PatentDe  


Dokumentenidentifikation DE69631543T2 16.09.2004
EP-Veröffentlichungsnummer 0000862615
Titel IMMUNITÄT GEGEN PASTEURELLA HAEMOLYTICA LEUKOTOXIN
Anmelder Commonwealth Scientific and Industrial Research Organisation, Campbell, AU;
University of New England, Armidale, New South Wales, AU;
The State of New South Wales, Orange, Neu Süd Wales, AU;
The State of Queensland Department of Primary Industries, Brisbane, Queensland, AU
Erfinder PRIDEAUX, Thomas, Christopher, Coburg North, AU;
HODGSON, Leslie, Adrian, East Malvern, AU
Vertreter Andrae Flach Haug, 81541 München
DE-Aktenzeichen 69631543
Vertragsstaaten DE, ES, FR, GB, IT
Sprache des Dokument EN
EP-Anmeldetag 01.11.1996
EP-Aktenzeichen 969342096
WO-Anmeldetag 01.11.1996
PCT-Aktenzeichen PCT/AU96/00685
WO-Veröffentlichungsnummer 9716531
WO-Veröffentlichungsdatum 09.05.1997
EP-Offenlegungsdatum 09.09.1998
EP date of grant 11.02.2004
Veröffentlichungstag im Patentblatt 16.09.2004
IPC-Hauptklasse C12N 1/21
IPC-Nebenklasse C12N 15/31   A61K 39/02   A61K 39/10   A61K 39/08   

Beschreibung[de]

Die vorliegende Erfindung betrifft genetisch modifizierte Pasteurella-haemolytica-Mikroorganismen, die für eine Verwendung als Lebendimpfstoffe geeignet sind. Die vorliegende Erfindung betrifft auch die Verwendung modifizierter Mikroorganismen als biologische Vektoren. Die vorliegende Erfindung betrifft ferner Impfstoffzusammensetzungeri.

Der Bovine Respiratorische Krankheitskomplex („bovine respiratory disease complex", BRD), die Rinderseuche oder Lungenpasteurellose ist eine multifaktorielle Erkrankung, bei der eine Kombination aus einer Virusinfektion, ungünstigen Umgebungsbedingungen und einem schlechten Immunstatus dazu führen kann, dass Tiere für bakterielle Infektionen prädisponiert sind. Der BRD ist eine Hauptursache für wirtschaftliche Verluste in der Rinder-Mastweidenindustrie. Der prinzipielle Mikroorganismus, der mit der Krankheit assoziiert ist, ist das Bakterium Pasteurella haemolytica mit dem Serotyp 1 (Schiefer et al., 1978). Unter normalen Bedingungen ist P. haemolytica eine Komponente der normalen Flora des oberen Atemtraktes, und nur, wenn die Mechanismen der Lungenclearance beeinträchtigt sind, kommt es zu einer Besiedelung der Lunge, was zur Krankheit führt (Frank und Smith, 1983). Es sind verschiedene Virulenzfaktoren mit P. haemolytica assoziiert worden, einschließlich von Oberflächenstrukturen wie dem kapsulären Polysaccharid (Adam et al. 1984) und eines sekretierten Exotoxins, das hitzelabil und spezifisch für Wiederkäuer-Leukozyten ist (Shewen und Wilkie, 1982).

Das Exotoxin oder Leukotoxin (Lkt) kann zur Krankheitsentstehung beitragen, indem es die primären Abwehrmechanismen der Lunge und sich anschließende Immunreaktionen beeinträchtigt, oder indem es als Ergebnis einer Leukozytenlyse eine Entzündung verursacht. Die Charakterisierung des Lkt hat gezeigt, dass es ein Mitglied der RTX-Familie von Toxinen ist (Strathdee und Lo, 1989), die von verschiedenen Bakterien erzeugt werden, einschließlich von Actinobacillus spp, Proteus vulgaris, Morganella morganii und Bordetella pertussis, und die am besten charakterisierten werden von E. coli erzeugt. Alle RTX-Toxine wirken, indem sie Poren in den Zielzellen erzeugen, wodurch sie das osmotische Gleichgewicht stören und zu einem Platzen der Zielzelle führen. Der Wirkungsmechanismus der RTX-Toxine ist zwar identisch, aber ihre Zielzellen unterscheiden sich bezüglich des Typs und der Spezifität hinsichtlich der verschiedenen Spezies beträchtlich. Bezüglich ihrer Struktur ist diese Familie von Toxinen durch das Vorliegen von glycinreichen Repeat-Strukturen innerhalb des Toxins, die Calcium binden und eine Rolle bei der Erkennung der Zielzelle und der Bindung spielen könnten, einen Bereich hydrophober Domänen, die in die Porenbildung involviert sind, die Abhängigkeit von einer posttranslationalen Aktivierung und die Abhängigkeit von einer C-terminalen Signalsequenz für die Sekretion charakterisiert. Die Produktion und Sekretion eines aktiven RTX-Toxins erfordert die Aktivität von wenigstens vier Genen, C, A, B und D. Das A-Gen codiert für die Toxinstruktur, das C-Gen codiert für einen posttranslationalen Aktivator, und die B- und D-Gene codieren für Proteine, die für die Sekretion des aktiven Toxins erforderlich sind. Das Lkt wird von einem Operon codiert, das aus den vier zusammenhängenden Genen (CABD) besteht, die von nur einem Promotor transkribiert werden. Das Lkt unterscheidet sich von einer Anzahl anderer RTX-Toxine, die eine breite Wirfszellspezifität zeigen, dadurch, dass es eine Zielzellspezifität aufweist, die auf Wiederkäuer-Leukozyten beschränkt ist (Übersicht siehe Coote, 1992).

Das Lkt wurde auch mit einer schützenden Immunität in Verbindung gebracht, mit Antikörpern gegen das Toxin auf dem Gebiet der Resistenz gegenüber der Krankheit und mit einem kommerziellen Impfstoff aus einem Kulturüberstand (Presponse, Langford Inc., Guelph, Ontario, Kanada), der Lkt enthält und eine Wirksamkeit bezüglich der Verminderung der Inzidenz und der Schwere der Lungenentzündung nach einem experimentellen Challenge und auf der Mastweide (Gentry et al., 1985; Mosier et al., 1986, 1989; Shewen und Wilkie, 1987; Shewen et al., 1988). Dieser Impfstoff aus dem Kulturüberstand induziert nicht nur Antikörper gegen Lkt, sondern stimuliert auch eine Immunreaktion gegen andere lösliche Antigene, die im Kulturüberstand vorhanden sind, und deshalb kann eine direkte Korrelation zwischen den Antikörpern gegen Lkt und einem Schutz nicht beansprucht werden.

Der Einsatz von Pasteurella-Bacterinen (inaktiven Impfstoffen) im Feld hatte bezüglich der Kontrolle der Lungenpasteurellose nur einen begrenzten Erfolg; in verschiedenen Feldversuchen hat die Verabreichung eines Impfstoffes auf Bacterin-Basis nicht gegen die Erkrankung geschützt, oder sie hat in einigen Fällen zu einer Verstärkung der Erkrankung geführt (Bennett, 1982; Morter of al., 1982). Bacterin-Impfstoffe haben auch die Nachteile, dass Adjuvanzien benötigt werden, dass sie zu Nebenwirkungen führen können und dass in einigen Fällen eine Mehrfachdosierung erforderlich ist, damit ein Schutz erhalten wird.

Cruz et al. (Molecular Microbiology 4, 1933–1939 (1990)) beschreiben die Wirkung von Deletionen im klonierten Lkt-A-Gen von Pasteurella haemolytica auf die Funktion des Pasteurella-Leukotoxins. Guthmiller et al. (Microbial Pathogenesis 18, 307–321 (1995)) beschreiben die Wirkung von Mutationen in den Lkt-B- und Lkt-D-Toxin-Genen auf das Leukotoxin von Actinobacillus actinomycetemcomitans.

Es ist ein Ziel der vorliegenden Erfindung, ein Problem oder mehrere Probleme des derzeitigen Standes der Technik zu verkleinern.

Dementsprechend stellt die vorliegende Erfindung einen modifizierten Mikroorganismus bereit, der ein Lkt-Toxin erzeugt, wobei das genannte Lkt-Toxin teilweise oder vollständig inaktiviert ist.

Der Begriff „modifiziert" schließt eine Modifikation über gentechnologische Verfahren oder über andere Techniken ein, wie eine chemisch oder mittels Strahlung induzierte Mutagenese. Wenn die gentechnologischen Verfahren die Einführung fremder DNA in Wirtszellen beinhalten, dann kann die DNA mittels jedes beliebigen geeigneten Verfahrens eingeführt werden. Zu geeigneten Verfahren gehören die Transformation kompetenter Zellen, die Transduktion, die Konjugation und die Elektroporation.

In der vorliegenden Erfindung wird ein modifizierter Mikroorganismus mit einem Lkt-Toxin-Operon bereit gestellt, das ein Lkt-Strukturgen enthält, wobei der posttranslationale Aktivator teilweise oder vollständig inaktiviert ist.

Der Begriff „Lkt-Toxin-Operon" soll, so wie er hier in den Ansprüchen und in der Beschreibung verwendet wird, diejenigen Gene einschließen, die in die Expression eines Lkt-Toxins, das ein Produkt des Lkt-Toxin-Operons ist, involviert sind. Die Gene, die im Lkt-Toxin-Operon enthalten sind, umfassen das Gen des posttranslationalen Aktivators (C) das Strukturgen (A) und die B- und D-Gene, die für Proteine codieren, die für die Sekretion des aktivierten Lkt-Toxins erforderlich sind.

Der Begriff „teilweise oder vollständig inaktiviert" schließt, so wie er hier in den Ansprüchen und in der Beschreibung verwendet wird, die Modifikation eines Gens über gentechnologische Verfahren ein, einschließlich einer Einführung und einer Deletion von DNA des Gens, einschließlich einfacher oder mehrfacher Nucleotidsubstitutionen, -additionen und/oder -deletionen, einschließlich einer vollständigen oder teilweisen Deletion des Gens unter Einsatz eines Zielkonstrukts oder einer Plasmidsegregation sowie einer chemisch induzierten oder durch Strahlung induzierten oder ortsgerichteten Mutagenese.

Die Anmelder der vorliegenden Erfindung haben gefunden, dass ein Vorläufer des Lkt-Toxins eine verminderte toxische Aktivität aufweist. Überraschenderweise haben die Anmelder der vorliegenden Erfindung auch gefunden, dass der Vorläufer des Lkt-Toxins imstande ist, in einem Tier eine Immunreaktion zu induzieren, die einen Schutz vor einem heterologen Challenge mit einem Mikroorganismus bietet, der das Lkt-Toxin bildet.

Dementsprechend ist bei einer bevorzugten Ausführungsform der Erfindung das inaktivierte Lkt-Toxin ein Vorläufer des Lkt-Toxins. Der Vorläufer kann ein nichtprozessiertes Expressionsprodukt des Lkt-Strukturgens sein. Das Lkt-Strukturgen kann das Lkt-A-Gen sein.

Die Anmelder der vorliegenden Erfindung haben gefunden, dass ein Mikroorganismus, der natürlicherweise ein Lkt-Toxin erzeugt, genetisch so verändert werden kann, dass er einen inaktiven Vorläufer des Lkt-Toxins erzeugt, indem der posttranslationale Aktivator des Vorläuferprodukts eliminiert wird. Dementsprechend ist der Mikroorganismus nicht imstande, einen posttranslationalen Aktivator des Vorläufers des Lkt-Toxins zu erzeugen, oder er erzeugt einen inaktivierten posttranslationalen Aktivator des Vorläufers des Lkt-Toxins. Der posttranslationale Aktivator kann ein Produkt des Lkt-C-Gens sein.

Bei einer bevorzugten Ausführungsform ist das Lkt-C-Gen des Mikroorganismus inaktiviert oder teilweise oder vollständig deletiert. Das Lkt-C-Gen kann über eine ortsgerichtete Mutagenese inaktiviert sein. Das Lkt-C-Gen kann über eine beliebige einfache oder mehrfache Nucleotidsubstitution, -addition und/oder -deletion inaktiviert sein. Vorzugsweise ist das Lkt-C-Gen über eine homologe Rekombination unter Verwendung eines Zielkonstruktes inaktiviert. Das Zielkonstrukt kann einen selektierbaren Marker einschließen, der von Sequenzen flankiert wird, die homolog zu Sequenzen sind, die die gewünschte Insertionsstelle flankieren. Der selektierbare Marker kann ein Gen sein, das eine Resistenz gegenüber einer toxischen Substanz wie Quecksilber bewirkt, oder er kann eine Determinante für eine Resistenz gegenüber einem Antibiotikum sein. Die Determinante für die Resistenz gegenüber einem Antibiotikum kann ein Gen sein, das für eine Ampicillin-Resistenz, Kanamycin-Resistenz oder Streptomycin-Resistenz codiert.

In einigen Fällen kann es unerwünscht sein, ein funktionelles Gen für eine Antibiotikumresistenz in einem modifizierten Mikroorganismus inkorporiert vorliegen zu haben. Demgemäß stellt man sich bei der vorliegenden Erfindung ein Zielkonstrukt vor, das genetische Elemente wie Repeat-Sequenzen einschließt, die das Herausschneiden des Gens für die Antibiotikumresistenz erleichtern, sobald das Zielkonstrukt die homologe Rekombination mit dem Wirtschromosom durchlaufen hat.

Bei der vorliegende Erfindung stellt man sich auch ein Zielkonstrukt vor, das keinen selektierbaren Marker einschließt. Zum Beispiel kann das Zielkonstrukt einen Abschnitt des Lkt-C-Gens einschließen, der eine Deletion enthält. Die homologe Rekombination des Zielkonstrukts mit dem Wirtschromosom kann zur Einführung einer Deletion in das chromosomale Lkt-C-Gen führen. Die Selektion von Rekombinanten kann dann auf einer fehlenden Bildung des Lkt-Toxins basieren.

Das Zielkonstrukt kann in linearer Form direkt in die Wirtszelle eingeführt werden. Alternativ kann das Zielkonstrukt über einen Suizid- oder nicht-replizierenden Vektor eingeführt werden. Der Suizid-Vektor kann jedes beliebige Plasmid sein, das im Wirtsmikroorganismus nicht repliziert. Mikroorganismen, die natürlicherweise Lkt-Toxine erzeugen, sind oft nicht-permissive Wirte für pEP-Vektoren. Demgemäß sind pEP-Vektoren Beispiele für Suizid-Vektoren, die in der vorliegenden Erfindung eingesetzt werden können.

Bei einer weiteren Ausführungsform kann eine ortsgerichtete Mutagenese über die Technik der Plasmidsegregation erreicht werden. Zum Beispiel kann ein Plasmid, das ein Fragment eines Lkt-C-Gens enthält, das durch das Gen eines selektierbaren Markers unterbrochen ist, in einen Mikroorganismus eingeführt werden. Der Mikroorganismus kann anschließend mit einem zweiten Plasmid transformiert werden, das ein Gen eines zweiten selektierbaren Markers enthält. Wirtszellen, die beide Plasmide enthalten, können dann in einem Medium passagiert werden, das nur für das zweite Plasmid selektiert. Die Selektion für das zweite Plasmid kann gegen eine Beibehaltung des ersten Plasmids wirken. Das erste Plasmid kann deshalb verloren gehen, aber in einigen Fällen kann eine Rekombination des unterbrochenen Fragments des Lkt-C-Gens, das den selektierbaren Marker enthält, in das Chromosom folgen. Dieser Prozess kann deshalb die Rekombination des unterbrochenen Lkt-C-Gens in das chromosomale Lkt-C-Gen fördern, wodurch das chromosomale Lkt-C-Gen inaktiviert wird.

Bei einem weiteren Aspekt der vorliegenden Erfindung wird ein Expressionsvektor bereit gestellt, der für ein Lkt-Toxin codiert, wobei das genannte Lkt-Toxin teilweise oder vollständig inaktiviert ist, und der genannte Vektor für ein Gen eines Lkt-Toxins, einschließlich eines Lkt-Strukturgens und eines Gens eines posttranslationalen Aktivators, codiert, wobei das genannte Gen des posttranslationalen Lkt-Aktivators teilweise oder vollständig inaktiviert ist.

Der Begriff „Expressionsvektor" schließt, so wie er hier in den Ansprüchen und in der Beschreibung verwendet wird, ein chromosomales oder extrachromosomales Element ein, das imstande ist, eine DNA-Sequenz einschließlich einer fremden DNA-Sequenz zu exprimieren.

Das Produkt des Lkt-A-Gens kann von einem chromosomalen Lkt-A-Gen exprimiert werden. Das chromosomale Lkt-A-Gen kann in seiner natürlichen Position auf dem Chromosom lokalisiert sein, oder es kann in einer Position in das Chromosom insertiert sein, die sich von seiner natürlichen Lokalisation unterscheidet. Außerdem kann das Produkt des Lkt-Gens von einem Lkt-A-Gen exprimiert werden, das auf einem extrachromosomalen Element, wie einem Plasmid, lokalisiert ist. Bei einer Ausführungsform kann deshalb ein extrachromosomales Element, das ein Lkt-A-Gen enthält, in einen Mikroorganismus eingeführt werden, der ein funktionelles chromosomales Lkt-A-Gen und ein inaktiviertes chromosomales Lkt-C-Gen aufweist. Das vom extrachromosomalen Element exprimierte Produkt des Lkt-A-Gens kann das Lkt-A-Produkt, das vom chromosomalen Gen exprimiert wird, supplementieren.

Alternativ kann das Produkt des Lkt-A-Gens vollständig von einem Lkt-A-Gen oder -Genen exprimiert werden, die auf extrachromosomalen Elementen, wie Plasmiden, lokalisiert sind. Die Lkt-A-Gene, die auf extrachromosomalen Elementen lokalisiert sind, können entweder in Anwesenheit oder in Abwesenheit einer Selektion für das extrachromosomale Element exprimiert werden. So kann bei einer Ausführungsform ein extrachromosomales Element, das ein Lkt-A-Gen enthält, in einen Mikroorganismus eingeführt werden, dem funktionelle chromosomale Lkt-A- und Lkt-C-Gene fehlen. Der Mikroorganismus, dem funktionelle Lkt-A- und Lkt-C-Gene fehlen, kann über eine Mutagenese des Mikroorganismus erzeugt werden. Die Mutagenese kann zur Deletion der Lkt-A- und Lkt-C-Gene oder von Teilen von diesen führen.

Das extrachromosomale Element kann ein rekombinanter Expressionsvektor sein, der das Lkt-A-Gen enthält. Vorzugsweise ermöglicht der rekombinante Expressionsvektor die Expression des Lkt-A-Gens in Mikroorganismen, die natürlicherweise Lkt-Toxine erzeugen. Der rekombinante Expressionsvektor kann die Expression des Lkt-A-Gens in P. haemolytica ermöglichen. Der rekombinante Expressionsvektor kann von einem pIG-Plasmid abgeleitet sein. Das rekombinante Plasmid kann von pIG3B abgeleitet sein. Das rekombinante Plasmid kann pIG3B-Lkt sein.

Bakterielle Vektorsysteme auf der Basis von APP (Ph) stellen ein alternatives Mittel für die Einführung von Impfstoffmolekülen aus „nackter DNA" in Wirtszellen bereit. Solche Impfstoff-/Expressionssysteme mit nackter DNA würden ein Plasmid einschließen, das imstande ist, in bakteriellen System zu replizieren, und einen eukaryotischen Promotor, der die Expression des interessierenden fremden/rekombinanten Gens steuert.

Bei einer bevorzugten Ausführungsform ist der Mikroorganismus imstande, ein oder mehrere funktionelles) Proteine) zu erzeugen, das bzw. die die Sekretion der Moleküle des Lkt-Toxins erleichtert bzw. erleichtern. Der Mikroorganismus kann funktionelle Lkt-B- und/oder Lkt-D-Gene aufweisen. Bei einer anderen Ausführungsform ist der Mikroorganismus nicht fähig zur Erzeugung wenigstens eines der Proteine, die in die Sekretion der Moleküle des Lkt-Toxins involviert sind, oder er erzeugt wenigstens ein inaktives Protein, das in die Sekretion der Moleküle des Lkt-Toxins involviert ist. Der Mikroorganismus kann ein inaktives Lkt-B- und/oder Lkt-D-Gen aufweisen. Somit kann der Mikroorganismus unfähig zur Sekretion aktiver oder inaktiver Moleküle des Lkt-Toxins sein.

In einem weiteren Aspekt stellt die vorliegende Erfindung eine Impfstoffzusammensetzung für die Auslösung einer Immunreaktion in einem Wirtstier bereit, das mit der genannten Impfstoffzusammensetzung inokuliert wurde, wobei die genannte Impfstoffzusammensetzung einen Vorläufer des Lkt-Toxins einschließt. Der Vorläufer des Lkt-Toxins kann ein nichtprozessiertes Expressionsprodukt eines Lkt-Strukturgens sein. Das Lkt-Strukturgen kann ein Lkt-A-Gen sein.

Die vorliegende Erfindung stellt ferner eine Impfstoffzusammensetzung für die Auslösung einer Immunreaktion in einem Wirtstier bereit, das mit der genannten Impfstoffzusammensetzung inokuliert wurde, wobei die genannte Impfstoffzusammensetzung den modifizierten Mikroorganismus einschließt, der ein Lkt-Toxin erzeugt, wobei das genannte Lkt-Toxin teilweise oder vollständig inaktiviert ist. Vorzugsweise ist das inaktivierte Lkt-Toxin ein Vorläufer eines Lkt-Toxins. Der Vorläufer kann ein nicht-prozessiertes Expressionsprodukt eines Lkt-Strukturgens sein. Das Lkt-Strukturgen kann ein Lkt-A-Gen sein. Der Mikroorganismus ist Pasteurella haemolytica. Vorzugsweise ist das Lkt-C-Gen des Mikroorganismus inaktiviert oder deletiert.

Bei einer bevorzugten Ausführungsform ist die Impfstoffzusammensetzung, die einen modifizierten Mikroorganismus einschließt, ein Lebendimpfstoff.

Eine Impfstoffzusammensetzung der vorliegenden Erfindung kann in einen beliebigen pharmazeutisch annehmbaren Träger mit oder ohne zugesetzte(n) Adjuvanzien oder immunstimulatorische(n) Moleküle(n) eingearbeitet sein.

Das Adjuvans kann von jedem beliebigen geeigneten Typ sein. Das Adjuvans kann ausgewählt sein aus Pflanzenölen oder Emulsionen von diesen, oberflächenaktiven Substanzen, z. B. Hexadecylamin, Octadecylaminosäureestern, Octadecylamin, Lysolecithin, Dimethyldioctadecylammoniumbromid, N,N-Dioctadecyl-N',N'-bis(2-hydroxyethylpropandiamin), Methoxyhexadecylglycerin und Pluronpolyolen; Polyaminen, z. B. Pyran, Dextransulfat, Poly-IC, Carbopol; Peptiden, z. B. Muramyldipeptid, Dimethylglycin, Tuftsin; immunstimulierenden Komplexen (ISCOMS); Öl-Emulsionen; und Mineralgelen und -suspensionen. Eine Mineralsuspension wie Alum, d. h. Aluminiumhydroxid (Al(OH)3), Aluminiumphosphat oder Aluminiumsulfat wird bevorzugt. Das Adjuvans kann in Mengen von ungefähr 1 bis 75 Gew.-%, bezogen auf das Gesamtgewicht der Impfstoffzusammensetzung, vorliegen.

Es dürfte klar sein, dass ein Impfstoff gemäß er vorliegenden Erfindung, der einen Vorläufer für ein Lkt-Toxin oder einen Mikroorganismus enthält, der fähig ist, einen Vorläufer für ein Lkt-Toxin zu erzeugen, das Potential besitzt, einen Schutz gegen verschiedene Serovare von Mikroorganismen bereit zu stellen, die das entsprechende Lkt-Toxin erzeugen.

In einem weiteren Aspekt stellt die vorliegende Erfindung einen biologischen Vektor bereit, der ein Pasteurella-haemolytica-Bakterium einschließt, wobei das genannte Bakterium so modifiziert wurde, dass es nicht zur Erzeugung eines aktiven Lkt-Toxins fähig ist.

Das modifizierte Bakterium ist unfähig, einen posttranslationalen Aktivator des Vorläufers des Lkt-Toxins zu erzeugen, oder es erzeugt einen inaktivierten posttranslationalen Aktivator des Vorläufers des Lkt-Toxins. Der posttranslationale Aktivator kann ein Produkt eines Lkt-C-Gens sein. Bei einer bevorzugten Ausführungsform ist das Lkt-C-Gen des modifizierten Bakteriums inaktiviert oder deletiert. Das Lkt-C-Gen kann über eine oder mehrere beliebige Nucleotid-Substitution(en), -Additionen) und/oder -Deletion(en) inaktiviert sein.

Das Lkt-C-Gen kann über die Einführung eines Zielkonstruktes, das einen selektierbaren Marker enthält, in das chromosomale Lkt-C-Gen über eine ortsgerichtete Rekombination inaktiviert werden. Das Zielkonstrukt kann genetische Elemente wie Repeat-Einheiten einschließen, die das Herausschneiden des Gens für die Antibiotikumresistenz erleichtern, sobald das Zielkonstrukt ein homologe Rekombination mit dem Wirtschromosom durchlaufen hat. Alternativ kann ein Zielkonstrukt, das keinen selektierbaren Marker enthält, zur Einführung einer Deletion in das chromosomale Lkt-C-Gen verwendet werden.

Das Produkt des Lkt-A-Gens kann von einem chromosomalen Lkt-A-Gen exprimiert werden. Das chromosomale Lkt-A-Gen kann in seiner natürlichen Position auf dem Chromosom lokalisiert sein, oder es kann in das Chromosom in einer Position insertiert sein, die sich von seiner natürlichen Lokalisation unterscheidet. Außerdem kann das Produkt des Lkt-Gens von einem Lkt-Gen exprimiert werden, das auf einem extrachromosomalen Element, z. B. einem Plasmid, lokalisiert ist. Alternativ kann das Produkt des Lkt-A-Gens vollständig von einem Lkt-A-Gen oder von Genen exprimiert werden, die auf extrachromosomalen Elementen wie Plasmiden lokalisiert sind.

Bei einer bevorzugten Ausführungsform ist der Mikroorganismus imstande, ein oder mehrere funktionelles) Proteine) zu erzeugen, das bzw. die die Sekretion der Moleküle des Lkt-Toxins erleichtert bzw. erleichtern. Der Mikroorganismus kann funktionelle Lkt-B- und/oder Lkt-D-Gene aufweisen. Bei einer anderen Ausführungsform ist der Mikroorganismus nicht fähig zur Erzeugung wenigstens eines der Proteine, die in die Sekretion der Moleküle des Lkt-Toxins involviert sind, oder er erzeugt wenigstens ein inaktives Protein, das in die Sekretion der Moleküle des Lkt-Toxins involviert ist.

Der Begriff „biologischer Vektor" wird in seinem weitesten Sinne verwendet und soll biologische Mittel einschließen, die für die Expression biologisch aktiver Moleküle geeignet sind. Das biologische Mittel ist vorzugsweise ein lebender Mikroorganismus, obwohl tote Organismen eingesetzt werden könnten. Der biologische Vektor kann nicht pathogen sein, oder er kann avirulent gemacht worden sein, oder er kann in nicht-pathogenen oder avirulenten wirksamen Mengen verabreicht werden. Der Begriff „biologisch aktive Moleküle" schließt funktionelle Moleküle ein, wie Wachstumsfaktoren, Hormone, Enzyme, Antigene oder antigene Teile von diesen, Cytokine wie Interleukine, Interferone und Tumornekrosefaktoren. Die Moleküle können vom biologischen Vektor in der natürlichen Form exprimiert werden. Alternativ können die Moleküle rekombinante Moleküle sein, die exprimiert werden, indem der biologische Vektor mit einem Plasmid transformiert wird, das ein Gen oder Gene trägt, das bzw. die für das biologisch aktive Molekül codiert bzw. codieren, das dann exprimiert wird; oder wobei das Plasmid und/oder das Gen oder die Gene und/oder Teile davon in das Wirtsgenom integriert werden, das das Chromosom und/oder das beliebige natürlich oder nicht natürlich vorkommende extrachromosomale Element einschließt, wobei das Gen oder die Gene oder Teile davon exprimiert werden.

Es dürfte klar sein, dass ein biologischer Vektor der vorliegenden Erfindung dazu verwendet werden kann, dem Wirtstier ein nützliches Protein oder mehrere nützliche Proteine bereit zu stellen. Die so bereit gestellten Proteine können synergistisch wirken, um eine verstärkte Reaktion im Wirtstier zu bewirken. Zum Beispiel kann der biologische Vektor ein Antigen zusammen mit einem Molekül erzeugen, das im Wirtstier eine immunogene Reaktion auf das Antigen verstärkt. Das Molekül, das die immunogene Reaktion verstärkt, kann ein Cytokin sein.

Es dürfte auch klar sein, dass ein erfindungsgemäßer biologischer Vektor dazu verwendet werden kann, einen multivalenten Impfstoff bereit zu stellen. Der Begriff „multivalenter Impfstoff" wird in seinem allgemeinsten Sinne verwendet und beinhaltet auch einen modifizierten Mikroorganismus, der imstande ist, eine Immunreaktion auf zwei oder mehr verschiedene antigene Epitope, die sich auf dem modifizierten Mikroorganismus befinden oder vom modifizierten Mikroorganismus exprimiert werden, zu induzieren, wobei die zwei oder mehr Epitope von Haus aus im modifizierten Mikroorganismus vorhanden sind. Im allgemeineren Sinne schließt ein multivalenter Impfstoff jedoch einen modifizierten Mikroorganismus ein, der imstande ist, eine Immunreaktion gegen virulente Formen des genannten Mikroorganismus sowie gegen heterologe Antigene, die vom genannten Mikroorganismus exprimiert werden (beispielsweise rekombinante Antigene oder diejenigen, die über eine Transduktion, Konjugation oder Transformation eingeführt wurden) und nicht von Haus aus im Mikroorganismus vorhanden sind, zu induzieren. Diesbezüglich kann ein multivalenter Impfstoff gegen zwei oder mehrere pathogene Agenzien gerichtet sein. Bevorzugte multivalente Impfstoffe sind diejenigen, die imstande sind, eine Immunreaktion gegen ein Lkt-Toxin und wenigstens ein antigenes Epitop eines pathogenen Agens oder mehrerer pathogener Agenzien zu induzieren. Die pathogenen Agenzien können aus bakteriellen Pathogenen, wie Pasteurella spp., Haemophilus spp., Moraxella spp., Leptospira spp., Streptococcus spp., Salmonella spp., E. coli, Fusobacterium spp., Clostridium spp. und Mycobacterium spp., ausgewählt sein. Die pathogenen Agenzien können auch aus Endoparasiten, wie Haemonchus spp. Und Trichostrongylus spp., oder aus Ectoparasiten, wie Boophilus spp., ausgewählt sein. Alternativ können die pathogenen Agenzien aus viralen Pathogenen, wie dem Virus der Bovinen Virus-Diarrhoe (BVDV), dem Parainfluenza-Virus (PI3), der Infektiösen bovinen Rhinotracheitis (IBR), dem Coronavirus und dem Rotavirus, ausgewählt sein.

Die vorliegende Erfindung stellt ferner ein Verfahren zur Herstellung eines modifizierten P. haemolytica, das ein Lkt-Toxin erzeugt, das teilweise oder vollständig inaktiviert ist, bereit, wobei das Verfahren einschließt das Bereitstellen eines Mikroorganismus, der ein aktives Lkt-Toxin erzeugt; und das Inaktivieren oder Deletieren des Lkt-C-Gens.

Die vorliegende Erfindung stellt ferner ein Verfahren zur Herstellung eines modifizierten P. haemolytica, das ein Lkt-Toxin erzeugt, das teilweise oder vollständig inaktiviert ist, bereit, wobei das Verfahren einschließt das Bereitstellen eines Mikroorganismus, der nicht zur Erzeugung eines aktiven Lkt-Toxins fähig ist; und das Einführen eines funktionellen Lkt-A-Gens in den genannten Mikroorganismus.

Die Erfindung stellt außerdem in einem weiteren Aspekt ein Verfahren zur Impfung eines Tieres gegen einen Mikroorganismus, der ein Lkt-Toxin erzeugt, bereit, wobei das genannte Verfahren das Verabreichen einer immunologisch wirksamen Menge eines Impfstoffes gemäß der vorliegenden Erfindung an das genannte Tier einschließt.

Das Impfverfahren kann für die Behandlung von Nutztieren, wie Schweinen, Rindern, Schafen und Ziegen, eingesetzt werden. Das Impfverfahren kann auch zur Behandlung von Haustieren, wie Pferden, Hunden oder Katzen, eingesetzt werden. Das Impfverfahren kann auch zur Behandlung von Menschen eingesetzt werden. Bei einer bevorzugten Ausführungsform wird das Impfverfahren zur Behandlung von Rindern eingesetzt. Vorzugsweise wird das Impfverfahren für die Behandlung des Bovinen Respiratorischen Krankheitskomplexes (BRD) eingesetzt.

Die Verabreichung eines Impfstoffes oder eines Impfstoffvektors gemäß der vorliegenden Erfindung kann über jeden beliebigen geeigneten Weg erfolgen, z. B. über eine orale oder parenterale Verabreichung. Die Verabreichung kann über die Schleimhaut erfolgen, z. B. nasal oder vaginal. Alternativ kann die Verabreichung intramuskulär, intradermal, subkutan oder intraperitoneal erfolgen. Die Präparation kann in trockener oder flüssiger Form vorliegen. Der gewählte Verabreichungsweg kann auch weitere Komponenten erforderlich machen, z. B. Protease-Inhibitoren, entzündungshemmende Mittel und dergleichen.

Die Erfindung stellt in noch einem weiteren Aspekt ein Verfahren zur Impfung eines Tieres gegen einen pathogenen Organismus bereit, wobei das genannte Verfahren das Verabreichen einer wirksamen Menge eines Impfstoffvektors gemäß der vorliegenden Erfindung an das genannte Tier einschließt, wobei der genannte Impfstoffvektor eine immunologisch wirksame Menge eines Antigens des genannten pathogenen Organismus erzeugt.

In noch einem weiteren Aspekt stellt die vorliegende Erfindung ein Verfahren zur Erzeugung eines inaktiven Lkt-Toxins bereit, wobei das Verfahren das Kultivieren eines modifizierten Mikroorganismus gemäß der vorliegenden Erfindung und das Gewinnen des vom genannten Mikroorganismus erzeugten inaktiven Toxins einschließt. Das mittels dieses Verfahrens erzeugte inaktive Lkt-Toxin kann beispielsweise als das aktive Immunogen in einem Impfstoff zur Stimulierung einer schützenden Immunreaktion gegen ein Lkt-Toxin eingesetzt werden.

In der gesamten Beschreibung und in den Ansprüchen dieser Beschreibung sollen das Wort „umfassen" und Variationen dieses Wortes, wie „umfassend" oder „umfasst", nicht andere Zusätze, Komponenten, ganzen Zahlen oder Schritte ausschließen.

Damit die Erfindung besser verstanden werden kann, stellen wir die folgenden nichteinschränkenden Beispiele bereit.

KURZE BESCHREIBUNG DER FIGUREN

1. Konstruktion einer Lkt-Expressionskassette für E. coli. Das Lkt-Gen wurde in pQE kloniert, und zwar im Leserahmen mit der Poly-HIS-Leadersequenz, um die Lkt-Expression zu ermöglichen. Das Gen für die Kanamycin-Resistenz aus pUC4K wurde in eine nur einmal vorhandene XhoI-Restriktionsstelle 5' der pQE-Lkt-Promotor/Regulator-Sequenzen kloniert. Das resultierende Plasmid, pQE-LktK, enthält das Lkt-Gen unter regulierter Expression, verknüpft mit dem Gen für die Kanamycin-Resistenz.

2. Partielle Restriktionskarte von pIG3 (2A), einem Plasmid von 4,2 kb, das für die Streptomycin-Resistenz codiert, isoliert aus einem australischen Stamm von Actinobacillus pleuropneumoniae. Für ein PstI-Fragment von 2,3 kb (pIG317) wurde gefunden, dass es ausreichte, um nach einer Zirkularisierung für die Replikation des Plasmids zu codieren und eine Streptomycin-Resistenz zu übertragen, und es wurde in E. coli oder P. haemolytica transformiert. Der Plasmidvektor pIG3B, der eine multiple Klonierungsstelle (MCS) und einen Teil des Lac-Gens enthält, wurde über das Einführen des Haell-Fragments von pIC19R in die nur einmal vorhandene EcoRI-Stelle von pIG317 (2B) konstruiert. Einmal vorhandene Restriktionsstellen sind für pIG3B angegeben (C), mit Ausnahme von PstI, das in der MCS und im Plasmid-Rückgrat schneidet (2C).

3. Konstruktion einer Lkt-Expressionskassette für die Verwendung in P. haemolytica. Die Lkt-Expressionskassette, verknüpft mit dem Gen für die Kanamycin-Resistenz, von pQE-LktK wurde als ein SphII-Restriktionsfragment isoliert, mit T4-DNA-Polymerase behandelt, um stumpfe Enden zu erzeugen, und in die einmal vorhandene EcoRV-Stelle von pIG3B kloniert. Es sind nicht alle einmal vorhandenen Restriktionsstellen in der multiplen Klonierungsstelle von pIG3B angegeben.

4. Western-Blot-Analyse des Ph : Lkt-Stammes, der die Lkt-Expressionskassette enthält. Es wurden Proben von exponentiell wachsenden Kulturen von P. haemolytica EMAI, Ph : Lkt und dem Ph : Lkt-Stamm, der die Lkt-Expressionskassette (pIG3B-Lkt) enthielt, mittels Western Blot untersucht. Toxinbanden wurden mittels eines Kaninchenantiserums gegen das Lkt nachgewiesen. Das Antiserum gegen Lkt band an ein Polypeptid, das bezüglich seiner Größe demjenigen des Lkt in Präparationen von P.-haemolytica-Stämmen EMAI und Ph : Lkt/pIG3B-Lkt entsprach, aber es erkannte nicht eine Bande ähnlicher Größe im Lkt-defizienten Stamm Ph : Lkt.

5. Kassetten auf der Basis von pIG für die Expression von CAT in Ph. Es wurde eine Reihe von Expressionskassetten auf der Basis von pIG für die Expression des CAT-Gens in Ph Konstruiert. Jedes Plasmid hatte die gleiche Struktur, bei der der Promotor 5' des CAT-Gens ausgerichtet war. Die in dieser Untersuchung eingesetzten Promotoren waren: der Ph-Lkt-Promotor, der DNT-Promotor, der aus dem dermonekrotischen Toxin von Pasteurella multocida isoliert worden war, und der APX1-Promotor, der aus dem APX1-Toxin von Actinobacillus pleuropneumoniae isoliert worden war.

MATERIALIEN UND METHODEN Bakterienstämme und Wachstumsbedingungen

Die in dieser Untersuchung verwendeten P.-haemolytica-Stämme wurden vom NSW Dept. Agriculture, Elizabeth Macarthur Institute, Menangle (EMAI; Australien) oder von der American Type Culture Collection (ATCC) bezogen. Die P.-haemolytica-Stämme wurden in Gehirn-Herz-Infusionslösung (brain heart infusion broth, BHI) bei 37°C unter kontinuierlichem Schütteln gezüchtet. Blutagar wurde hergestellt, indem 5% sterile defibrinierte rote Blutzellen vom Schaf dem BHI-Agar zugegeben wurden. Antibiotika wurden in einer Endkonzentration des Kanamycins von 25 &mgr;g/ml eingesetzt. Der E.-coli-Stamm DH5&agr; wurde in der gesamten Studie eingesetzt, und zwar unter Verwendung von Standardtechniken, wie sie bei Sambrook et al. (1989) umrissen werden.

Isolierung von genomischer DNA aus P. haemolytica

Die in 1 ml einer Übernachtkultur von P. haemolytica EMAI, die in BHI gezüchtet worden war, vorhandenen Bakterien wurden durch Zentrifugation gesammelt, und der Überstand wurde verworfen. Das Pellet wurde in 1 ml TE (10 mM Tris-HCl, pH 8,5/1 mM EDTA), das Lysozym (7,5 mg/ml) enthielt, resuspendiert und 2 Stunden bei 37°C inkubiert. Danach wurde die Lösung auf eine Endkonzentration von 0,1 M NaCl, 1% SDS und 2,5 &mgr;g/ml Proteinase K eingestellt, und die Inkubation wurde über Nacht bei 50°C fortgesetzt. Am folgenden Tag wurde die Präparation auf 0,5 M NaCl eingestellt und zweimal mit Phenol/Chloroform/Isoamylalkohol (100 : 99 : 1, Vol./Vol./Vol.) extrahiert, und die genomische DNA wurde dann durch Zugabe von 0,6 Volumina Isopropanol ausgefällt.

Isolierung und Klonierung des Lkt-Gens

Die Amplifizierung des Lkt-Gens erfolgte mittels der Polymerase-Kettenreaktion (PCR). Die Reaktionen wurden in Volumina von 50 &mgr;l durchgeführt, die 50 ng genomische DNA (EMAI), 3 &eegr;g Oligonucleotidprimer, 50 mM KCl, 10 mM Tris-HCl, pH 8,3, 2,5 mM MgCl2, 200 mg/ml BSA, 200 mM von jeweils dATP, dCTP, dGTP und dTTP plus 1 Einheit Taq-DNA-Polymerase (Perkin Elmer Cetus, USA) enthielt. Die Reaktionsmischungen wurden mit dem gleichen Volumen Paraffinöl überschichtet und 1 min auf 94°C erhitzt, 2 min auf 55°C abgekühlt und 5 min auf 72°C erhitzt. Dieser Zyklus wurde 35-mal unter Verwendung eines DNA-Thermocyclers von Perkin-Elmer-Cetus wiederholt. Spezifische Oligonucleotide wurden auf der Basis der veröffentlichten Sequenz des Lkt-Gens (Lo et al., 1987; Highlander et al., 1989) konstruiert. Die Sequenz der beiden Oligonucleotide war 5' CGCGGATCCCGGGCCATGGGAACTAGACTTACAACC 3' und 5' CGCGAATTCTTAAGCTGCTCTAGC 3', und sie war so konstruiert, dass ein PCR-Produkt mit einer BamHI-Stelle am 5'-Ende und einer EcoRI-Stelle am 3'-Ende erzeugt wurde, um die Klonierung zu erleichtern. Die Oligonucleotide wurden mittels des Gene Assembler Plus Synthesiser (Pharmacia, Schweden) synthetisiert. Produkte der PCR-Reaktionen, die dem vorhergesagten Molekulargewicht des Lkt-Gens entsprachen, wurden aus Agarosegelen mittels Gene-Cleaning (BRESATech, Australien) isoliert, mit BamHI und EcoRI restriktionsverdaut und in die entsprechenden Stellen von pUC18 (Yanish-Perron et al., 1985) kloniert, um das Plasmid pUC-Lkt zu erzeugen. Die Bestätigung, dass Klone das Lkt-Gen enthielten, wurde über eine Doppelstrang-Sequenzierung erhalten (Ergebnisse nicht gezeigt).

Transformation von P. haemolytica mit Plasmid-DNA

Elektrokompetente P. haemolytica wurden durch das Inokulieren von BHI-Nährmedium mit einer einzigen Kolonie aus einer über Nacht inkubierten BHI/Blutagar-Platte präpariert. Man ließ die Kultur wachsen, bis ein OD600-Wert von 0,8 erreicht wurde, wobei sich die Kultur zu dieser Zeit in der Mitte der logarithmischen Wachstumsphase befand (Daten nicht gezeigt). Die Bakterien wurden durch Zentrifugieren geerntet, dreimal mit 15% Glycerin gewaschen und in 1/50 des ursprünglichen Volumens resuspendiert. Aliquots (50 &mgr;l) von elektrokompetenten P. haemolytica wurden mit Plasmid-DNA unter Einsatz der folgenden Bedingungen transformiert: 1000 &OHgr;, 2,25 kV und 25 &mgr;F in 0,2-cm-Küvetten. Nach der Elektroporation ließ man die transformierten Zellen in BHI-Nährmedium wachsen, wobei 4 Stunden bei 37°C geschüttelt wurde, und zwar ohne Antibiotikumselektion, ehe sie auf BHI-Agar, der das entsprechende Antibiotikum für die Selektion enthielt, ausplattiert wurden.

Herstellung von Antiseren

Der mittels PCR erhaltene offene Leserahmen des Lkt wurde aus pUC-Lkt so in den Expressionsvektor pGEX2T subkloniert, dass er sich im Leserahmen mit dem GST-Gen befand. Das GST-Lkt-Fusionsprotein wurde über eine GST-Affinitätschromatographie gereinigt, wie es in der Anleitung des Herstellers (Pharmacia, Schweden) angegeben ist.

Kaninchen erhielten insgesamt drei Dosen an gereinigtem Protein (100 &mgr;g) in Abständen von zwei Wochen, wobei die erste in Freunds komplettem Adjuvans gegeben wurde und die nachfolgenden Impfungen in Freunds unvollständigem Adjuvans erfolgten. Seren wurden zwei Wochen nach der letzten Boosterung gewonnen.

Western-Blot-Analyse

Die Western-Blot-Analyse (Immunoblot-Analyse) wurde mittels des Verfahrens von Sambrook et al. (1989) durchgeführt. Kaninchenseren gegen das GST-Lkt-Fusionsprotein wurden zum Nachweis des Lkt in einer Verdünnung von 1 : 50 eingesetzt. Beim Konjugat, das in einer 1 : 1000-Verdünnung eingesetzt wurde, handelte es sich um HRP-konjugiertes Schaf-Antiserum gegen affinitätsgereinigtes Kaninchen-Ig (Sienus), wobei Tetramethylbenzidin (McKimm-Breschkin 1990) als Substrat eingesetzt wurde. Bakterienproben für die Western-Blot-Analyse wurden durch das 1 : 20-Verdünnen von Übernacht-Kulturen im geeigneten Wachstumsmedium und das Inkubieren bei 37°C unter heftigem Schütteln, bis ein OD600-Wert von 0,8 erreicht wurde, präpariert. An diesem Punkt wurden Proben, die 20 &mgr;l der Gesamtkultur enthielten, mittels SDS-PAGE analysiert, und die Proteine wurden mittels einer Bio-Rad Transblot Cell auf Nitrocellulose (Bio-Rad) transferiert, wie es in den Beschreibungen des Herstellers beschrieben wird.

Konstruktion einer Lkt-Expressionskassette für P. haemolytica

Der offene Leserahmen (open reading frame, ORF) des Lkt wurde von pUC-Lkt in den Expressionsvektor pQE30 (QIAGEN Inc., Chatsworth, Kalifornien, USA) im Leserahmen mit dem Signal für die Poly-His-Reinigung kloniert, wie es in der 1 skizziert ist. Die Expression des Lkt-Gens von pQE30 (qQE-Lkt) stand unter der Kontrolle des Promotors des E.-coli-Phagen T5 und von zwei Lac-Operator-Sequenzen. Zur Erleichterung der Subklonierung dieses Expressionselements von pQE-Lkt in alternative Plasmide wurde das Gen für die Kanamycin-Resistenz aus pUC4K (Pharmacia) isoliert und einem Shuttling durch pIC20R unterzogen, ehe es in pQE-Lkt kloniert wurde, wie es in der 1 skizziert ist. Das resultierende Plasmid, pQE-LktK, enthält das Gen für die Kanamycin-Resistenz und das Lkt-Gen, verknüpft mit dem T5-Promotor, und beide werden von einmal vorhandenen SphI-Restriktionsstellen flankiert (1).

Ein Plasmid, das für die Transformation von P. haemolytica geeignet ist, ist in unserem Labor entwickelt worden. Das Ausgangsplasmid wurde aus einem australischen Stamm von Actinobacillus pleuropneumoniae isoliert, und es wurde zu dem Plasmidvektor pIG3B weiter entwickelt, wie es in den 2A, 2B und 2C skizziert ist. Das SphI-Restriktionsfragment, das das Lkt-Gen enthielt, sowie die Steuerungssignale für die Transkription wurden aus pQE-T1K isoliert und in die EcoRV-Stelle von pIG3B subkloniert, um den Expressionsvektor pIG3B-Lkt für das P.-haemolytica-Gen Lkt A zu erzeugen, wie es in der 3 umrissen ist.

Konstruktion eines P.-haemolytica-Impfstammes

Während eines Verfahrens einer ortsgerichteten Mutagenese des Chromosoms von P. haemolytica (Stamm EMAI), das so ausgelegt war, dass ein kleiner Teil des Lkt-C-Gens deletiert wurde, wurde ein Isolat erhalten, das auf Blutagarplatten keine Hämolysezone erzeugte. Eine weitere Charakterisierung dieses Stammes (Ph : Lkt) zeigte, dass er unfähig zur Herstellung sowohl von Lkt C als auch von Lkt A war.

Der Ph : Lkt-Stamm wurde mit pIG3B-Lkt transformiert, wie es in Materialien und Methoden beschrieben wurde, und DNA wurde aus Kanamycin-resistenten Kolonien isoliert und über einen Restriktionsverdau analysiert, um die vorhergesagten Profile von pIG3B-Lkt zu bestätigen.

Charakterisierung des P.-haemolytica-Impfstammes

Übernachtkulturen des Ph : Lkt-Stammes, der pIG3B-Lkt enthielt, sowie der P.-haemolytica-Stämme Ph : Lkt und von ATCC-Stämmen wurden mittels Western Blotting unter Verwendung von Antiseren, die in Kaninchen gegen das mittels einer GST-Affinitätschromatographie gereinigte Lkt-Protein, gewonnen wurden, untersucht. Aus dem Western Blot (4) geht hervor, dass der Ph : Lkt-Stamm keine in den Seren vorhandenen Antikörper spezifisch band, während sowohl der Wildtyp-ATCC-Stamm als auch der Ph : Lkt-Stamm, der pIG3B-Lkt enthielt, Proteine mit dem vorhergesagten . Molekulargewicht des Lkt, die mit dem Lkt-Antiserum reagierten, erzeugten.

BEISPIEL 1 TESTUNG DES PH-TOX-IMPFSTAMMES AN RINDERN

Rindern, die ungefähr ein Jahr alt waren, wurde vor ihrer Verwendung Blut entnommen, um die Abwesenheit bereits vorhandener Antikörper gegen Ph zu bestätigen, und anschließend wurden sie in zwei Zufallsgruppen aus jeweils drei Tieren eingeteilt. Am Tage 0 erhielt eine Gruppe von drei Tieren 50 ml einer exponentiell wachsenden Kultur von Ph-Lkt (entsprechend 5 × 1010 CFU) über eine intratracheale Inokulation verabreicht. Vor dem Impfexperiment waren Experimente durchgeführt worden, in denen Rindern Dosierungen des pH-Lkt-Impfstammes, die von 5 × 1010 bis 2 × 1011 reichten, verabreicht wurden, die Tiere bezüglich klinischer Zeichen überwacht und eine Woche nach dem Challenge einer Autopsie unterzogen wurden, um zu bestimmen, ob sich Lungenschäden entwickelt hatten. Bei allen getesteten Dosierungen waren keine Lungenschäden gefunden worden, und die Rinder hatten keine Körpertemperaturen, die außerhalb des Normalbereiches lagen. Die zweite Gruppe diente als nicht geimpfte Kontrollen. Am Tage 14 wurden die Rinder erneut wie am Tage 0 geimpft. Am Tage 28 wurden alle Ringer mit 100 ml einer exponentiell wachsenden Kultur von Wiltyp-Ph (entsprechend 1 × 1011 CFU) über eine direkte Inokulation in die Trachea provoziert. Klinische Zeichen wurden über die nächsten 8 Tage verfolgt, und zu diesem Zeitpunkt wurden alle Tiere getötet und auf Lungenschäden untersucht.

Die Zahl und die Schwere der in jedem Tier bei der Autopsie 8 Tage nach dem Challenge gefundenen Lungenschäden sind in der Tabelle 1 dargestellt. Das Challenge der nichtgeimpften Kontrollen mit Ph führte bei zwei der drei provozierten Rinder zu einer akuten Lungenentzündung. Das dritte Tier zeigte bei der Autopsie keine Zeichen einer Ph-Infektion, möglicherweise als Folge eines Fehlers bei der Verabreichung des Challenge über die Trachea oder, alternativ, da Ph bei einer großen Zahl von Rindern kommensal vorliegt, könnte dieses Tier vor dem Challenge eine Immunität gegen Ph entwickelt haben. Innerhalb der geimpften Gruppe von Tieren entwickelte nur eines Anzeichen einer Ph-Infektion. Diese bestanden aus mehreren verdichteten Läppchen (mit einer Größe von unter 1 cm) im rechten apikalen Flügel.

Dieses Experiment zeigt eindeutig das Potential von Ph-Lkt für eine Verwendung als Lebendimpfstoff für den Schutz von Rindern gegen eine Ph-induzierte BRD an. Es wurde gefunden, dass ein Challenge mit dem Ph-Lkt-Stamm keine Schäden in den Lungen von Rindern induziert (bis zu einer Dosis von 1011 CFU), und somit beeinflusst der Impfstamm Rinder nicht nachteilig. In Experimenten, die durchgeführt wurden, um die geeignetste Challengedosis zu bestimmen, führte ein Challenge mit Wildtyp-Ph mit der dreifachen Dosis, die in diesem Experiment eingesetzt wurde, zum Tod der Tiere (3 von 3 Tieren) in weniger als 48 Stunden. Sogar bei einem extremen Challenge mit 1 × 1011 CFU zeigte nur eines der geimpften Tiere ein Zeichen einer Ph-Infektion, und das in erheblich geringerem Ausmaß, als es bei zwei von drei nicht-geimpften Kontrollen gesehen wurde. Eine weitere Charakterisierung der Schäden in diesem Tier zeigte, dass sie eine chronische Form hatten und älter als 8 Tage waren (d. h. vor dem Challenge vorhanden waren). Es zeigte sich, dass die Ph, die aus diesem Schaden isoliert wurden, Lkt produzierten, und somit handelte es sich bei ihnen nicht um den Impfstamm. Möglicherweise resultierte dieser Schaden aus der Etablierung einer opportunistischen Infektion mit dem Ph-Wildtyp während der Impfung. Ein Tier entwickelte zwar schwache Anzeichen einer Infektion mit dem Ph-Lkt-Stamm, aber die Annahme erscheint vernünftig, dass die Expression einer inaktiven Form von Lkt, von der bekannt ist, dass sie eine Rolle bei der schützenden Immunität spielt, das Ausmaß des erhaltenen Schutzes erhöhen würde. Das Potential zur Expression inaktiver Formen des Lkt aus diesem Stamm wurde an anderer Stelle in diesem Dokument demonstriert (4).

Expression fremder Proteine über Ph-Vektoren

Das Potential zur Expression rekombinanter Gene von Ph wurde an früherer Stelle in diesem Dokument demonstriert, wobei das Lkt-Gen von einem Plasmid im Ph-Tox-Stamm exprimiert wurde. Für das von dem Plasmid exprimierte Lkt zeigte sich in Western Blots, dass es mit Antiseren, die gegen Lkt gewonnen worden waren, reagierte (4). Zusätzlich zur Expression des Lkt aus Ph ist es auch möglich, dass weitere Antigene von einem Ph-Stamm, der zuvor über eine Modifikation des Lkt-Operons avirulent gemacht wurde, exprimiert werden könnten, um multivalente Impfstoffe zu erzeugen.

Um das Potential von Ph zur Wirkung als bakterieller Vektor weiter zu demonstrieren, wurde eine Reihe von Expressionskassetten auf der Basis von pIG (5) konstruiert, bei denen verschiedene Promotoren verwendet wurden, um die Expression des Chloramphenicolacetyltransferase-Gens (CAT-Gens) anzutreiben. Das CAT-Gen codiert für ein Enzym, das eine Resistenz gegen das Antibiotikum Chloramphenicol bewirkt, und das leicht über Enzymreaktionen quantifiziert werden kann. Die Promotoren, die für das Antreiben der Expression des CAT-Gens in Ph verwendet wurden, wurden in unserem Labor aus verschiedenen Bakterien isoliert, die zur Pasteurellaceae-Familie gehören. Die verschiedenen Promotor/CAT-Kassetten (pIG-CAT) wurden in E. coli konstruiert und dann, wie es in Materialien und Methoden beschrieben wird, in Ph transformiert. Plasmid-DNA wurde aus Antibiotikum-resistenten Kolonien isoliert und über einen Restriktionsverdau analysiert, um die vorhergesagten Profile zu bestätigen. Für alle mit den CAT-Expressionskassetten transformierten Ph-Stämme wurde gefunden, dass sie gegen das Antibiotikum Chloramphenicol resistent waren. Das Ausmaß der CAT-Aktivität, das von jedem Konstrukt exprimiert wurde, wurde mittels Enzymtests bestimmt.

Eine Probe einer exponentiell wachsenden Kultur von Ph/pIG-CAT wurde abzentrifugiert, und die Bakterien wurden in Tris, pH 8,0, resuspendiert. Die löslichen Proteine wurden aus den Bakterien über eine Ultraschallbehandlung und Zentrifugation isoliert, und der Extrakt wurde in CAT-Tests eingesetzt, wobei die CAT-Enzymtests 150 &mgr;l Reaktionspuffer (Chloramphenicol 1 mg/ml, 3H-CoA 0,1 &mgr;l/150 &mgr;l (Amersham International), Tris pH 8,0) und 50 &mgr;l Proteinextrakt enthielten. Man ließ die Reaktionen 30 Minuten lang ablaufen, und das Ausmaß der CAT-Enzymaktivität wurde mittels Szintillationszählung unter Verwendung von Econoflur-Szintillationsflüssigkeit (Dupont) bestimmt. Die CAT-Enzymreaktionen basieren auf der Übertragung der 3H-Gruppe von einem Substrat, das in organischen Lösemitteln (Szintillationsflüssigkeit) unlöslich ist, auf ein in organischen Lösemitteln lösliches Produkt durch das CAT-Enzym. Für alle überprüften Promotoren wurde gefunden, dass sie für eine Erzielung der Expression des fremden Gens in Ph geeignet sind, wobei die erhaltenen CAT-Spiegel für alle Ph/pIG-CAT-Konstrukte signifikant über den Background-Werten lagen (Tabelle 2).

Die Entwicklung von Ph als bakterielles Vektorsystem wird es ermöglichen, fremde Proteine von kommerzieller Bedeutung der Mukosa von Rindern zu verabreichen. Zu den Proteintypen, die verabreicht werden könnten, gehören Cytokine, die das Immunsystem steuern und regulieren, und die dazu dienen würden, das Immunsystem unspezifisch hochzuregulieren. Das bzw. die über den Vektor übertragene(n) Moleküle) könnte(n) auch schützende Antigene anderer pathogener Bakterien sein, wodurch das Potential für die Konstruktion multivalenter Impfstoffe bereit gestellt wird. Derartige Impfstoffe hätten das Potential, nach einer einzigen Impfung einen Schutz vor mehr als einer Krankheit bereit zu stellen.

Tabelle 1 Bei der Autopsie von Rindern gefundene Lungenschäden

Rinder wurden zweimal in einem Abstand von zwei Wochen mit Ph-Lkt geimpft und zwei Wochen nach der letzten Impfung mit Wildtyp-Ph provoziert. Die Autopsien wurden 8 Tage nach dem Challenge durchgeführt, wobei die Lungenschäden bestimmt wurden. Gruppe 1 Nicht geimpft und provoziert 1. Kein Zeichen einer Ph-Infektion 2 & 3 Akute Lungenentzündung und Verdichtung im rechten apikalen Lungenflügel. Akute adhäsive Pleuritis. Ein Tier hatte auch eine lokalisierte Adhäsion zwischen dem rechten diaphragmatischen Flügel und dem Perikard. Gruppe 2 Geimpft und provoziert 1 & 2 Kein Anzeichen einer Ph-Infektion 3. Verschiedene Läppchen von weniger als 1 cm im rechten apikalen Flügel. (Schäden chronisch, älter als 8 Tage)

Tabelle 2 Expression des CAT-Gens in Ph

Ph wurde mit verschiedenen Promotor/CAT-Konstrukten transformiert, und es wurde das Ausmaß der CAT-Genexpression über Enzymreaktionen bestimmt. Die Ergebnisse sind als Zählereignisse pro 30 Sekunden ausgedrückt. Tris diente als Negativkontrolle zur Messung des spontanen Zerfalls des CAT-Substrats zu messen. Promotor CAT-Aktivität kein Promotor 200 Lkt 29 300 APX1 40 000 DNT 44 500

LITERATURSTELLEN

Adam, C., Knights, J. M., Mudridge, A., Lindon, J. C., Baker, P. R. W., Beesley, J. E., Spacey, B., Carig, G. R. and Nagy, L. K. (1984) Purification, characterization, and immunological properties of serotype-specific polysaccharide of Pasteurella haemolytica (serotype A1) organisms. J. Gen. Microbiol. 130: 2415–2426.

Bennett, B. W. (1982) Efficacy of Pasteurella bacterins for yearling feedlot heifers. Bovine Pract. 3: 26–30.

Coote, J. G. (1992) Structural relationships among the RTX determinants of Gram-negative bacteria. FEMS Micro. Rev. 88: 137–162.

Frank, G. H. and Smith, P. C. (1983) Prevalence of Pasteurella haemolytica in transported calves. Am J. Vet. Res. 44: 981–985.

Gentry, M. J., Confer, A. W. and Panceirta, R. J. (1982) Serum neutralization of cytotoxin from Pasteurella haemolytica leukotoxin gene cluster. DNA 8: 15–28.

Lo, R. Y. C. Strathdee, C. A. and Shewen, P. E. (1987) Nucleotide sequence of the leukotoxin genes of Pasteurella haemolytica A1. Infection and Immunity 55: 1987–1996.

Morter, R. L., Amstutz, H. E., Crandell. R. A. (1982) Clinical evaluation of prophylactic regimens for bovine respiratory disease. Bovine Prac. 17: 56–58.

McKimm-Breschkin, J. L. (1990) The use of tetramethylbenzidine for solid phase immunoassays. J. Immunol. Methods 135: 277–280.

Mosier, D. A., Confer, A. W., Hall, S. M., Gentry, M. J. and Panciera, R. J. (1986) Enzymelinked immunosorbant assay for the detection of serum antibodies to Pasteurella haemolytica cytotoxin (leukotoxin) in cattle. J Clin. Microbiol. 24: 218–222.

Mosier, D. A. Simons, K. R., Confer, A. W., Panciera, R. J. and Clinkenbeard, K. D. (1989) Pasteurella haemolytica antigens associated with resistance to pneumoic pasteurellosis. Infect. Immun. 57: 711–716.

Sambrook, J., Fritsch, E. F. und Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2. Auflage, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, New York.

Schiefer, B., Ward, G. E. und Moffatt, R. E. (1978) Correlation of microbiological and histological findings in bovine fibrinous pneumonia. Vet. Pathol. 15: 313–321.

Shewen P. E. und Wilkie B. N. (1982) Cytotoxin of Pasteurella haemolytica acting on bovine leukocytes. Infect. Immun. 35: 91–94.

Shewen, P. E. und Wilkie B. N. (1987) Vaccination of calves with leukotoxic culture supernatant from Pasteurella haemolytica. Can. J. Vet. Res. 52: 30–36.

Strathdee, A. A. und Lo, R. Y. C. (1989) Cloning, nucleotide sequence, and characterisation of genes encoding the Pasteurella haemolytica leukotoxin determinant. J. Bact 171: 916–928.

Yanisch-Perron, C., Viejra, J. und Messing, J. (1985) Improved M13 phage cloning vectors and host strains; nucleotide sequence of the M13mp18 and pUC19 vectors. Gene 33: 103–119.


Anspruch[de]
  1. Genetisch modifizierte Pasteurella haemolytica, die ein Lkt-Toxin-Operon aufweist, das ein Lkt-Struktur-Gen und ein partiell oder vollständig inaktiviertes Lkt-Gen für die posttranslationale Aktivierung einschließt, die ein Lkt-Toxin erzeugt, wobei das Lkt-Toxin teilweise oder vollständig inaktiviert ist.
  2. Genetisch modifizierte Pasteurella haemolytica nach Anspruch 1, die in einem Wirt ein schützende Immunität gegenüber dem Lkt-Struktur-Polypeptid und gegen eine Infektion durch Pasteurella haemolytica induziert.
  3. Genetisch modifizierte Pasteurella haemolytica nach Anspruch 1 oder 2, wobei das partiell oder vollständig inaktivierte Lkt-Toxin ein Vorläufer eines Lkt-Toxins ist.
  4. Genetisch modifizierte Pasteurella haemolytica nach irgendeinem der Ansprüche 1 bis 3, wobei das teilweise oder vollständig inaktivierte Lkt-Toxin ein nichtprozessiertes Expressionsprodukt eines Lkt-Strukturgens ist.
  5. Genetisch modifizierte Pasteurella haemolytica nach irgendeinem der Ansprüche 1 bis 4, wobei das Struktur-Gen ein Lkt-A-Gen ist.
  6. Genetisch modifizierte Pasteurella haemolytica nach irgendeinem der Ansprüche 1 bis 5, wobei der posttranslationale Aktivator teilweise oder vollständig eliminiert ist.
  7. Genetisch modifizierte Pasteurella haemolytica nach irgendeinem der Ansprüche 1 bis 6, wobei der posttranslationale Aktivator ein Produkt eines Lkt-C-Gens ist.
  8. Genetisch modifizierte Pasteurella haemolytica nach irgendeinem der Ansprüche 1 bis 7, wobei der posttranslationale Aktivator mittels solcher rekombinanter DNA-Techniken teilweise oder vollständig inaktiviert ist, die die Einführung oder Eliminierung von DNA aus dem Gen, das für den posttranslationalen Aktivator codiert, umfassen, einschließlich einer Substitution, Addition und/oder Deletion eines einzelnen oder mehrerer Nucleotide, einschließlich einer vollständigen oder teilweisen Eliminierung des Gens, einer homologen Rekombination unter Verwendung eines Zielkonstrukts oder einer Plasmid-Segregation und einer chemisch induzierten, durch Strahlung induzierten oder ortsspezifischen Mutagenese.
  9. Genetisch modifizierte Pasteurella haemolytica nach irgendeinem der Ansprüche 1 bis 8, wobei die Pasteurella haemolytica nicht in der Lage ist, wenigstens eines der Proteine zu erzeugen, die an der Sekretion eines Lkt-Toxin-Genprodukts beteiligt sind.
  10. Genetisch modifizierte Pasteurella haemolytica nach Anspruch 9, wobei die Pasteurella haemolytica ein teilweise oder vollständig inaktiviertes Lkt-B- und/oder ein teilweise oder vollständig inaktiviertes Lkt-D-Gen aufweist.
  11. Expressionsvektor, der für ein inaktives Lkt-Toxin codiert, wobei der genannte Expressionsvektor ein Lkt-Toxin-Operon aufweist, wie es in irgendeinem der Ansprüche 1 oder 3 bis 8 definiert ist.
  12. Expressionsvektor nach Anspruch 11, der aus der Gruppe ausgewählt ist, die pIG3B und pIG3B-Lkt einschließt.
  13. Produkt eines Lkt-Toxin-Operons, für das ein Expressionsvektor nach Anspruch 11 oder Anspruch 12 codiert.
  14. Impfstoffzusammensetzung zur Induzierung einer Immunantwort auf ein Lkt-Toxin in einem Wirtstier, wobei die genannte Impfstoffzusammensetzung ein Lkt-Toxin-Genprodukt nach Anspruch 13 beinhaltet.
  15. Impfstoffzusammensetzung zur Induzuierung einer Immunantwort gegen ein Lkt-Toxin in einem Wirtstier, wobei die genannte Impfstoffzusammensetzung eine modifizierte Pasteurella haemolytica beinhaltet, wie sie in irgendeinem der Ansprüche 1 bis 10 definiert ist.
  16. Impfstoffzusammensetzung nach Anspruch 14 oder Anspruch 15 zur Induzierung einer Immunantwort gegenüber einem Bereich von Serovaren eines Mikroorganismus, der das entsprechende Lkt-Toxin erzeugt.
  17. Biologischer Vektor, der einen genetisch modifizierten Mikroorganismus nach irgendeinem der Ansprüche 1 bis 10 einschließt und außerdem biologisch aktive Moleküle bereitstellt, die in der Lage sind, eine Antwort in einem Wirtstier zu verstärken.
  18. Biologischer Vektor nach Anspruch 17, wobei das biologisch aktive Molekül aus der Gruppe ausgewählt ist, die funktionelle Moleküle, wie Wachstumsfaktoren, Hormone, Enzyme, Antigene oder deren antigene Teile, Cytokine wie Interleukine, Interferone und Tumornekrosefaktoren einschließt.
  19. Biologischer Vektor nach Anspruch 17 oder Anspruch 18, wobei das biologisch aktive Molekül von dem biologischen Vektor mit einem Plasmid, das ein Gen trägt, das für das biologisch aktive Molekül codiert, exprimiert wird.
  20. Biologischer Vektor nach irgendeinem der Ansprüche 17 bis 19, wobei der genannte Mikroorganismus in der Lage ist, eine Immunantwort gegenüber zwei oder mehr Antigen-Epitopen zu erzeugen, die für den Mikroorganismus findigen sind.
  21. Biologischer Vektor nach Anspruch 20, wobei die genannte Immunantwort gegenüber einer virulenten Form des Mikroorganismus und gegenüber heterologen Antigenen, die von dem Mikroorganismus exprimiert werden, induziert wird.
  22. Biologischer Vektor nach Anspruch 20 oder Anspruch 21, wobei die Immunantwort gegen ein Lkt-Toxin und wenigstens ein Antigen-Epitop von einem oder mehreren pathogenen Agentien induziert wird, die ausgewählt sind aus bakeriellen Pathogenen, die Pasteurella spp., Haemophilus spp., Moraxella spp., Leptospira spp., Streptococcus spp., Salmonella spp., E. coli, Fusobacterium spp., Clostridium spp., Mycobacterium spp. einschließen; aus Endoparasiten, die Haemonchus spp., Trichostrongylus spp. einschließen; aus Ectoparasiten, die Boophilus spp. einschließen; aus viralen Pathogenen, die das bovine Virus Diarrhoe-Virus (BVDV), das Parainfluenza-Virus (PI3), die infektiöse bovine Rhinotracheitis (IBR), das Corona-Virus und das Rota-Virus einschließen.
  23. Verfahren zur Herstellung einer genetisch modifizierten Pasteurella haemolytica, die ein inaktives Lkt-Toxin erzeugt, wobei das genannte Lkt-Toxin teilweise oder vollständig inaktiviert ist, wobei das Verfahren einschließt

    Bereitstellen einer Pasteurella haemolytica, die ein aktives Lkt-Toxin erzeugt; und

    teilweise oder vollständig Inaktivieren eines Lkt-Gens für die posttranslationale Aktivierung in der Pasteurella haemolytica.
  24. Verwendung einer immunologisch wirksamen Menge einer Impfstoffzusammensetzung nach irgendeinem der Ansprüche 14 bis 16 zur Herstellung eines Arzneimittels zum Impfen eines Tiers gegen einen Mikroorganismus, der Lkt-Toxin produziert.
  25. Verwendung einer immunologisch wirksamen Menge einer Impfstoffzusammensetzung nach irgendeinem der Ansprüche 14 bis 16 bei der Herstellung eines Arzneimittels zur Verwendung bei der Behandlung des bovinen respiratorischen Erkrankungs (BRD)-Komplexes.
  26. Verfahren zur Herstellung eines inaktiven Lkt-Toxins, wobei das Verfahren die Kultivierung einer genetisch modifizierten Pasteurella haemolytica nach irgendeinem der Ansprüche 1 bis 10 und die Gewinnung des teilweise oder vollständig inaktiven Toxins, das von diesem Mikroorganismus erzeugt wird, umfaßt.
Es folgen 4 Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com