PatentDe  


Dokumentenidentifikation DE69130724T2 17.06.1999
EP-Veröffentlichungsnummer 0480525
Titel Verfahren zur Gewinnung von rekombinantem Hepatitis B Virus (HEP B) Oberflächeantigen
Anmelder Centro de Ingenieria Genetica y Biotecnologia, Cubanacan Playa, Havana, CU
Erfinder Muzio Gonzalez, Verena Lucila, Plaza de la Revolucion, Habana, CU;
Penton Arias, Eduardo, Playa, Habana, CU;
Palou, Garcia, Manuel, Plaza de la Revoluci n, Habana, CU;
Fontirrochi Escobar, Giuvel, Eden, Camagüey, CU;
Nazabal Galvez, Marcelo, Puentes Grandes Playa Habana, CU;
Gonzalez Griego, Marta de Jesus, Lawton, 10 de Octubre Habana, CU;
Beldarrain Iznaga, Alejandro, Santa Felicia, Marianao, Habana, CU;
Padron Gonzalez, Guillermo Julio, Cubanacan, Playa, Habana, CU;
Ramirez Albajes, Victoria, Playa Habana, CU;
Garcia Pena, Arnaldo, Playa, Habana, CU;
Ruiz Cruz, Carlos Enrique, Habana, CU;
Izquierdo Lopez, Gladys Mabel, Vibora, 10 de Octubre, Habana, CU;
Herrera Martinez, Luis Saturnino, Playa, Habana, CU;
Duarte Cano, Carlos Antonio, entre Cubay San Ignacio, Centrr Habana, CU;
Perez Suarez, Lilia Luisa, Cubanacan, Playa, Habana, CU;
Garcia Suarez, Jose San Rafael No. 1203, Habana, CU;
de la Riva de la Riva, Gustavo Alberto, Vibora, Habana, CU;
Santiago Avila, Ramon Alexis, Lisa, Habana, CU;
Ayon Zorilla, Filiberto Rosendo, Havana, CU;
Paez Meireles, Rolando, La Habana, CU;
Agraz Fierro, Alberto, Cubanacan, Playa, C. de la Habana, CU;
Diaz Betancourt, Raul E., Cubanacan, Playa, C. de la Habana, CU;
Quinones Maya, Yair, Cubanacan, Playa, C. de la Habana, CU
Vertreter Weser & Kollegen, 81245 München
DE-Aktenzeichen 69130724
Vertragsstaaten AT, BE, CH, DE, DK, ES, FR, GB, GR, IT, LI, LU, NL, SE
Sprache des Dokument En
EP-Anmeldetag 07.10.1991
EP-Aktenzeichen 912026150
EP-Offenlegungsdatum 15.04.1992
EP date of grant 07.01.1999
Veröffentlichungstag im Patentblatt 17.06.1999
IPC-Hauptklasse C12P 21/02
IPC-Nebenklasse C12N 5/12   C12P 21/08   A61K 39/29   

Beschreibung[de]

Die vorliegende Erfindung betrifft das Gebiet der Gentechnik und Biotechnologie und insbesondere die Herstellung von Impfstoffen gegen Hepatitis B-Virus.

Die Infektion mit Hepatitis B-Virus stellt weltweit ein erhebliches Gesundheitsproblem dar, da sie nicht nur eine akute Erkrankung hervorruft, sondern auch chronische Formen, Leberzirrhose und -insuffizienz und hepatozelluläres Karzinom hervorrufen kann. Man rechnet, daß es weltweit etwa 200 Millionen chronische Virus-Träger gibt, die das Hauptreservoir für dieses infektiöse Agens darstellen.

Derzeit gibt es keine wirksame Behandlung gegen das Virus, so daß eine Prophylaxe den einzigen Weg darstellt, die Verbreitung des Virus zu beschränken und die Infektionsfälle zu verringern.

Es gibt zwei Hauptstrategien für die Herstellung von Impfstoffen gegen Hepatitis B-Virus: aus Plasma abgeleitete Impfstoffe und durch gentechnische Verfahren hergestellte Impfstoffe.

Die aus Plasma abgeleiteten Impfstoffe beruhen auf der Reinigung von HBsAg aus dem Plasma von chronischen Virus-Trägern durch verschiedene physikalische Verfahren und Inaktivierung des Virus (A.J. Zückerman et al., British Medical Journal, Bd. 290 (1985), S. 492). Die Impfstoffe haben sich seit Jahren als wirksam und sicher erwiesen (A.M. Prince et al., Annual Clinical Research, Bd. 14 (1982), S. 225) und wurden nicht mit der Gefahr einer Übertragung von HIV oder anderen infektiösen Agentien in Verbindung gebracht (F. Deinhardt et al., Journal of Medical Virology, Bd. 17 (1985), S. 209).

Jedoch wird die umfassende Verwendung dieses Impfstoffes durch die begrenzte Verfügbarkeit von Seren von Virus-Trägern zur Gewinnung des für die Herstellung des Impfstoffes verwendeten HBsAg, die Notwendigkeit von streng einzuhaltenden Verfahrensmaßnahmen zur Reinigung und Inaktivierung des Hepatitis B-Virus und zur Entfernung von anderen infektiösen Ägentien, die in Plasma vorhanden sein können, sowie durch längere Sicherheitstests, die für die Klärung der Ansätze von Impfstoffen notwendig sind, beeinträchtigt. Außerdem besteht die besondere Befürchtung, daß infektiöse Agentien, die durch Blut übertragbare Krankheiten verursachen können, während der Herstellung des Impfstoffes den Inaktivierungsvorgang verlassen können, so daß eine allgemeine Tendenz dahingehend besteht, von Blut abgeleitete Produkte durch Produkte zu ersetzen, die durch gentechnische Maßnahmen erhalten worden sind.

Hepatitis B-Virus-Oberflächenantigen wurde geklont und in prokaryontischen und eukaryontischen Zellen exprimiert.

In Bakterien sind die erzielten Expressionsgrade nieder und ein wirksamer Einbau des Antigens in immunogene Teilchen von 22 nm findet nicht statt, was der Grund dafür ist, daß dieses System nicht als Antigenquelle für die Herstellung von Impfstoffen verwendet wird (P. Valenzuela et al., Nature, Bd. 280 (1980), S. 8151 C.J. Burrell et al., Nature, Bd. 279 (1979), S. 43).

Ferner wurden eukaryontische Zellen bei der Herstellung von HBsAg verwendet (M.L. Michel et al., Biotechnology, Bd. 3 (1985), S. 561; G. M. MacNab et al., British Journal of Cancer, Bd. 36 (1976), S. 509). Jedoch erfordert die Herstellung von Impfstoffen unter Anwendung dieses Verfahrens eine komplizierte und kostspielige Einrichtung, Methodik und Nährmedien und bringt Probleme bei der Herstellung in größerem Maßstab mit sich. Es bestehen auch Befürchtungen bezüglich der Sicherheit von Impfstoffen, die von tumorigenen Säugetier-Zellinien abgeleitet sind, was auf die Gefahr der Anwesenheit von Retroviren zurückzuführen ist. Obgleich das erhaltene Antigen ähnliche Eigenschaften wie das natürliche Antigen aufweist, wurde dieses Verfahren ebenfalls nicht zur Massenproduktion dieses Impfstoffes herangezogen.

Das gentechnisch bearbeitete Kuhpocken-Virus macht es möglich, rekombinante Viren, die HBsAg allein oder in Kombination mit anderen Antigenen exprimieren, für die Herstellung von Lebendimpfstoffen gegen infektiöse Agentien zu erhalten (C. Cheng et al., Journal of Virology, Bd. 60 (1986), S. 337; E. Paoletti et al., Proceedings of the National Academy of Sciences USA, Bd. 81 (1984), S. 193). Die auf diese Weise erhaltenen Impfstoffe sind für die großtechnische Anwendung beim Menschen aufgrund zahlreicher technischer und ethischer Überlegungen noch nicht zugelassen.

Die rekombinanten Impfstoffe gegen Hepatitis B, die im Handel verfügbar sind, beruhen grundlegend auf der Herstellung von HBsAg durch gentechnisch manipulierte Hefen.

Die Hefe Saccharomyces cerevisiae wurde in breitem Umfang für die Herstellung von biologisch aktiven heterologen Proteinen für ein breites Anwendungsgebiet (S.M. Kingsman et al., Tictech, Bd. 5 (1987), S. 53) und zur Herstellung von HBsAg in großen Mengen (W.J. McAleer et al., Nature, Bd. 307 (1984), S. 178; N. Harford et al., Postgraduate Medical Journal, Bd. 63 Suppl. 2 (1987), S. 65; G.A. Bitter et al., Journal of Medical Virology, Bd. 25 (1988), S. 123) eingesetzt.

Das erhaltene Antigen wird intrazellulär gebildet und durch verschiedene Verfahren zum Aufbrechen von Zellen extrahiert und durch verschiedene physikochemische Verfahren gereinigt, die es ermöglichen, Reinheitsgrade von mehr als 97% zu erzielen, und zwar bei einem Produkt, das ein ähnliches antigenes Verhalten wie das Plasma-Antigen zeigt, wie bei Tieren und Menschen nachgewiesen worden ist (P. Hauser et al., Postgraduate Medical Journal, Bd. 63 Suppl. 2 (1987), S. 83).

Kürzlich wurde über ein wirksames Expressionssystem berichtet, das sich der methylotrophen Hefe Pichia pastoris als Wirt bedient und das auf der Verwendung des Promotors des Gens für das Enzym Alkohol-oxidase I, dem ersten Enzym, das beim Stoffwechselweg zur Verwertung von Methanol durch diese Hefe beteiligt ist, basiert. Dieser Promotor wird streng reguliert und ermöglicht es, hohe Konzentrationen des Enzyms (bis zu 30%) zu exprimieren, wenn die Zellen in Gegenwart von Methanol und nicht in Gegenwart von Glucose wachsen (S.B. Ellis et al., Molecular and Cellular Biology, Bd. 5 (1985), S. 1111; R. Couderc et al., Agrio. Biol. Chem., Bd. 44 (1980), S. 2259).

Die Hefe P. pastoris wurde bereits zur Expression von verschiedenen heterologen Proteinen, einschließlich HBsAg (J. M. Cregg et al., Biotechnology, Bd. 5 (1987), S. 479), in einem genetischen Konstrukt, bei dem das für HBsAg kodierende Gen unter den Regulationssignalen des Promotors des Enzyms Alkohol-oxidase I geklont wird, in einer Expressionskassette verwendet, die in das Chromosom eines mutanten Stammes dieser Hefe integriert ist, was es bei Aktivierung des Systems in Gegenwart von Methanol ermöglicht, daß 2-3% des gebildeten löslichen Proteins HBsAg sind. Eine Reinigung des Antigens wird jedoch nicht beschrieben.

Ein wichtiger Vorteil, der sich beim Pichia pastoris-System im Vergleich zum S. cerevisiae-System ergibt, besteht im sehr wirksamen Einbau des Antigens in Teilchen von 22 nm, da praktisch das gesamte Antigen in Teilchenform erzeugt wird, im Gegensatz zur Situation bei S. cerevisiae, wo nur ein geringer Teil des Monomeren mit 24 kDa in die Antigenteilchen eingebaut wird (P. Valenzuela et al., Nature, Bd. 298 (1982), S. 347; R. A. Hitzeman et al., Nucleic Acids Research, Bd. 11 (1983), S. 2745; A. Miyanohara et al., Proceedings of the National Academy of Sciences USA, Bd. 80 (1983), S. 1). Dennoch bedienen sich die derzeit marktüblichen Impfstoffpräparate auf der Basis von rekombinantem HBsAg der Hefe S. cerevisiae als Quelle.

Andererseits werden bei den gebräuchlichsten Reinigungsverfahren für Hepatitis B-Oberflächenantigen aus Hefe Verfahren der Dichtegradientenzentrifugation angewandt (EP-278 940-A3, Smith Kline), deren Durchführung im großtechnischen Maßstab teuer und kompliziert ist.

In EP-A-337 492 (Phillips Petroleum) wird ein Verfahren zur Gewinnung von Hepatitis B-Oberflächenantigen aus einem rekombinanten Stamm von Pichia pastoris beschrieben. Obgleich der Zweck darin besteht, das Hepatitis B-Oberflächenantigen, in einem Zustand ausreichender Reinheit direkt in einen Impfstoff einzuverleiben, werden weder die Eigenschaften des Antigens in bezug auf die Teilchenbildung nach der Reinigung noch dessen immunogene Kapazität bei Einverleibung in ein Impfstoffpräparat beschrieben.

Das Phillips Petroleum-Verfahren umfaßt die Lysis der Hefezellen in Gegenwart eines chaotropen Salzes und die Trennung des Überstands, der das Antigen enthält, vom lysierten Zellpellet; die Fällung von Lipiden und kontaminierenden Proteinen vom Überstand bei einem pH-Wert von 4,5- 5,5 und die Entfernung des ausgefällten Rückstands; die Behandlung des Überstands durch Einengen und Diafiltration; das Kontaktieren des Retentats, das das Antigen enthält, mit Siliciumdioxid, das Auswaschen von kontaminierenden Proteinen aus dem Siliciumdioxid und das Eluieren des Hepatitis B-Oberflächenantigens mit einem Puffer mit einem pH-Wert von 9,5-11,0, der Harnstoff enthält; die Gelfiltration der entsprechenden Fraktion mit einem Material mit einer Molekulargewichtstrenngrenze, die sich zur Abtrennung der Hepatitis B-Oberflächenantigen-Teilchen von Verunreinigungen eignet; das Kontaktieren der entsprechenden Fraktion mit einem Anionenaustauscherharz und das Eluieren der Hepatitis B-Oberflächenantigen-Teilchen von dem Harz mit einem Puffer mit einem pH-Wert von 6-9.

Bei diesem Verfahren wird ein chaotroper Puffer für die Lysis/Extraktions-Stufe verwendet. Dieser Puffer enthält Kaliumthiocyanat als chaotropes Mittel und Phenylmethylsulfonylfluorid als Protease-Inhibitor. Diese letztgenannte Verbindung ist stark giftig, so daß es erforderlich ist, während des Reinigungsverfahrens sämtliche Spuren davon zu beseitigen. Ferner ist diese Substanz zwar bei der Proteasehemmung wirksam, jedoch ist ihr Hemmspektrum begrenzt.

Anschließend wird der das HBsAg enthaltende Überstand diafiltriert, und diese Fraktion wird mit Siliciumdioxid kontaktiert. Um die Trennung von Hepatitis B-Oberflächenantigen vom Siliciumdioxid durchzuführen, wird ein harnstoffhaltiger Puffer mit einem pH-Wert im Bereich von 9,5 bis 11 verwendet. Diese Verbindung wirkt stark denaturierend und ihre Verwendung kann zu einem Verlust von immunogenen Eigenschaften des erhaltenen Produkts führen.

Die vorliegende Erfindung stellt ein neues Reinigungsverfahren bereit, das die Gewinnung eines rekombinanten Antigens aus Pichia pastoris sicherstellt, wobei das Antigen durch einen hohen Grad an Teilchenbildung und Homogenität gekennzeichnet ist, was dem Produkt überlegene immunogene Eigenschaften verleiht.

Die Erfindung besteht in einem Verfahren zur Gewinnung von Hepatitis B-Oberflächenantigen aus Pichia pastoris-Zellen, die ein für Hepatitis B- Oberflächenantigen kodierendes Gen enthalten und die dieses Gen exprimiert haben, wobei das Verfahren folgende Stufen umfaßt:

die Zellen werden in Gegenwart eines Puffers, der ein chaotropes Mittel, Saccharose und Ethylendiamintetraessigsäure (EDTA) enthält, lysiert;

Verunreinigungen werden bei einem sauren pH-Wert ausgefällt;

das Antigenpräparat wird einer sauren Adsorptionsbehandlung und einer alkalischen Desorptionsbehandlung an einer Matrix von Diatomeenerde unterworfen;

das Antigenpräparat wird einer Immunoaffinitätschromatographie unter Verwendung eines für Hepatitis B-Oberflächenantigen spezifischen monoklonalen Antikörpers unterworfen;

das eluierte Antigen wird einer Wärmebehandlung bei einer Temperatur von 30-40ºC unterworfen;

das Antigen wird in einer Anionenaustauschersäule mit einem Detergens gewaschen; und

das eluierte Antigen wird einer Hochleistungsflüssigchromatographie (HPLC) in Gegenwart eines Detergens unterworfen.

Erfindungsgemäß ist es bevorzugt, daß die Lysis der Zellen in Gegenwart eines Puffers durchgeführt wird, der Kaliumthiocyanat, Saccharose, EDTA, Tris und NaCl enthält. Insbesondere wird die Lysis der Zellen in Gegenwart eines Puffers durchgeführt, der 1-4 M Kaliumthiocyanat, 1-15% (Gew./Vol.) Saccharose, 2,5-3,5 mM EDTA, 10-30 mM Tris und 0,1-1 M NaCl enthält und vorzugsweise im wesentlichen aus 291 g/Liter Kaliumthiocya nat, 100 g/Liter Saccharose, 1,86 g/Liter EDTA, 12 g/Liter Tris und 17,5 g/Liter NaCl besteht.

Ferner ist es erfindungsgemäß bevorzugt, daß die Säurefällung der Verunreinigungen bei einem pH-Wert von 3-4 durchgeführt wird.

Gegebenenfalls kann das nach der Entfernung des bei der Säurefällungsstufe gebildeten Niederschlags erhaltene Antigenpräparat bei einem pH-Wert von 7-8 gelagert werden.

Vorzugsweise wird das nach der Entfernung des bei der Säurefällungsstufe gebildeten Niederschlags erhaltene Antigenpräparat bei einem pH-Wert von 3-5 mit einer Matrix von Diatomeenerde in Kontakt gebracht, um das Antigen zu adsorbieren, wobei die Verunreinigungen mit einem Elutionspuffer mit einem pH-Wert von 3-5 eluiert werden und anschließend eine Desorption des Antigens bei einem pH-Wert von 7,5-9,0 erfolgt.

Gegebenenfalls kann das von der Diatomeenerde desorbierte Antigenpräparat herkömmlichen Einengungs- und Entsalzungsbehandlungen unterworfen werden, wobei es beispielsweise durch Ultrafiltration eingeengt und durch Diafiltration entsalzt wird.

Erfindungsgemäß ist es bevorzugt, daß es sich bei dem bei der Immunoaffinitätschromatographiebehandlung des Antigenpräparats verwendeten monoklonalen Antikörper um einen monoklonalen Antikörper handelt, der in bezug auf seine hohe Affinität gegenüber antigenen Hepatitis B-Oberflächenantigen-Teilchen ausgewählt ist. Insbesondere handelt es sich bei dem bei der Immunoaffinitätschromatographiebehandlung des Antigenpräparats verwendeten monoklonalen Antikörper um anti-HBsAg CB-HEP1, das durch die Hybridom-Zellinie ECACC 90 112 606 erzeugt worden ist.

Vorzugsweise wird das Antigen von der Immunoaffinitätschromatographiesäule mit einem Puffer, der ein chaotropes Mittel enthält, eluiert.

Erfindungsgemäß ist es bevorzugt, daß die Wärmebehandlung des eluierten Antigens bei 30-40ºC für 1-6 Stunden durchgeführt wird.

Nach der Wärmebehandlung wird das Antigen vorzugsweise in einer DEAE-Cellulosesäule mit einem Detergens, wie Natriumdesoxycholat oder Triton X-100 gewaschen. Das Detergens wird in einer Konzentration von 0,01-0,5 Gew.-% und vorzugsweise von 0,05-0,1 Gew.-% verwendet. Anschließend wird das Antigen eluiert.

Das eluierte Antigen wird anschließend vorzugsweise einer HPLC-Behandlung mit einer Trenngrenze zwischen 20 000 und 10 000 000 in Gegenwart eines Detergens, wie Natriumdesoxycholat, unterworfen. Das Detergens wird in einer Konzentration von 0,01-0,5 Gew.-% und vorzugsweise von etwa 0,05 Gew.-% verwendet.

Erfindungsgemäß ist es bevorzugt, daß das Hepatitis B-Oberflächenantigen aus dem rekombinaten Pichia pastoris-Stamm C226 [pTA0906], CBS450.90, gewonnen wird.

Nachstehend wird die Erfindung ausführlich erläutert.

Die erste Stufe des Verfahrens besteht in der Lysis der Zellen mit einem Puffer, der EDTA, Tris, NaCl, Saccharose und Kaliumthiocyanat enthält. Bei dieser Stufe ist die Anwesenheit von EDTA wichtig, das einen Protease-Inhibitor mit einem weiten Hemmspektrum darstellt und das ferner vollständig bioverträglich ist. Die Saccharose hält den Konformationszustand des Moleküls aufrecht und gewährleistet dessen Halbwertszeit. Kaliumthiocyanat stellt ein herkömmliches chaotropes Mittel dar, wobei aber auch an dessen Stelle andere Mittel verwendet werden können.

Nach dem Aufbrechen der Zellen wird die Abtrennung der Bruchstücke gleichzeitig mit einer Säurefällung von verunreinigenden Proteinen unter Anwendung eines pH-Bereichs von 3 bis 4 durchgeführt. Dieser Vorgang ermöglicht es, die Anzahl an Stufen während des Reinigungsvorgangs zu verringern und gleichzeitig das Verfahren mit einem Material von hoher Reinheit (mehr als 10% Antigen) und mit guter Ausbeute einzuleiten. Ferner gewährleistet diese Stufe die Beseitigung von verunreinigenden Lipiden, Kohlenhydraten und DNA. Nach der Zentrifugation kann der das Antigen enthaltende Überstand bei einem pH-Wert von 7 bis 8 gelagert werden. Zur Durchführung der anschließenden Reinigung wird der pH-Wert des Präparats erneut auf einen Wert von 3 bis 5 gesenkt. Anschließend läßt man das Präparat in Kontakt mit einer Celite-Matrix kommen, an der das Antigen adsorbiert wird. Die Matrix wird mit einer gepufferten Lösung mit einem pH-Wert von 3 bis 5 (Tris-HCl, Kaliumthiocyanat, Saccharose und EDTA) gewaschen, um Verunreinigungen, wie Kohlenhydrate, Lipide und DNA, zu entfernen. Das Antigen wird von der Matrix durch eine pH-Änderung gewonnen, wobei man einen Puffer mit einem pH-Wert von 7,5 bis 9,0 verwendet. Diese Stufe stellt sicher, daß das Antigen mit einer Reinheit von 40 bis 50% gewonnen wird, ohne daß die Gefahr einer Denaturierung oder eines Verlustes der besonderen Beschaffenheit des Antigens besteht, da während dessen Elution milde Bedingungen angewandt werden.

Das das Antigen enthaltende Elutionsmittel, das von Celite absorbiert worden ist, wird durch Ultrafiltration unter Verwendung einer Membran von 0,1 um 30- bis 40-fach eingeengt. Anschließend wird das Präparat mit 3 Volumina eines geeigneten Puffers (Tris · HCl, EDTA, pH-Wert zwischen 7 und 8) diafiltriert und sodann einer weiteren Reinigungsstufe durch Immunoaffinitätschromatographie unter Verwendung von monoklonalen Antikörpern, die einem speziellen Screening zur Auswahl von antigenen Teilchen unterzogen worden sind, unterworfen. Diese monoklonalen Antikörper werden zur Vermeidung von belastenden Behandlungen und möglicherweise zur Erkennung von speziellen Epitopen mit bestimmten immunogenen Eigenschaften verwendet, wie es bei Schimpansen gezeigt wurde (H. Schellekens, A. De Reus, J.H. Peetermans und P.A.C.M. Van Eerd, Postgraduated Medical Journal, Bd. 63 Suppl. (2) (1987), S. 93-96). Die in der vorstehenden Stufe erhaltene Fraktion mit einem Gehalt an HBsAg wird auf die Affinitätssäule, die in einem geeigneten Puffer, wie Tris-HCl, Kalium- oder Natriumphosphat, bei einem pH-Wert zwischen 6 und 7 und einer Strömungsgeschwindigkeit von 25 bis 50 cm/h äquilibriert worden ist, aufgesetzt. Die nicht-adsorbierten Fraktionen in der Säule (verunreinigende Substanzen) werden unter Verwendung des Äquilibrierungspuffers unter Zusatz von 1 M NaCl ausgewaschen. Das Antigen wird von der Säule unter Verwendung eines Puffers, wie Tris-HCl oder Phosphat mit einem Gehalt an Kaliumthiocyanat in einem Bereich von 1 bis 3 M, gewonnen. Das in dieser Stufe erhaltene Material weist einen Reinheitsgrad von mehr als 85% auf.

Ein weiterer neuer Aspekt dieses Verfahrens besteht darin, daß das in der vorstehenden Stufe erhaltene Elutionsmittel, das das Antigen enthält, für eine Zeitspanne von 1 bis 6 Stunden einer Wärmebehandlung bei 30 bis 40ºC und vorzugsweise bei 37ºC unterworfen wird. Diese Stufe ermöglicht eine hohe Ausbeute an homogenen Teilchen von 22 nm, die eine stark immunogene Beschaffenheit zeigen. Speziell wird diese Tatsache in der nächsten Stufe gezeigt, die aus einem Tonenaustausch an DEAE-Cellulose besteht, wobei bei dieser Stufe diese Teilchen mit einem starken Peak bei 175 mM NaCl eluiert werden und sich diese Fraktion von den übrigen Fraktionen, die teilchenförmige Formen des Antigens mit geringerer antigener Aktivität enthalten, unterscheidet.

Die das Antigen enthaltende eluierte Fraktion wird sodann durch Gelfiltrationschromatographie mit einem geeigneten Puffer (Tris-HCl- oder Phosphatpuffer) in einem pH-Bereich von 7 bis 7,5 entsalzt. Anschließend wird dieses Material auf eine Ionenaustauschersäule, wie DEAE-Cellulose, aufgesetzt, und das Harz wird mit unterschiedlichen Konzentrationen an NaCl im Bereich von 10 bis 50 mM und Detergentien, wie Natriumdesoxycholat und Triton X-100, in Konzentrationen von 0,05 bis 0,1% gewaschen.

Diese Waschvorgänge gewährleisten die Beseitigung von verunreinigender DNA und Endotoxinen. Das Antigen wird von der Säule unter Verwendung einer NaCl-Lösung von 150 bis 200 mM und Kaliumthiocyanat gewonnen. Dieses Präparat ist vollkommen frei von DNA und weist einen Reinheitsgrad von mehr als 95% auf.

Das eluierte Antigen wird unter Verwendung eines Ultrafiltrationssystems mit Membranen mit einer Trenngrenze von 100 000 Dalton bis zu einer Proteinkonzentration im Bereich von 1 bis 3 mg/ml eingeengt. Ein Detergens, wie Natriumdesoxycholat, wird in einer Konzentration von 0,05% zum Präparat gegeben. Anschließend wird das Konzentrat einer hochauflösenden Gelfiltrationschromatographie mit einem Funktionsbereich von 10 000 000 bis 20 000 Dalton (PW 5000 oder PW 6000) unterworfen. Die Säule wird mit einem Puffer mit einem Gehalt an 0,05% Natriumdesoxycholat äquilibriert. Die Anwesenheit von Detergens während dieses Vorgangs verringert den Endotoxingehalt des antigenen Präparats auf weniger als 0,4 ng/ug Antigen und ermöglicht die Abtrennung von nicht in geeigneter Teilchenform vorliegenden Fraktionen.

Das erhaltene Antigen wird erneut in einer Gelfiltrationssäule mit einem geeigneten Puffer entsalzt, um eine Adjuvansbehandlung in. Aluminiumhydroxidgel zur Verwendung in einem Impfstoffpräparat vorzunehmen.

Die Bestätigung der überlegenen immunogenen Eigenschaften des unter Einsatz der vorerwähnten Verfahrens erhaltenen Impfstoffpräparats beruht auf den Ergebnissen von kontrollierten vorklinischen Tests, die nach einem strengen Doppelblindsystem vorgenommen wurden.

Mit dem erfindungsgemäß vorgeschlagenen Verfahren ist es möglich, ein Produkt zu erhalten, das gegenüber anderen gleichartigen, handelsüblichen Produkten bei Einsatz beim Menschen eine überlegene Qualität als Immunogen aufweist.

Praktische Beispiele Beispiel 1

Um das Hepatitis B-Virus-Oberflächenantigen-Gen zu erhalten, wurde virale DNA in die EcoRI-Stelle von pBR322 geklont. Das virale Genom wurde aus Dane-Teilchen, die aus dem Serum eines asymptomatischen Virus-Trägers gemäß einem ähnlichen Verfahren erhalten, wie es von P. Valenzuela et al., Nature, Bd. 280 (1979), S. 815, beschrieben wurde, isoliert und gereinigt worden waren. Das erhaltene Plasmid mit der Bezeichnung pHBS1 wurde mit den Enzymen EcoRI und HpaI unter Bildung eines Fragments verdaut, das wiederum mit dem Enzym TaqI verdaut wurde. In diesem Zustand wurde ein EcoRI-Linker (5'-GGAATTCC-3') in die EcoRI-Stelle von pBR322 ligiert und subkloniert. Das erhaltene Plasmid erhielt die Bezeichnung pHBS2. Daraus wurde das Fragment, das das HBsAg-Gen enthält, durch Verdauung mit EcoRI und Behandlung mit S&sub1;-Nuclease erhalten.

Dieses Fragment wurde in den Vektor pBS5 (Fig. 1), der vorher mit NcoI linearisiert und mit S&sub1;-Nuclease und alkalischer Phosphatase behandelt worden war, subkloniert. Das erhaltene Plasmid erhielt die Bezeichnung pPCAS3 (Fig. 2), in dem die nicht-kodierenden viralen Regionen an den 5' (25 bp)- und 3' (125 bp)-Enden, die dieses Gen flankierten, durch Polymerase-Kettenreaktion (PCR) unter standardmäßigen Reaktionsbedingungen beseitigt wurden (R.K. Saiki et al., Science, Bd. 230 (1985), S. 1350).

Unter Verwendung von zwei synthetischen Oligonucleotiden der folgenden Sequenzen:

5'-Region: 5' GCCATGGAGAACATCACAT 3' (SEQ ID NO: 1)

3'-Region: 3' GACCCATATGTAAATTTGCAGCTGG 5' (SEQ ID NO: 2),

wurden NcoI- und SalI-Restriktionsstellen am 5'- bzw. am 3'-Ende des Gens geschaffen, die eine anschließende einfache Manipulation und die Beseitigung der nicht-kodierenden Regionen bei Verdauung des amplifizierten Fragments mit den vorerwähnten Enzymen ermöglichten. Das erhaltene Fragment von 678 bp, das das genaue HBsAg-Gen enthielt, wurde in das Plasmid pBS5 subkloniert. Das erhaltene Plasmid mit der Bezeichnung pPCB6 (Fig. 3) enthält das Gen unter den Transkriptionsregulationssignalen des Gens für das Enzym Glycerinaldehyd-3-phosphat-dehydrogenase (GAP) von S. cerevisiae.

Aus dem Plasmid pCAO10, das aus der DNA-Bank von Pichia pastoris erhalten worden war (Fig. 4), wurde das 1,1 kb-Fragment, das den Promotor des Gens für das Enzym AOX1 sowie eine nicht-kodierende 5'-Region enthielt, extrahiert und in das Plasmid pBR322 subkloniert. Mit dem erhaltenen Plasmid pPAO23 (Fig. 5) wurde die Polymerase-Kettenreaktionstechnik mit dem Zweck durchgeführt, 18 bp vom Strukturgen für das Enzym AOX1 zu beseitigen, die den in diesem Konstrukt vorhandenen Codons, die für die ersten 6 Aminosäuren dieses Proteins kodieren, entsprechen.

Folgende Oligonucleotide wurden verwendet:

5'-Region: 5' GTATCACGAGGCCCT 3' (SEQ ID NO: 3)

3'-Region: 3' TTGATTAATAAGCTTTGGTACCGC 5' (SEQ ID NO: 4).

Das Oligonucleotid der 3'-Region erlaubt es, eine NcoI-Stelle am 3'- Ende des Promotors des Gens für das Enzym AOX1 zu schaffen, um die Se quenz von 18 bp des Strukturgens für dieses Enzym zu beseitigen und um eine exakte Bindung an das HBsAg-Gen zu erreichen. Das Oligonucleotid der 5'-Region erlaubt es, die EcoRI-Stelle von pBR322 beizubehalten.

Das amplifizierte Fragment von 1115 bp wurde in das Plasmid pUC19 subkloniert, was zum Plasmid mit der Bezeichnung pMAO107 (Fig. 6) führte, das den perfekten Promotor des Gens für das Enzym AOX1 von P. pastoris enthält.

Der endgültige Integrationsvektor wurde durch Subklonieren des exakten Gens für HBsAg unter dem perfekten Promotor des Enzyms AOX1 erhalten (Fig. 7). Der erhaltene Klon mit der Bezeichnung pHAO112 enthält das Gen für HBsAg unter dem Regulationssignal des AOX1-Promotors und dem Terminationssignal des GAP-Gens von S. cerevisiae, in dem sich auch eine Region von chromosomaler DNA von P. pastoris befindet, die für die homologe Rekombination mit der Hefe erforderlich ist. Durch partiellen Verdau und Behandlung mit S&sub1;-Nuclease dieses Plasmids wurde die SalI-Stelle, die sich zwischen dem 3'-Ende des HBsAg-Gens und dem Terminator des Enzyms Glycerinaldehyd-3-phosphat-dehydrogenase befand, zerstört. Der erhaltene Klon erhielt die Bezeichnung pSAO503 (Fig. 8). Er wurde in das 2,4 kb- Fragment subkloniert, das ein Fragment des Strukturgens für das Enzym AOX1 sowie die flankierende, nicht-kodierende 3'-Region enthielt, das aus dem Plasmid pCAO10 erhalten wurde. Das gebildete Plasmid erhielt die Bezeichnung pVA0721 (Fig. 8), in das das 1,8 kb-Fragment geklont wurde, das das his3-Gen von S. cerevisiae aus dem Plasmid pPMC (Fig. 9) enthielt.

Der erhaltene Klon pTAO906 (Fig. 10) ergab das endgültige Integrationsplasmid, das für die Transformation des Stammes P. pastoris MP36 (EP- A-0 438 200) verwendet wurde. Die Individuen, die klare Integrationsmuster zeigten, wurden für die Bewertung der Antigen-Expressionsgrade herangezogen. Der für die Antigen-Erzeugung ausgewählte Stamm trug die Bezeichnung C226.

Es wurde eine Hinterlegung von Pichia pastoris C226 [pTA0906] gemäß dem Budapester Vertrag am 22. Oktober 1990 beim Centraal Bureau voor Schimmelcultures (CBS), Baarn, Niederlande, unter der Hinterlegungsnummer CBS 450.90 vorgenommen.

Beispiel 2

Um die Synthese von HBsAg zu erreichen, wurde der transformierte Stamm C226 in einem Vorinokulumstadium in einem Salzmedium der nachstehend angegebenen Zusammensetzung gezüchtet:

K&sub2;HPO&sub4; 5 g/l

MgSO&sub4; 4,6 g/l

(NH&sub4;)&sub2;SO&sub4; 22 g/l

CaCl&sub2; 0,5 g/l

Glycerin 20 ml/l

Vitamine 200 · 10 ml/l

Spurenelemente 200 · 5 ml/l

Das Wachstum erfolgt bei einer Temperatur von 30ºC und einem pH-Wert von 4,5 unter solchen Lüftungs- und Bewegungsbedingungen, das ein Sauerstoffpartialdruck von mehr als 30% des Sättigungswerts gewährleistet ist. Die Kultur wird 10 bis 12 Stunden gezüchtet.

Im Inokulumstadium erfolgt ein Austausch des Salzmediums durch ein reiches Medium der nachstehend angegebenen Zusammensetzung:

Hefeextrakt 1%

Pepton 2%

Glycerin 2%

Spurenelemente 200 · 10 ml/l

Vitamine 200 · 5 ml/l

Die Kultur wird 10-12 Stunden unter diesen Bedingungen gehalten, bis eine Zellkonzentration von 10-12 g/Liter (auf der Basis der Trockenbestandteile) erreicht ist, um die Fermentation zu inokulieren. Die Fermentation wird im gleichen reichen Medium und unter identischen Temperatur- und pH-Bedingungen durchgeführt. Die Kultur wird 8-10 stunden belassen, bis eine Zellkonzentration von 10-12 g/Liter (auf der Basis der Trockenbestandteile) erreicht ist.

Von diesem Zeitpunkt an erfolgt eine kontinuierliche Zugabe von Methanol, um die Expression des Antigens zu induzieren, die nach 90- bis 100-stündiger Züchtung etwa 3% des Gesamtproteins erreicht. Diese Zugabe wird in zeitlichen Abständen entsprechend der Zunahme der Zellkonzentration im Medium gesteigert. Nach Ablauf dieser Zeitspanne wird mit einer Kulturvermehrung mit einem reichen Medium der nachstehend angegebenen Zusammensetzung begonnen:

Hefeextrakt 3%

Pepton 6%

Diese Vermehrung wird bis zum Ende der Züchtung, die 180-200 Stunden dauert, aufrechterhalten, wobei sich die spezifische Wachstumsgeschwindigkeit 5-fach steigert und die Expressionsgrade ansteigen. Ein Ergebnis dieses Verfahrens besteht auch darin, daß das auf diese Weise exprimierte Protein zu mehr als 80% in löslicher Form gehalten wurde. Dieser Faktor bewirkt einen höheren Wirkungsgrad in den anschließenden Reinigungsstufen sowie eine verbesserte Teilchenbildung des Antigens.

In der letzten Fermentationsstufe wird eine Konzentration der Biomasse von 60 bis 80 g/Liter (auf Basis der Trockenbestandteile) erreicht. Die Antigen-Expressionsgrade erreichen Werte von 2 bis 5% des gesamten Proteins.

Bei Beendigung der Fermentation werden die Zellen durch Zentrifugation in einem kontinuierlichen System gewonnen und bei 4ºC nach Waschen mit sterilem Wasser unter Verwendung des gleichen Zentrifugationssystems in Form eines cremeartigen Produkts bei 4ºC gelagert.

Beispiel 3

Um ein für die säulenchromatographische Verarbeitung geeignetes HBsAg-Präparat zu erhalten, wurde der rohe Extrakt, der durch mechanisches Aufbrechen der Biomasse, die durch Zentrifugation der Kultur der mit dem für das Antigen kodierenden Gen transformierten Hefe gewonnen worden war, dem folgenden Reinigungsverfahren unterzogen.

Die Zellkonzentration des gewaschenen cremeartigen Produkts wurde mit destilliertem Wasser auf 100 g/Liter eingestellt. Zur Bildung eines Aufbrechpuffers wurden die folgenden Substanzen zugesetzt:

Trishydroxymethylaminomethan - 12,1 g/l

Saccharose - 100 g/l

NaCl - 17,5 g/l

EDTA - 1,86 g/l

KSCH - 291 g/l

Der pH-Wert wurde mit 1 N HCl auf 7,5 bis 8,0 eingestellt.

Diese Lösung wurde 5 Minuten homogenisiert und in einer Bettmühle einem mechanischen Aufbrechen der Zellen unterworfen.

Die aufgebrochenen Zellen wurden einem Klärungsverfahren, das auf der Stabilität von HBsAg unter extremen pH-Bedingungen beruhte, unterworfen, wobei zahlreiche verunreinigende Proteine der Wirtshefe ausgefällt wurden, während das Antigen in der Lösung verblieb.

Die Klärung des Aufbrechextraktes durch Fällung von Verunreinigungen bei einem sauren pH-Wert wurde gemäß dem folgenden Verfahren durchgeführt:

Das Homogenisat von aufgebrochenen Zellen wurde unter kontinuierlichem Bewegen und Überwachen des pH-Werts auf eine Temperatur von 0 bis 4ºC abgekühlt und sodann unter Vermeidung von Schaumbildung rasch bei 9ºC mit einer Lösung von 1 N HCl in einer ausreichenden Menge vermischt, um den pH-Wert auf 2,5 bis 3 abzusenken. Nach 5-minütigem oder längerem Rühren wurde das Gemisch in einer kontinuierlichen Zentrifuge zentrifugiert, auf 4ºC gekühlt und 45 Minuten belassen. Die Behälter, aus denen das Material extrahiert und gewonnen wurde, wurden kühl gehalten. Der Überstand wurde unmittelbar nach dem Zentrifugieren unter konstantem Bewegen und Überwachen des pH-Werts wieder auf einen pH-Wert von 7,5 bis 8,5 gebracht.

Der pH-Wert des geklärten Überstands wurde erneut auf 4,0 abgesenkt. Sodann wurde etwa 1 Stunde mit einer Matrix von Celite (High Flow Supercell, Fluka) in einem ungefähren Anteil von 0,35 g des Antigens pro 1 kg der Matrix homogenisiert. Das Antigen wurde an der Matrix adsorbiert. Durch Zentrifugieren, Filtrieren oder Dekantieren wurde die Matrix vom nicht-adsorbierten Material, das verworfen wurde, abgetrennt. Sodann wurden 2 oder 3 Waschvorgänge des im Bett fixierten Antigens mit einer Pufferlösung der nachstehend angegebenen Zusammensetzung durchgeführt:

KSCH - 48,5 g/l

Saccharose - 100 g/l

Tris - 2,42 g/l

EDTA - 1,86 g/l

Der pH-Wert wurde mit 1 N HCl auf 4,0 eingestellt.

Nach den anschließenden Waschvorgängen wurde die Desorption des Antigens von der Matrix unter Verwendung eines Elutionspuffers der nachstehend angegebenen Zusammensetzung durchgeführt:

Tris - 2,42 g/l

EDTA - 1,12 g/l

Saccharose - 100 g/l

Der pH-Wert wurde mit 1 N NaOH auf 9,0 bis 9,5 eingestellt.

Das durch die Elution erhaltene Material wurde in eine Amicon-Konzentriervorrichtung (auf Hohlfaserbasis) mit einer Patrone mit einer Porengröße von 0,1 um eingeführt, um das anfängliche Volumen um einen Faktor von etwa 55 einzuengen. Der gesamte Vorgang wurde bei 9ºC durchgeführt.

Um die Reinigung des erhaltenen HBsAg zu beenden, wurden einige chromatographische Stufen gemäß den folgenden Angaben durchgeführt.

Etwa 2 Liter der konzentrierten Celite-Eluate wurden durch eine mit Sephadex G-25-Medium, das in 20 mM Tris-HCl-Puffer vom pH-Wert 8,0 expandiert und äquilibriert worden war, entsalzt. Der Ablauf des Entsalzungs vorgangs wurde durch Messen der Absorption bei 280 nm und der Leitfähigkeit kontrolliert.

Eine Immunoaffinitätsmatrix wurde hergestellt, die etwa 2 Liter mit CNBr aktivierte Sepharose CL-9B und etwa 10 g daran gebundenen monoklonalen Antikörper CB-HEP1 (erhalten durch CIGB gemäß Beispiel 4) enthielt, wobei der Antikörper spezielle Eigenschaften aufwies, die die Selektion von Antigenpopulationen mit stark immunogener Beschaffenheit ermöglichten. Die mit der vorstehenden Matrix gepackte Immunoaffinitätssäule wurde in 20 mM Tris-HCl-Puffer vom pH-Wert 8,0 äquilibriert. Eine Menge des entsalzten Celite-Eluatkonzentrats, das das Antigen in einem ungefähren Verhältnis von 0,1 mg HBsAg pro 1 ml Bett enthielt, wurde injiziert. Die Fließgeschwindigkeit betrug etwa 50 cm/h bei Umgebungstemperatur. Der Waschvorgang wurde mit einem Äquilibrierungspuffer durchgeführt. Der Fortschritt des Waschvorgangs wurde durch Messen der Absorption bei 280 nm unter graphischer Aufzeichnung kontrolliert. Das ausströmende Produkt wurde gesammelt, bis die Basislinie des Chromatogramms erreicht wurde. Anschließend wurde ein Puffer mit einem Gehalt an 20 mM Tris-HCl und 1 N NaCl vom pH-Wert 8,0 zur Beseitigung der nicht-spezifischen Adsorption bis zum erneuten Erreichen des Basiswerts durchgeleitet.

Das Antigen wurde mit einem Puffer mit einem Gehalt an 20 mM Tris- HCl, 3 M KSCH und 1 M NaCl vom pH-Wert 8,0 eluiert. Die Säule wurde sofort mit überschüssigem Äquilibrierungspuffer in Gegenwart von 0,01% Thimerosal bei 4ºC gewaschen, sofern sie für längere Zeit unbenutzt blieb.

Das von der Affinitätssäule eluierte HBsAg wurde 2 Stunden bei 37ºC in einem Wasserbad einer Wärmebehandlung unterzogen. Später wurde das Antigen in einer Sephadex G-25-Säule, die mit 20 mM Tris-HCl, 3 mM EDTA, pH-Wert 8,0, äquilibriert worden war, entsalzt.

In einer Säule, die DEAE-Cellulose (Whatman DE-52), die in Puffer mit einem Gehalt an 20 mM Tris-HCl und 3 mM EDTA vom pH-Wert 8,0 äquilibriert worden war, enthielt, wurden etwa 3 Liter des entsalzten Materials von der Immunoaffinitätssäule injiziert. Der Vorgang wurde bei 4ºC durchgeführt. Sodann wurden Waschvorgänge mit dem Äquilibrierungspuffer, der 20 mM Tris-HCl, 3 mM EDTA, 50 mM NaCl und 0,05% Na-Desoxycholat enthielt, durchgeführt. Der Vorgang wurde durch Messen der Absorption bei 280 nm unter graphischer Aufzeichnung kontrolliert. Das ausströmende Produkt wurde so lange gesammelt, bis auf dem Chromatogramm die Basislinie erreicht war. Das HBsAg wurde von der Säule unter Verwendung eines Puffers mit einem Gehalt an 20 mM Tris-HCl, 3 mM EDTA und 150 mM NaCl vom pH-Wert 8,0 gewonnen, wobei das ausströmende Produkt bis zum erneuten Erreichen des Basiswerts gesammelt wurde.

Die Fraktion, die von der Ionenaustauschersäule gemäß der vorstehenden Stufe erhalten worden war, wurde in einem Amicon-Hohlfasersystem (DC- 2) unter Verwendung einer Patrone mit einer Trenngrenze von 100 000 Dalton etwa 25-fach eingeengt. Sodann wurde das Konzentrat mit 0,05 g/100 ml Na-Desoxycholat versetzt. Die Inkubation wurde 1 Stunde bei 4ºC durchgeführt. Später wurde diese Fraktion auf eine PWG 6000-Säule, die in 20 mM Tris-HCl, 3 mM EDTA und 0,05% Na-Desoxycholat vom pH-Wert 8,0 äquilibriert worden war, aufgesetzt. Es wurde ein Hauptpeak erhalten, der das stark teilchenförmige Antigen, das frei von Monomeren oder Dimeren des gleichen Moleküls war, enthielt. Diese Fraktion wurde gewonnen und in einer in PBS vom pH-Wert 7,0 äquilibrierten G-25-Säule entsalzt. Dieses letzte Präparat von gereinigtem HBsAg wurde unter Verwendung einer Membran von 0,2 um für die Adjuvans-Behandlung in Aluminiumhydroxid steril filtriert.

Da das vorstehend erwähnte gereinigte Antigen als injizierbares Präparat bereitgestellt werden muß, wurden sämtliche strikten Maßnahmen ergriffen, die für die Herstellung von Präparaten für die parenterale Verabreichung gelten. Entsprechende Qualitätskontrollen wurden durchgeführt (Erfordernisse für durch rekombinante DNA-Techniken hergestellte Hepatitis B-Impfstoffe, Erfordernisse für biologische Substanzen Nr. 45, World Health Organization, Technical Report Series, Nr. 786, 1989).

In der folgenden Tabelle sind die beim erfindungsgemäßen Verfahren zur Reinigung von HBsAg erzielten Ergebnisse zusammengestellt.

Beispiel 4

Um einen für HBsAg spezifischen monoklonalen Antikörper (MAb) zu erhalten, wurden 8 Wochen alte, männliche Balb/c-Mäuse mit natürlichem Hepatitis-B-Virus-Oberflächenantigen, das aus humanem Plasma erhalten worden war, immunisiert (S. Krugman et al., J. Am. Med. Assoc., Bd. 217 (1971), S. 41). Die Fusion, Züchtung und Überwachung der Hybride wurde gemäß den von Kohler beschriebenen Grundprinzipien durchgeführt (The Technic of Hybridoma Production, Immunological Methods, 1981, Vol. I, Academic Press, 285-298). Die Milzzellen wurden mit der Myelom-Linie SP2/0/Agl4 in einem Verhältnis von 10 : 1 unter Verwendung von 50% Polyethylenglykol 1500 (BDH) hybridisiert und auf Platten mit 96 Vertiefungen (Costar) in einer Konzentration von 100 000 Zellen pro ml Medium und 100 ul Vertiefung angeimpft. Beim verwendeten selektiven Züchtungsmedium handelte es sich um RPMI 1640 (Gibco), das mit 1 g/Liter NaHCO&sub3;, 3 ug/Liter HEPES, 2 mM L-Glutamin, 1 mM Natriumpyruvat, 0,05 mM 2-Mercaptoethanol, 10% fötalem Kälberserum, 40 ug/ml Gentamicin und 3% humanem Endothelzellen-Kulturüberstand (HECS) ergänzt werden kann (Astaldi et al., Methods of Enzymology, 1983, Vol. XCII, Hrsg. J. Langone, Academic Press, S. 39-46), wobei Hypoxanthin bis zu einer Konzentration von 0,03 mM, Thymidin bis zu 3 uM und Aminopterin bis zu 0,4 um zugegeben wurden.

Ab der dritten Züchtungswoche wurden die Überstände auf für HBsAg spezifische Antikörper untersucht, wozu ein indirektes ELISA-Verfahren herangezogen wurde. Unter den positiven Vertiefungen wurde die Nr. 48 aufgrund der bei wiederholten Tests erzielten hohen Werte ausgewählt, geklont und mehrmals durch beschränkende Verdünnung rekloniert. Als letzter Klon wurde 48/1/5/4 ausgewählt, der einen MAb mit den folgenden immunochemischen Eigenschaften sezernierte:

- Er erkennt in spezifischer Art und Weise sowohl natürliches HBsAg als auch in Hefen erzeugtes rekombinantes HBsAg (HBsAgr). Dies wurde für beide Moleküle durch ELISA-Technik gezeigt.

- Er erkennt HBsAgr sowohl in fester Phase (ELISA) als auch in Lösung. Es ist möglich, die Bindung des MAb an das Antigen in fester Phase durch vorherige Inkubation in Lösung zu hemmen.

- Bei ELISA-Tests mit mehreren Molekülen als Beschichtung wurden keine Kreuzreaktionen beobachtet. Er erkennt auch spezifisch in einem Western-Blot die Bande, die dem HBsAg eines Präparats von Hefe, die HBsAgr erzeugt, entspricht. Dadurch können wir bestätigen, daß dieser MAb in hohem Maße für HBsAg spezifisch ist und daß das erkannte Epitop vom kontinuierlichen Typ ist.

- Er erkennt in äquivalenter Art und Weise die internationalen Standards der Subtypen ay und ad, was zeigt, daß er gegen die Determinante, die sämtlichen Untertypen des Virus gemeinsam ist, gerichtet ist.

- Eine spezielle Eigenschaft dieses Klons besteht in der Tatsache, daß er zwei Typen von schweren Ketten synthetisiert: eine der Unterklasse gamma 2b und die andere der Klasse M. Die Zellen sezernieren sowohl Antikörper der Klasse IgG 2b und pentamere IgM-Moleküle, die durch Gelfiltrationschromatographie (Sephacryl S-300) getrennt werden können. Dies konnte durch doppelte Radialimmunodiffusion (O. Ouchterlony et al., Handbook of Experimentäl Immunology, 1973, Vol. 1, S. 19.1) und durch Polyacrylamid-Gelelektrophorese (N.K. Laemmli, Nature, Bd. 227 (1970), S. 680) gezeigt werden. Beide Antikörper sind spezifisch gegen HBsAg, was durch ELISA-Technik mit Konjugaten, die für Mäuse-IgG und -IgM (Sigma) spezifisch waren, gezeigt wurde.

- Versuche an beschichteten PVC-Platten zeigen, daß der MAb dazu befähigt ist, in wirksamer Weise HBsAg einzufangen. Ein hoher prozentualer Anteil davon kann anschließend eluiert werden, wobei man Lösungen mit einer hohen Molarität an Kaliumthiocyanat verwendet.

Eine Hinterlegung dieser Hybridom-Zellinie gemäß dem Budapester Vertrag wurde am 26. November 1990 bei der European Collection of Animal Cell Cultures, Salisbury, Vereinigtes Königreich, Hinterlegungsnummer ECACC 90 112 606 vorgenommen.

Für die Herstellung dieses monoklonalen Antikörpers werden reine Präparate davon aus Aszites-Flüssigkeit erhalten, die nach Inokulation von 3 Millionen hybriden Zellen in die peritoneale Höhle von Balb/c-Mäusen extrahiert worden sind, die 10 Tage vorher eine Verabreichung von Mineralöl auf dem gleichen Wege erhalten hatten. Die durch wiederholte Punktur erhaltene Aszites-Flüssigkeit wird bei 500 g zentrifugiert, mit Chloroform im Verhältnis 1 : 1 delipidiert und mit phosphatgepufferter Kochsalzlösung (PBS) dialysiert.

Zur Reinigung werden eine 2-stündige Fällung bei 4ºC mit 50% (NH&sub4;)&sub2;SO&sub4;, eine 30-minütige Zentrifugation bei 4000 U/min. zwei weitere Waschvorgänge des Niederschlags mit der gleichen Konzentration an (NH&sub4;)&sub2;SO&sub4; und eine Entsalzung in Sephadex G-25 (Pharmacia) durchgeführt. Die entsalzte Probe wird durch Affinitätschromatographie in Protein A- Sepharose CL4B (Pharmacia) fraktioniert, wobei die vom Hersteller empfohlenen Anweisungen eingehalten werden.

Die gereinigten Antikörper werden an Matrices von Sepharose CL4B, die gemäß den Angaben des Herstellers mit Bromcyan aktiviert worden ist, gebunden. Pro 1 ml Gel werden 5 mg MAb verwendet.

Beispiel 5

Um ein Impfstoffpräparat aus dem reinen rekombinanten Antigen mit hoher Homogenität und hohem Grad der Teilchenbildung zu erhalten, wird das Antigen mit einer sterilen Aluminiumhydroxidlösung vermischt.

Auf diese Weise wurden mehrere Ansätze hergestellt, um die erforderlichen Tests zur Charakterisierung dieses Produkts durchzuführen. Die Ergebnisse der Bewertung von drei aufeinanderfolgehden Ansätzen dieses Präparats sind nachstehend zusammengestellt.

Erzielte Ergebnisse

(*) Spezifische Proteinwerte von mehr als 1000 ug/ml sind auf die Unterbestimmung von immunogenem Protein durch Folin zurückzuführen.

Beispiel 6

Um die Immunogenitätseigenschaften des durch rekombinante DNA-Technik in Hefen gemäß den vorstehenden Beispielen erhaltenen Hepatitis B- Virus-Oberflächenantigens zu untersuchen, wurden vorklinische Tests an Gruppen von freiwilligen Personen durchgeführt, nachdem gezeigt worden war, daß das Präparat den Bestimmungen für die parenterale Verabreichung an Menschen entsprach (Bestimmungen für durch rekombinante DNA-Techniken hergestellte Hepatitis B-Impfstoffe, Bestimmungen für biologische Substanzen Nr. 45, World Health Organization, Technical Report Series, Nr. 786, 1989). Diese Untersuchungen wurden von einem Bewertungsgremium durchgeführt, das für diesen Zweck vom kubanischen Gesundheitsministerium eingesetzt wurde. Der Bericht dieses Gremiums ist nachstehend zusammengefaßt:

Das vom kubanischen Gesundheitsministerium eingesetzte Gremium zur Bewertung des kubanischen rekombinanten Impfstoffes gegen Hepatitis B hat einen vollständigen endgültigen Bericht über eine Untersuchung der Prototypphase II zur Bewertung der immunogenen Beschaffenheit des kubanischen Impfstoffes aus rekombinanter DNA von Hepatitis B-Virus-Oberflächenantigen (rec-HBsAg) in Hefe erstellt.

Der hier zusammengestellte Bericht beschreibt einen typischen kontrollierten Doppelblindversuch, der dazu bestimmt ist, das Verhalten des kubanischen rec-HBsAg-Impfstoffes mit einem eingeführten, handelsüblichen Impfstoff des gleichen Typs, der in nahezu 100 Ländern zugelassen und registriert ist (Smith & Kline) zu vergleichen.

Von insgesamt 123 Personen, die ein Dokument unterschrieben, das ihre freiwillige Teilnahme an der Untersuchung bestätigte, wurden 35 Personen aus unterschiedlichen Gründen ausgeschlossen. 88 klinisch gesunde Personen, die frei von Virus-Markern (HBsAg, HBeAg, anti-HBsAg, anti- HBcAg) waren und normale Transaminase-Werte (ALT) aufwiesen, wurden ausgewählt. Bei den Versuchspersonen handelte es sich hauptsächlich um junge Erwachsene beiderlei Geschlechts im Alter von 20 und 34 Jahren, die gleichmäßig in drei Gruppen von 31, 30 und 27 Personen aufgeteilt wurden. Die Gruppen erhielten 3 Dosen (1 ml Antigen, adsorbiert an Aluminiumhydroxid) von 20 ug kubanischem Impfstoff (CV20), 10 ug kubanischem Impf stoff (CV10) bzw. 20 ug handelsüblichem Impfstoff (SK20) an den Tagen 0, 30 und 60.

Blutproben wurden an den gleichen Tagen vor der Impfung und an den Tagen 15, 75 und 90 während oder nach der Impfung entnommen. 45% der gesamten Versuchspersonen erhielten eine subkutane Impfung, der Rest eine intramuskuläre Impfung (Deltamuskel), wobei zwischen den Gruppen in bezug auf Alter, Geschlecht oder Verabreichungsweg keine signifikanten Unterschiede bestanden.

Am Tag 90 nach Beendigung des gesamten Impfprogramms zeigten 29 Personen der Gruppe mit 31 Personen, die mit CV20 geimpft und anschließend getestet worden waren, zu 100% Antikörper-Titer, die über dem anerkannten minimalen Schutzniveau (MPL) von 10 IU/Liter lagen, wobei sich ein geometrisches Mittel des Titers (GMT) von 239,9 IU/Liter ergab.

26 Personen der Gruppe mit 30 Personen, die mit CV10 geimpft und anschließend getestet worden waren, zeigten 100% Antikörper-Titer, die größer als der MPL-Wert waren, wobei sich ein GMT-Wert von 218,4 IU/Liter ergab. Dagegen zeigten aus der Gruppe von 27 Personen, die SK20 erhalten hatten, von den 26 geimpften und getesteten Personen 23 (88,5%) Antikörper mit einem GMT-Wert von 43,9 IU/Liter, während nur 21 (80,8%) den MPL- Wert überstiegen.

Bei einem Vergleich der Ergebnisse nach 90 Tagen mit denen nach 75 Tagen (15 Tage nach der dritten Dosis) hielten die beiden kubanischen Impfstoffe CV20 und CV10 eine maximale Serokonversionsrate (100%) aufrecht und erhöhten die Anzahl der mit Titern über dem MPL-Wert geimpften Personen auf 100%, während bei SK&sub2;O die Anzahl der Personen, die reagierten, von 96,3% auf 88,5% abnahm. Dagegen stieg die Anzahl der Personen mit Titern über dem MPL-Wert von 70,4% auf 80,8%. Diese Daten sind für SK20 immer noch signifikant schlechter (p) als für die beiden kubanischen Präparate.

Somit läßt sich der Schluß ziehen, daß von den insgesamt 81 geimpften und getesteten Personen, die das Impfprogramm beendet hatten (92% der Personen, die die erste Dosis erhalten hatten) bei 78% eine Serokonversion erfolgte (96,3%). Darunter hatten 55 Personen (100%) einen der beiden kubanischen Impfstoffe erhalten (alle mit Titern über dem MPL-Wert), während 23 (88,5%) den handelsüblichen Impfstoff erhalten hatten. 21 Personen (80,8%) davon wiesen einen über dem MPL-Wert liegenden Titer auf. Auf der Grundlage dieser Ergebnisse, die zugunsten des kubanischen Impfstoffes signifikant sind, wurde entschieden, diese Untersuchung auf eine größere Gruppe von Personen auszudehnen, die auf die vorstehend beschriebene Weise ausgewählt und verschiedenen Institutionen des nationalen Gesundheitsdienstes zugeordnet wurden.

Die Ergebnisse dieser zweiten Phase sind in den Diagrammen 1 und 2 zusammengestellt. Aus diesen Diagrammen ist das Ausmaß der Reaktion für beide Präparate (kubanischer Impfstoff gegenüber SK) bei intramuskulärer (IM) und subkutaner (SC) Immunisierung ersichtlich.

Zeichnung:

In den Zeichnungen werden folgende Abkürzungen verwendet:

B BamHI

N NcoI

S SalI

EI EcoRI

EV EcoRV

BgII BglII

C ClaI

CIP Kälberdarm-Phosphatase

Klenow DNA-Polymerase I, großes Fragment

SEQUENZPROTOKOLL

SEQ ID NO: 1

SEQUENZART: Nucleotid

SEQUENZLÄNGE: 19 Nucleotide

GCCATGGAGA ACATCACAT

SEQ ID NO: 2

SEQUENZART: Nucleotid

SEQUENZLÄNGE: 25 Nucleotide

GGTCGACGTT TAAATGTATA CCCAG

SEQ ID NO: 3

SEQUENZART: Nucleotid

SEQUENZLÄNGE: 15 Nucleotide

GTATCACGAG GCCCT

SEQ ID NO: 4

SEQUENZART: Nucleotid

SEQUENZLÄNGE: 24 Nucleotide

CGCCATGGTT TCGAATAATT AGTT


Anspruch[de]

1. Verfahren zur Gewinnung von Hepatitis B-Oberflächenantigen aus Pichia pastoris-Zellen, die ein für Hepatitis B-Oberflächenantigen kodierendes Gen enthalten und die dieses Gen exprimiert haben, umfassend folgende Stufen:

- die Zellen werden in Gegenwart eines Puffers, der ein chaotropes Mittel, Saccharose und Ethylendiamintetraessigsäure (EDTA) enthält, lysiert;

- Verunreinigungen werden bei einem sauren pH-Wert ausgefällt;

- das Antigenpräparat wird einer sauren Adsorptionsbehandlung und einer alkalischen Desorptionsbehandlung an einer Matrix von Diatomeenerde unterworfen;

- das Antigenpräparat wird einer Immunoaffinitätschromatographie unter Verwendung eines für Hepatitis B-Oberflächenantigen spezifischen monoklonalen Antikörpers unterworfen;

- das eluierte Antigen wird einer Wärmebhandlung bei einer Temperatur von 30-40ºC unterworfen;

- das Antigen wird in einer Anionenaustauschersäule mit einem Detergens gewaschen; und

- das eluierte Antigen wird einer Hochleistungsflüssigchromatographie (HPLC) in Gegenwart eines Detergens unterworfen.

2. Verfahren nach Anspruch 1, wobei die Lysis der Zellen in Gegenwart eines Puffers mit einem Gehalt an Kaliumthiocyanat, Saccharose, EDTA, Tris und NaCl durchgeführt wird.

3. Verfahren nach Anspruch 1, wobei die Lysis der Zellen in Gegenwart eines Puffers mit einem Gehalt an 1-4 M Kaliumthiocyanat, 1-15% (Gew.-Vol.) Saccharose, 2,5-3, 5 mM EDTA, 10-30 mM Tris und 0,1-1 M NaCl, der vorzugsweise im wesentlichen aus 291 g/Liter Kaliumthiocyanat, 100 g/Liter Saccharose, 1,86 g/Liter EDTA, 12 g/Liter Tris und 17,5 g/Liter NaCl besteht, durchgeführt wird.

4. Verfahren nach Anspruch 1, wobei die Säurefällung der Verunreinigungen bei einem pH-Wert von 3-4 durchgeführt wird.

5. Verfahren nach Anspruch 1, wobei das nach Entfernung des bei der Säurefällungsstufe gebildeten Niederschlags erhaltene Antigenpräparat bei einem pH-Wert von 7-8 aufbewahrt wird.

6. Verfahren nach Anspruch 1, wobei das nach Entfernung des bei der Säurefällungsstufe gebildeten Niederschlags erhaltene Antigenpräparat bei einem pH-Wert von 3-5 mit einer Matrix von Diatomeenerde in Kontakt gebracht wird und die Verunreinigungen mit einem Elutionspuffer mit einem pH-Wert von 3-5 eluiert werden, wonach sich die Desorption des Antigens bei einem pH-Wert von 7,5-9,0 anschließt.

7. Verfahren nach Anspruch 1, wobei das von der Diatomeenerde desorbierte Antigenpräparat durch Ultrafiltration eingeengt und durch Diafiltration entsalzt wird.

8. Verfahren nach Anspruch 1, wobei es sich bei dem bei der Immunoaffinitätschromatographiebehandlung verwendeten monoklonalen Antikörper um einen monoklonalen Antikörper handelt, der im Hinblick auf seine hohe Affinität gegenüber antigenen Hepatitis B-Oberflächenantigen-Teilchen ausgewählt ist.

9. Verfahren nach Anspruch 1, wobei es sich bei dem bei der Immunoaffinitätschromatographiebehandlung des Antigenpräparats verwendeten monoklonalen Antikörper um anti-HBsAg-CB- HEP1 handelt, das durch die Hybridomzellinie ECACC 90112606 erzeugt worden ist.

10. Verfahren nach Anspruch 1, wobei das Antigen von der Immunoaffinitätschromatographiesäule mit einem Puffer mit einem Gehalt an einem chaotropen Mittel eluiert wird.

11. Verfahren nach Anspruch 1, wobei die Wärmebhehandlung des eluierten Antigens bei 30-40ºC für eine Zeitspanne von 1-6 Stunden durchgeführt wird.

12. Verfahren nach Anspruch 1, wobei das Antigen in einer DEAE-Cellulosesäule mit einem Detergens, wie Natriumdesoxycholat und Triton X-100, gewaschen wird.

13. Verfahren nach Anspruch 1, wobei das Antigen in einer Anionenaustauschersäule mit einem Detergens in einer Konzentration von 0,01-0,5 Gew.-% und vorzugsweise von 0,05-0,1 Gew.-% gewaschen wird.

14. Verfahren nach Anspruch 1, wobei das eluierte Antigen einer Hochleistungsflüssigchromatographie mit einer Trenngrenze von 20000 bis 10000000 in Gegenwart eines Detergens, wie Natriumdesoxycholat, unterworfen wird.

15. Verfahren nach Anspruch 1, wobei das eluierte Antigen einer Hochleistungsflüssigchromatographie in Gegenwart eines Detergens in einer Konzentration von 0,01-0,5 Gew.-% und vorzugsweise von etwa 0,05 Gew.-% unterworfen wird.

16. Verfahren nach Anspruch 1, wobei das Hepatitis B-Oberflächehantigen aus dem rekombinanten Pichia pastoris- Stamm C226 [pTA0906], CBS450.90, gewonnen wird.







IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com