PatentDe  


Dokumentenidentifikation DE69533092T2 09.06.2005
EP-Veröffentlichungsnummer 0000804454
Titel HYBRIDISIERUNGS- UND ABDRUCKVERFAHREN ZUR CHARAKTERISIERUNG ODER INTERAKTIONEN VON 16S-rRNS-ANALOGEN ZUR IDENTIFIZIERUNG NEUER ANTIBIOTIKA
Anmelder University of Massachusetts Medical Center, Worcester, Mass., US
Erfinder STERN, Seth, Sterling, US;
PUROHIT, Prakash, Worcester, US
Vertreter Dr. Volker Vossius, Corinna Vossius, Tilman Vossius, Dr. Martin Grund, Dr. Georg Schnappauf, 81679 München
DE-Aktenzeichen 69533092
Vertragsstaaten CH, DE, FR, GB, IT, LI
Sprache des Dokument EN
EP-Anmeldetag 23.08.1995
EP-Aktenzeichen 959309261
WO-Anmeldetag 23.08.1995
PCT-Aktenzeichen PCT/US95/10721
WO-Veröffentlichungsnummer 0096006106
WO-Veröffentlichungsdatum 29.02.1996
EP-Offenlegungsdatum 05.11.1997
EP date of grant 26.05.2004
Veröffentlichungstag im Patentblatt 09.06.2005
IPC-Hauptklasse C07H 21/02
IPC-Nebenklasse C12Q 1/68   

Beschreibung[de]
Hintergrund der Erfindung

Das Gebiet der Erfindung ist die Bewertung von Therapeutika, die mit Ribonukleinsäure (RNA) wechselwirken, z. B. von Antibiotika, die an die 16S RNA binden und die Proteinsynthese hemmen.

Ribosomen sind große Ribonukleoproteine (RNPs) bestehend aus mehreren Untereinheiten, die für die Proteinsynthese verantwortlich sind und über Stämme sowohl strukturell als auch funktionell hoch konserviert sind. Sie umfassen große (50S) und kleine (30S) Untereinheiten, die aus ribosomalen RNAs bestehen und Proteine, die an die rRNA gebunden sind. Die ribosomale Untereinheit 30S enthält 16S rRNA, während die 50S Untereinheit 23S rRNa enthält. Ribosomen synthetisieren Proteine bei korrekter Bindung an Messenger-RNA (mRNA) und Transfer-RNA (tRNA).

Man nimmt an, dass der korrekte Zusammenbau der verschiedenen Bestandteile, die an der Proteinsynthese beteiligt sind, durch Bindestellen auf den tRNAs gesteuert wird. Zwei wichtige Bindestellen auf der rRNA für die Proteinsynthese sind die sogenannten A- und P-Stellen, die die hereinkommende Aminoacyl-tRNA (A-Stelle) bzw. die Peptidyl-tRNA (P-Stelle) aufnehmen. Bei Prokaryoten bestehen diese Stellen teilweise aus hoch geordneten Strukturen der 16S rRNA, wahrscheinlich in der Spalte der 30S Untereinheit.

Ribosomen sind in allen Spezies (Eukaryoten eingeschlossen) strukturell ähnlich, obwohl sich die primären Nukleotidsequenzen der rRNA Moleküle unterscheiden. Für eine Überblick über die Funktion ribosomaler RNA, siehe Noller, In the RNA world, Gesteland und Atkins (Hrsg.), 137–84 (CSHL Press, NY, 1993); Noller et al., In The Ribosome: Structure, Function, and Evolution, Hill et al., (Hrsg), 73–92 (American Soc. for Microbiol. Washington, DC, 1990).

Es ist nun allgemein akzeptiert, dass 16S und 23S rRNAs (die man in der ribosomalen 50S Untereinheit findet; analoge eukaryotische rRNAs sind 28S, 5.8S und 5S rRNA in der ribosomalen Untereinheit 60S, und 18S rRNA in der ribosomalen Untereinheit 40S) wichtige, wenn nicht essentielle Rollen bei der Dekodierung und bei Peptidyl-Transferase-Aktivitäten von Ribosomen spielen (Noller et al., 1990, supra, Noller, supra).

Die meisten Antibiotika, die Proteinsynthese hemmen, wirken direkt auf die Ribosomen. Einige Mutationen in ribosomalen Proteinen können z. B. zu Antibiotikaresistenz führen (Birge und Kurland (1969) Science, 166: 1282; Ozaki et al., (1969) Nature, 222: 333; Davies et al. (1965) Science, 149: 1096). Arbeiten auf diesem Gebiet haben auch gezeigt, dass Aminoglykosid-Antibiotika mit Stellen auf den ribosomalen Untereinheiten wechselwirken, wodurch RNA geschützt wird, wobei der Schutz durch RNA-Footprint-Assays sichtbar gemacht werden kann (z. B. Moazed und Noller (1987) Nature 327: 389; Woodcock et al. (1991) EMBO J., 10: 3099; Thompson und Cundliffe (1991) Biochimie, 73: 1131–1135).

Diese Forschungsarbeiten haben gezeigt, dass spezifische Nukleotide in der 16S rRNA Ziele für die Bindung von Aminoglykosiden wie Neomycin, Streptomycin, Hygromycin, Gentamycin und Tetrazyklin sind. In ähnlicher Weise sind spezifische Nukleotide in der 23S rRNA die Ziele zahlreicher MLS Verbindungen (Makrolide, Lincomycine und Streptogramine), einschließlich Erythromycin.

Einige Antibiotika (z. B. Edein, Pactamycin, Apramycin und Neamin) hemmen Proteinsynthese durch Störung der Bindung zwischen tRNA und den A- oder P-Stellen auf dem Ribosom während der Translation (Woodcock et al. (1991) EMBO J. 10: 3099). Wechselwirkungen von vielen dieser Verbindungen mit 16S rRNA in der ribosomalen Untereinheit 30S wurden auf verschiedenen funktionellen Stellen kartiert, hauptsächlich durch chemische Footprint-Analyse. Von anderen antibiotischen Verbindungen, wie vom Peptid-Antibiotikum Thiostrepton wurde gezeigt, dass sie auf ähnliche Weise mit der 23S rRNA in 50S Untereinheiten interagieren (Thompson und Cundliffe (1991) supra).

Einige Faktoren, die alle mit der strukturellen Komplexität des Ribosoms zusammenhängen, machen Screening-Assays kompliziert, die auf der Bindung eines möglichen Arzneistoffkandidats an ein ribosomales Ziel beruhen. Zunächst ist es schwierig, große Mengen aufgereinigter Ribosomen, auch aus gewöhnlichen Bakterien, zu gewinnen. Zweitens degradieren Ribosomen häufig bei typischen Screening-Bedingungen. Drittens ist es unklar, bis zu welchem Ausmaß die Fähigkeit einer Verbindung, an Ribosomen oder RNA Moleküle zu binden, ein Indikator für ihr Potential als Antibiotika ist.

Insbesondere sind auch kleine, gut definierte RNA-Moleküle komplexe Ziele für solche Arzneistoffscreening-Assays, da sie multiple Bindestellen für kleine Moleküle unterstützen. So stellt z. B. das polyanionische Phosphodiester-Gerüst einer Nukleinsäure für viele Verbindungen, die eine positive Ladung tragen, ein attraktives Bindeziel dar, genauso wie das hydrophobe helikale Zentrum für viele aromatische Verbindungen ein Ziel darstellt. Somit sind Verbindungen, die an Nukleinsäurereste binden, die nicht direkt mit der angestrebten Funktion in Verbindung stehen als Arzneistoff eher unnützlich.

Zusammenfassung der Erfindung

Die vorliegende Erfindung basiert auf der Entdeckung, dass relativ kleine RNA-Moleküle, „Oligoribonukleotid Analoga", die von Teilen größerer parentaler RNA-Strukturen abgeleitet sind (z. B. RNPs), überraschenderweise wichtige parentale Strukturen beibehalten, auch ohne den Rest der parentalen RNA Sequenzen) und ohne assoziierte Proteine. Oligoribonukleotid-Analoga sind für neue Verfahren zum Screening von Kandidatenverbindungen für antibiotische Aktivität nützlich. Purohit und Stern (Nature, 370, 1994, 659–662) beschreiben entworfene Oligoribonukleotid-Analoga, die in Wechselwirkungsassays verwendet werden, aber aus verschieden strukturellen Eigenschaften bestehen.

Die Erfindung betrifft daher in einem Aspekt ein Oligoribonukleotid-Analog eines Bereichs einer parentalen Ribonukleinsäure (RNA), umfassend (i) eine erste Nukleinsäurestruktur mit einer oder mehreren Nukleotidsequenzen, wobei die erste Struktur aus dem Bereich der parentalen RNA, z. B. 16S ribosomale RNA (rRNA) abgeleitet ist, wobei die Region in ihrem nativen Zustand mit einem Liganden-Bindungsmuster parentaler RNA an einen Liganden bindet, und (ii) eine zweite Nukleinsäurestruktur, die eine oder mehrere Nukleinsäuresequenzen aufweist, kombiniert mit der ersten Nukleinsäurestruktur zur Bildung des Analogs und zur Bereitstellung des Analogs mit einer Konformation, die den Liganden mit einem Liganden-Bindemuster bindet, das im wesentlichen identisch zum parentalen RNA-Liganden-Bindemuster ist.

Die hier verwendeten Begriffe „Oligoribonukleotid-Analog" oder „Analog" bezeichnen ein einzelsträngiges Molekül, bestehend aus Ribonukleinsäuren, das kleiner als die parentale RNA ist (z. B. mit insgesamt etwa 10 bis 700 Nukleotiden), welches sich zu einer bestimmten dreidimensionalen Konfiguration faltet, die die Struktur einer Subdomäne eines größeren parentalen RNA Moleküls nachahmt. Modifizierte RNAs, z. B. Phosphorthioate, Desoxynukleotide oder 2'-O-Methylsubstitutionen können ebenfalls dazu verwendet werden, den Analoga Stabilität zu verleihen.

Die Oligoribonukleotid-Analoga werden in vitro entweder durch Transkription von DNA Matrizen mit RNA Polymerase, z. B. T7 RNA Polymerase oder durch chemische Synthese mit einem käuflichen DNA/RNA Synthesegerät hergestellt. Im allgemeinen sind in einem Oligoribonukleotid-Analog etwa 10 Nukleotide bis zu einigen hundert Nukleotiden (und bevorzugt 20–50 Nukleotide) identisch zu Nukleotiden in einem Bereich der parentalen RNA (die Zahl der parental abgeleiteten Nukleotide wird durch die Sequenz bestimmt, die dazu nötig ist, eine funktionale Subdomäne nachzuahmen).

Die zweite Nukleinsäurestruktur kann heterologe (künstliche) Nukleotidsequenzen enthalten, d. h. Sequenzen, die in der parentalen RNA nicht existieren und die die Struktur des Analogs stabilisieren, wenn sie mit der ersten Nukleinsäurestruktur kombiniert werden. Der hier verwendete Begriff „kombiniert" bedeutet, dass die Nukleotidsequenzen der ersten und zweiten Nukleinsäurestrukturen derart gekoppelt sind, z. B. durch kovalente und nichtkovalente Verknüpfungen (z. B. Wasserstoffbrücken, ionische (elektrostatische) Wechselwirkungen, und/oder van der Waals Kräfte), dass das vollständige Analog ein Liganden-Bindemuster aufweist, dass im wesentlichen identisch ist zum Liganden-Bindemuster der parentalen RNA im nativen Zustand, d. h. im intakten Ribosom.

Der hier verwendete Begriff „parentale(s) RNA" Molekül oder -Struktur bezieht sich auf das/die natürlicherweise auftretende (oder „native") intakte RNA-Molekül oder Struktur (einschließlich assoziierter Proteine und anderen Bestandteilen der Struktur), von denen die erste Nukleinsäurestruktur des Oligoribonukleotids abgeleitet ist. Die parentale RNA kann ribosomale RNA, virale RNA wie HIV-RNA, messenger RNA oder spezifische zelluläre RNA regulatorische Elemente sein.

Bevorzugte HIV RNA Oligoribonukleotid-Analoga werden von der Tat-Bindestelle (TAR) oder dem Rev Response Element (RRE), insbesondere von einem Teil des RRE mit der Sequenz GCACUAUGGGCGCAGCGUCAAUGACGCUGACGGUACAGGCCAGACAAU UAUUGUCUGGUAUAGUGC (SEQ ID NO: 8) abgeleitet. Weiterhin kann, wenn der parentale RNA-bindende „Ligand" ein Aminoglykosid wie Neomycin ist, das rRNA Bindemuster auch als „Aminoglykosid-Schutzprofil" der parentalen RNA bezeichnet werden.

In spezifischen Ausführungsformen ist der Bereich der parentalen RNA eine dekodierende Region der 16S rRNA, der z. B. die Nukleotide 1398–1410 und 1490–1505 der 16S rRNA (von E. coli) umfasst. In anderen Ausführungsformen ist der Bereich die Subdomäne der A-Stelle der dekodierenden Region der 16S rRNA, die z. B. die Nukleotide 1404–1410 und 1490–1497 der 16S rRNA (von E. coli) umfasst. Der „dekodierende Bereich" ist der Teil der 16S rRNA, der im intakten Ribosom während der Proteinsynthese die tRNA mit der mRNA genau in Kontakt für eine richtige Kodon-Antikodon Basenpaarung bringt. Der dekodierende Bereich besteht aus der „A-Stelle", die im intakten Ribosom die hereinkommende Aminoacyl-tRNA aufnimmt und der „P-Stelle", die den Peptidyl-tRNA-Komplex enthält (wobei die tRNA noch an alle Aminosäuren gekoppelt ist, die bis dahin an die Kette angehängt wurden). Andere mögliche rRNAs, die in der Erfindung verwendet werden können, sind die 23S rRNAs von Prokaryoten; oder die 28S, 5.8S, 5S und 18S rRNAs von Eukaryoten.

Die zweite Nukleinsäurestruktur des Analogs kann eine stabile Stamm-Schleife, z. B. eine Tetra-Schleife enthalten, die z. B. die Nukleotidsequenz 5'-CCUUCGGG-3' besitzt, wobei die Nukleotide UUCG die Schleife bilden und die Nukleotide CC und GG gepaart sind. Die zweite Nukleinsäurestruktur kann auch zwei Nukleotidsequenzen enthalten, die eine basengepaarte stabile Helix bilden, die auch als Nukleotidklemme („nucleotide clamp") bekannt ist. Solch eine Klemme kann z. B. die folgende Nukleotidsequenz aufweisen:

3'-CGUGUC-5' oder 3'-CC-5'

5'-GCACAG-3' 5'-GG-3'

Spezifische Analoga der Erfindung umfassen eine erste Nukleinsäurestruktur, die von einem dekodierenden Bereich einer 16S rRNA abgeleitet sind und eine zweite Nukleinsäurestruktur, die eine Tetra-Schleife und eine basengepaarte Nukleotidklemme umfasst. Der dekodierende Bereich kann z. B. die Nukleotide 1398–1410 und 1490–1505 der 16S rRNA umfassen, die Tetra-Schleife kann die Nukleotidsequenz 5'-CCUUCGGG-3' aufweisen, die basengepaarte Nukleotidklemme kann die Nukleotidsequenz:

3'-CGUGUC-5'

5'-GCACAG-3'

haben, und die vollständige lineare Nukleotidsequenz der kombinierten ersten und zweiten Nukleotidstrukturen des Analogs wäre

5'-GCACAGACCG CCCGUCACAC CUUCGGGUCA AGUCGUAACA AGGCUGUGC-3' (SEQ ID NO: 1).

In einer anderen Ausführungsform kann das Analog von einem dekodierenden Bereich abgeleitet sein, der die Nukleotide 1404–1410 und 1490–1497 der 16S rRNA umfasst, die Tetraschleife kann die Nukleotidsequenz 5'-CCUUCGGG-3' haben, die basengepaarte Nukleotidklemme kann die Nukleotidsequenz:

3'-CC-5'

5'-GG-3'

haben, und die vollständige lineare Nukleotidsequenz der kombinierten ersten und zweiten Nukleotidstrukturen des Analogs wäre

5'-GGCGUCACACCUUCGGGUGA AGUCGCC-3' (SEQ ID NO: 11).

In einem anderen Aspekt betrifft die Erfindung einen Affinitäts-Assay zur Bestimmung der möglichen antibiotischen oder therapeutischen Aktivität einer Testverbindung; wobei der Assay die Schritte umfasst des (i) Vermischen einer Testverbindung mit einem erfindungsgemäßen Oligoribonukleotid-Analog unter Bedingungen, die die Bildung eines Bindungskomplexes zwischen dem Analog und der Testverbindung gestatten, und (ii) Nachweis der Bildung eines Bindungskomplexes, wobei die Anwesenheit eines Bindungskomplexes zeigt, dass die Testverbindung mögliche antibiotische Aktivität hat.

Die Testverbindungen zeigen bevorzugt eine spezifische Affinität, d. h. die bestimmte Wechselwirkung mit dem Oligoribonukleotid-Analog ist reproduzierbar und betrifft die gleichen Nukleotide im Analog. Je höher die Affinität des Testmoleküls für das Oligoribonukleotid, desto höher sein möglicher Nutzen als therapeutische/antibiotische Verbindung.

In spezifischen Ausführungsformen ist das Analog markiert, z. B. mit einer fluoreszierenden oder einer radioaktiven Markierung, und auf einer Oberfläche immobilisiert, und der Bindungskomplex wird durch das Überwachen von Änderungen des Signals der Markierung nachgewiesen, wenn eine Testverbindung an das Analog gebunden ist, oder das Analog wird auf einer Oberfläche immobilisiert, die Testverbindung wird markiert und der Bindungskomplex wird durch Nachweis einer der Markierungen nachgewiesen, die an die Oberfläche über das Analog gebunden sind.

In einer bevorzugten Ausführungsform wird der Affmitäts-Assay dazu verwendet, mögliche nützliche Verbindungen aus einem Gemisch von Verbindungen zu identifizieren. Dies beinhaltet die Schritte des In-Kontakt-Bringens des Analogs mit zahlreichen Testverbindungen, die im Gemisch vorliegen, das Isolieren der Analog-Testverbindung-Komplexe und das Bestimmen der Identität der Testverbindungen, die an das Analog binden. Ein Beispiel für ein solches Verbindungsgemisch ist eine kodierte Bibliothek kleiner Moleküle (vgl. z. B. Needels et al., 1993, PNAS 90: 10700–04).

In einer kodierten Bibliothek wird die molekulare Struktur synthetischer kleiner Moleküle, z. B. von Peptiden oder anderen organischen Molekülen z. B. von einem DNA-Strang kodiert. In einer kodierten Peptidbibliothek sind z. B. die spezifischen DNA-Sequenzen für jedes Peptid an Kügelchen angeheftet (wobei eine einzigartige Sequenz, die für die Peptidsequenz kodiert, an das Kügelchen angeheftet ist), als auch die kleinen Peptidmoleküle, die von den DNA-Sequenzen kodiert werden. Wenn eines oder mehrere dieser Testmoleküle eine Affinität für das markierte erfindungsgemäße Oligoribonukleotid-Analog zeigt, kann es isoliert werden, z. B. durch Biotinylierungs/Streptavidin-Wechselwirkung oder durch Fluoreszenzaktiviertes Zellsortieren markierter Moleküle und dann durch Standardverfahren identifiziert werden, z. B. Polymerasekettenreaktion (PCR) oder Didesoxy-Sequenzierung.

Die Erfindung betrifft auch einen kompetitiven Bindeassay zur Bestimmung der möglichen antibiotischen oder therapeutischen Aktivität einer Testverbindung, umfassend (i) Vermischen eines Analogs mit einem Analog-bindenden Liganden unter Bedingungen, die die Bildung eines ersten Bindungskomplexes zwischen dem Analog und dem Liganden gestatten, (ii) Vermischen einer Testverbindung mit dem ersten Bindungskomplex unter Bedingungen, die es der Testverbindung ermöglichen, den ersten Bindungskomplex unter Bildung eines zweiten Bindungskomplexes zwischen dem Analog und der Testverbindung zu zerstören, und (iii) Nachweis der Zerstörung des ersten Bindungskomplexes, wobei die Zerstörung des ersten Bindungskomplexes zeigt, dass die Testverbindung mögliche antibiotische Aktivität besitzt.

In spezifischen Ausführungsformen ist der Ligand z. B. fluoreszierend oder radioaktiv markiert, das Analog ist auf einer Oberfläche immobilisiert und die Zerstörung des ersten Bindungskomplexes wird durch Überwachung einer Reduzierung des Signals von der Markierung nachgewiesen, wenn eine Testverbindung den Liganden aus dem ersten Bindungskomplex verdrängt.

Alternativ dazu kann das Analog markiert und der Ligand auf einer Oberfläche immobilisiert sein, und die Zerstörung des ersten Bindungskomplexes wird durch Überwachung einer Reduzierung des Signals von der Markierung nachgewiesen, wenn eine Testverbindung das Analog aus dem ersten Bindungskomplex verdrängt.

In einer bevorzugten Ausführungsform ist der Ligand ein Aminoglykosid und z. B. kovalent oder quervernetzt auf einem festen Träger immobilisiert, z. B. auf einer Nylon- oder von Cellulose abgeleiteter Membran, einer Mikrotiterplatte oder einem anderen Plastikträger, und wird dann mit einem markierten (fluoreszierend oder radioaktiv) Oligoribonukleotid-Analog inkubiert. Die Aminoglykosid-Analog-Komplexe werden dann kompetitiv mit Testverbindungen, oder Verbindungsgemischen, Zellextrakten, etc. inkubiert. Die Verbindungen, die wirksam an das Analog binden können, werden das Analog aus dem Aminoglykosid-Analog-Komplex verdrängen. Andere Ausführungsformen umfassen das Quervernetzen des Analogs mit einem festen Träger und die Behandlung mit einem Gemisch aus Aminoglykosid und Testverbindungen.

In einem weiteren Aspekt betrifft die Erfindung einen in situ Footprinting-Assay zur Bestimmung der möglichen antibiotischen oder therapeutischen Aktivität einer Testverbindung, umfassend (i) Vermischen eines Oligoribonukleotid-Analogs mit einer Testverbindung unter Bedingungen, die die Bildung eines Bindungskomplexes zwischen dem Analog und der Testverbindung ermöglichen, (ii) Inkubieren des Bindungskomplexes mit einem chemischen Sonden-Reagenz und Überwachen hinsichtlich einer Wirkung des Analogs im Komplex, (iii) in einer getrennten Kontrollreaktion, Inkubieren des nicht an eine Testverbindung gebundenen Analogs mit dem chemischen Sondenreagenz und Überwachung hinsichtlich einer Wirkung des Reagenz auf das ungebundene Analog, und (iv) Vergleichen der Effekte des Sondenreagenz auf das Analog im Bindungskomplex und auf das ungebundene Analog, wobei die Prävention eines Effektes des Reagenz auf das Analog im Bindungskomplex, der vom Reagenz auf das ungebundene Analog ausgeübt wurde zeigt, das die Testverbindung mögliche antibiotische Aktivität besitzt.

In spezifischen Ausführungsformen ist das chemische Sondenreagenz Dimethylsulfat (DMS), Kethoxal (KE) oder Carbodiimid, z. B. 1-Cyclohexyl-3-(2-morpholinoethyl) carbodiimid metho-p-toluen-sulfonat (CMCT). Diese und andere Sondenreagenzien modifizieren ein Nukleotid im Analog kovalent, wenn es nicht an eine Testverbindung gebunden ist, z. B. durch Methylierung im Falle von DMA. Die Auswirkungen des Sondenreagenz können durch Verwendung eines markierten Oligonukleotids überwacht werden, das z. B. die Sequenz CAGUGU hat, das zu einem Teil des Analogs komplementär ist und somit an das Analog hybridisiert, sobald das Analog durch die Testverbindung vor Modifikation geschützt ist, und hybridisiert nicht an das Analog, wenn es modifiziert ist, z. B. durch Methylierung durch das Reagenz, wobei die Anwesenheit der Markierung nach Abschluss des Assays zeigt, dass die Testverbindung mögliche antibiotische Aktivität hat. Alternativ wird die Wirkung des Sondenreagenz durch Verwendung eines Oligonukleotidprimers überwacht, der z. B. die Sequenz TTCACCCGGAAGGTG (SEQ ID NO: 12) aufweist, der zu einem Teil des Analogs komplementär ist, einem markierten Nukleotid, und reverser Transkriptase, wobei die Verlängerung des Primers auf dem Analog mit dem markierten Nukleotid nicht erfolgt, wenn das Analog durch das Reagenz methyliert ist, wobei die Anwesenheit der Markierung nach Abschluss des Assays zeigt, dass die Testverbindung mögliche antibiotische oder therapeutische Aktivität hat.

Andere mögliche Therapeutika oder Antibiotika, die identifiziert werden können, umfassen Therapeutika gegen humanes Immundefizienzvirus (HIV) (z. B. Moleküle, die virale Replikation oder Proteinsynthese hemmen). Interessierende Bereiche umfassen jene Bereiche, die an der viralen Replikation beteiligt sind (z. B. Tat Bindestelle (TAR) und das Rev Response Element (RRE) der RNA).

„Schutz", z. B. vor einem Aminoglykosid oder Thiostrepton, bezieht sich auf den charakteristischen Footprint oder das Profil, d. h. ein Muster von Banden auf einem Polyacrylamidgel, das nach verschiedenen chemischen Behandlungen (z. B. Dimethylsulfat, Kethoxal, 1-Cyclohexyl-3-(3-Morpholinoethyl)-Carbodiimid metho-p-toluensulfonat) von RNA entsteht, die zuvor dem schützenden Molekül ausgesetzt wurde. Diese Footprint-Assays sind Routine und verwenden bekannte Verfahren (vgl. z. B. Moazed et al., 1986, Cell 47: 985–94; Stern et al., 1988, Meth. Enzymol. 164: 481–489; Peattie und Gilbert 1980, PNAS 77: 4679–82).

Ein großer Vorteil der hier beschriebenen Verfahren besteht darin, dass diese Verfahren die Entdeckung neuer antibiotischer Verbindungen oder Moleküle ohne den Arbeitsaufwand und die Kosten bekannter antimikrobieller Aktivitäts-Assays gestatten. Durch Verwendung der Oligoribonukleotid-Analoga, die die Aminoglykosidwechselwirkungsstelle (Liganden-Bindestelle) einer parentalen DNA nachahmen, können Verbindungen, die wahrscheinlich antibiotische, Protein-synthese-hemmende oder virushemmende Eigenschaften haben, schnell und günstig identifiziert werden, auch wenn Screening-Protokolle in sehr großem Maßstab mit Hunderten von Testmolekülen verwendet werden. Die Assays sind der Automatisierung zugänglich, wodurch Screening-Verfahren in großem Maßstab erleichtert werden.

Solange nicht anders definiert, haben alle hier verwendeten technischen und wissenschaftlichen Begriffe die übliche, für den jeweiligen Fachmann bekannte Bedeutung. Obwohl zu den hier beschriebenen Verfahren und Materialien ähnliche oder äquivalente Verfahren und Materialien verwendet werden können, sind die bevorzugten Verfahren und Materialien nachstehend beschrieben. Alle hier genannten Veröffentlichungen, Patentanmeldungen, Patente und andere Referenzen sind durch Bezugnahme Teil der Offenbarung. Zusätzlich sind die Materialien, Verfahren und Beispiele lediglich veranschaulichend und nicht beschränkend aufzufassen.

Andere Eigenschaften und Vorteile der Erfindung sind aus der ausführlichen Beschreibung ersichtlich oder aus den Ansprüchen.

Beschreibung der Zeichnungen

1A1E sind schematische Abbildungen der 16S rRNA, der dekodierenden Region, zweier Oligoribonukleotid-Analoga, und von Testergebnissen. 1A ist ein schematisches Diagramm der 16S rRNA, das die Nukleotide ausserhalb der dekodierenden Region (eingerahmt) zeigt, die an Wechselwirkungen der tRNA und der 30S-Untereinheit an den A- und P-Stellen beteiligt sind (Noller et al., In The Ribosome: Structure, Function, and Evolution (Hrsg. Hill, Dahlberg, et al.) American Soc. For Microbiol., Washington, DC, 1990, Seiten 73–92; Moazed et al., 1986, Cell, 47: 985–94, Moazed et al., 1990, J. Mol. Biol., 211: 135–45). Die Position einer Quervernetzung zwischen den tRNA Antikodon-Schleifen und C1400 (Cytosin an Position 1400) mit Länge Null im dekodierenden Bereich (AC XL) ist angezeigt (Prince et al., 1982, Proc. Natl. Acad. Sci USA, 79: 5450–54). 1B zeigt den dekodierenden Bereich (SEQ ID Nos: 9 und 10) und die durch Neomycin-artige Aminoglykosidantibiotika (Moazed et al., 1987, Nature 327: 389–94; Woodcock et al., 1991, EMBO J., 10: 3099–103) (Neos) vor Modifikation durch DMS geschützten Nukleotide (bei N1 aus A, N3 aus C und N7 aus G) und A- und P-Stellen tRNA (Moazed et al., 1986, Cell, supra, Moazed et al., 1990, J. Mol. Biol., supra). Die Positionen der A- und P-Stellen dekodierenden Region Subdomänen und die Identitäten der posttranskriptionell methylierten Nukleotide sind markiert. Der dekodierende Bereich ist mit den tertiären Basenpaaren von Gutell und Mitarbeitern gezeichnet (Gutell et al., 1985, Prog. Nucl. Acids Res. Mol. Biol., 32: 153–216, Gutell, In The Translational Apparatus (Hrsg. Nierhaus, Subramanian et al.) Plenum Publishing, NY, 1993, Seiten 477–88): C1399-G1504, G1401-C1501, C1402-A1500, C1404-G1497 und G1405-C1496. 1C zeigt das Oligoribonukleotid-Analog der dekodierenden Region (SEQ ID NO: 1), wobei durch Neomycin und Paromyomycin (Neos) vor DMS-Modifikation geschützte Bereiche markiert sind. Das Analog enthält 16S rRNA Sequenzen aus der dekodierenden Region von A1398 bis A1410 auf der proximalen Seite und U1490-G1505 auf der distalen Seite. Das distale Ende des Analogs endet in der gleichen Stamm-Tetra-Schleife, die man am Ende des vorletzten Stammes der 16S rRNA (Nukleotide 1448–1455) findet. Eine heterologe Klemme-Helix ist oben gezeigt. Schwacher und starker Schutz ist durch kleine bzw. große Symbole markiert. 1D zeigt das Oligoribonukleotid-Analog der dekodierenden Region (SEQ ID NO: 1) mit vor DMS-Modifikation geschützten Nukleotiden, oder Nukleotiden, die in der Reaktivität gegenüber DMS verstärkt sind, in Reaktion auf poly U mRNA- und tRNA Antikodon-Stamm-Schleifen T7-Transkripte. 1E zeigt ein Oligoribonukleotid-Analog (SEQ ID NO: 11) der A-Stelle der dekodierenden Region, wobei durch Neomycine vor DMS-Modifikation geschützte Nukleotide markiert sind.

2A2B zeigen Fotos von Elektrophorese-Gelen, die Wechselwirkungen zwischen Analoga für den dekodierenden Bereich und Antibiotika zeigen. 2A zeigt Ergebnisse mit DMS-Hybridisierungsreaktionen mit dem Oligoribonukleotid-Analog alleine (Spur 6) und in Anwesenheit von 0.1, 1, 10 und 100 &mgr;M Neomycin (Spuren 7–10), Paromomycin (Spuren 11–14), Hygromycin (Spuren 15–18), Streptomycin (Spuren 19–22), Tetrazyklin (Spuren 23–26) und Erythromycin (Spuren 27–30). Auf der linken Seite sind Didesoxysequenzierungsreaktionen (Spuren 1–4) und eine Kontroll-Verlängerungsreaktion mit unmodifizierter RNA (K, Spur 5) und auf der rechten Seite Banden markiert, die den nachstehend diskutierten Nukleotiden entsprechen. 2B zeigt DMS/N7 Hybridisierungsreaktionen mit dem Oligoribonukleotid-Analog alleine (Spur 1) und in Anwesenheit von 0.1, 1, 10 und 100 &mgr;M Neomycin (Spuren 2–5), Paromomycin (Spuren 6–9).

3 zeigt ein Elektrophoresegel, das Wechselwirkungen von tRNA Antikodon Stammschleifen-Transkripten und poly U mit dem Oligoribonukleotid-Analog für den dekodierenden Bereich zeigt. DMS und DMS/N7 Hybridisierungsreaktionen mit nacktem Analog (Spuren 6 und 16) und 3, 6, 12, und 24 &mgr;M Antikodon Stamm-Schleifen Transkript (Spuren 7–10 und 12–15). Die gleichen Reaktionen wurden in Anwesenheit von 4 &mgr;g poly U wiederholt (Spuren 11–15 und 21–25).

4A4B zeigen Elektrophoresegele, die die Selektivität der Wechselwirkungen des Analogs für den dekodierenden Bereich zeigen. In 4A wird die Selektivität der mRNA Wechselwirkungen durch DMS-Hybridisierungsreaktionen gezeigt. Reaktionen mit nacktem Analog (Spur 6), 3 &mgr;M (Spur 7) und 6 &mgr;M (Spur 8) Antikodon Stamm-Schleifen Transkript wurden in Gegenwart von 2 &mgr;g Poly U (Spuren 9–11), Polydesoxy U (Spuren 12–14) und Poly C (Spuren 15–17) wiederholt. Nukleotide, die durch tRNA Antikodon Stamm-Schleife oder mRNA geschützt sind, sind rechts angegeben. 4B zeigt Selektivität der P-Stellen Subdomäne für Stamm-Schleifenstrukturen. DMS-Hybridisierungsreaktionen mit nacktem Analog (Spur 6) und 1.5, 3, 6 und 12 &mgr;M E. coli tRNAphe Antikodon-Stamm-Schleifen-Transkript (Spuren 7–10), tRNApro Antikodon-Stamm-Schleifen-Transkript (Spuren 11–14), scrambled tRNAphe (sctRNAphe, Spuren 15–18), Tetra-Schleifen-Element (Spuren 19–22) und triUloop Element (Spuren 23–26). Durch die Antikodon Stamm-Schleifen geschützte Nukleotide sind rechts gezeigt.

5A und 5B sind schematische Diagramme zweier unterschiedlicher Screening-Verfahren unter Verwendung der Oligoribonukleotid-Analoga der Erfindung.

6 ist ein schematisches Diagramm eines Analogs der A-Stelle der dekodierenden Region und zeigt die möglichen Nukleotidstellen (Kästchen) für die Derivatisierung, z. B. zur Hinzufügung einer Fluoreszenzmarkierung.

7A und 7B sind schematische Diagramme eines Footprint-Assays mit hohem Durchsatz unter Verwendung der erfindungsgemäßen Analoga und einem auf Oligonukleotid basierenden Reportersystem.

8A und 8B sind schematische Diagramme eines Footprint-Assays mit hohem Durchsatz unter Verwendung der erfindungsgemäßen Analoga und einem auf reverse Transkriptase basierenden Reportersystem.

Ausführliche Beschreibung

Trotz der komplexen Strukturen und der zahlreichen assoziierten Proteine vollständiger Ribosomen haben wir kleine Oligoribonukleotid-Analoga entdeckt, die kleine Domänen parentaler RNAs nachahmen und die sich für die hier beschriebenen Screeningassays autonom falten und funktionieren können. Die Erfindung umfasst alle solchen autonom funktionierenden Oligoribonukleotid-Analoga, die dazu verwendet werden können, neue therapeutische Agenzien zur antibiotischen, antiviralen, anti-Krebs, antiproliferativen und anti-inflammatorischen Verwendung, insbesondere für die nachstehend spezifisch beschriebenen Verwendungen zu identifizieren. Andere Oligoribonukleotid-Analoga, die als Screeningsonden nützlich sind, können in zellulärer RNA, einschließlich mRNA und viraler RNA identifiziert werden.

Eine Domäne, die verwendet werden kann, um die erste Nukleinsäurestruktur der Analoga abzuleiten, ist die dekodierende Region der 16s rRNA, die nahe dem 3'-Ende der 16S rRNA von E. coli liegt (1A und 1B). Die nachstehend beschriebenen Experimente zeigen, dass ein Oligoribonukleotid-Analog der dekodierenden Region sowohl mit antibiotischen als auch mit RNA Liganden der 30S Untereinheit in einer Weise wechselwirkt, die mit der normalen Funktion der Untereinheit korreliert. Die Aktivitäten des Analogs der dekodierenden Region legen nahe, dass die einschüchternde strukturelle Komplexität des Ribosoms in gewissem Ausmaß umgangen werden kann.

Experimentelle Verfahren Herstellung eines Analogs

Eine erste Oligoribonukleotid-Analog-RNA, die von der dekodierenden Region der 16S rRNA abgeleitet ist, wurde durch Transkription eines linearisierten pGEM3 Plasmids (Promega) mit T7 Polymerase (Milligan et al., 1989, Meth. Enzymol., 180: 51–62) wie in Zapp et al., 1993, Cell, 74: 969–978 beschrieben hergestellt, das die in 1D gezeigte Analogsequenz (SEQ ID NO: 1) enthält, flankiert durch EcoRI und BamHI Restriktionsstellen, und eine 15mer Anlagerungsstelle für reverse Primer unmittelbar 3' von der BamHI-Stelle. Diese Sequenz umfasst sowohl die ersten und zweiten Nukleinsäurestrukturen zur Bildung des vollständigen Analogs.

Spezifisch umfasst im ersten Analog (gezeigt in 1D) die erste Nukleinsäurestruktur die Nukleotidsequenzen 5'-ACCGCCCGUCACA-3' (SEQ ID NO: 12) und 5'-UGAAGUCGUAACAAGG-3' (SEQ ID NO: 13), die von der vollständigen dekodierenden Region abgeleitet sind. Die zweite Nukleinsäurestruktur umfasst eine Tetra-Schleife 5'-CCUUCGGG-3', die minimale Größe für eine stabile Tetra-Schleife, und eine Nukleotidklemme bestehend aus den Sequenzen 5'-GCACAG-3' und 3'-CGUGUC-5'. Anstelle dieser bestimmten Nukleotidklemme kann jede andere stabile Helix verwendet werden. Ähnlich kann anstelle der bestimmten Tetra-Schleife jede andere stabile Stammschleife verwendet werden.

Das zweite Analog, das in 1E gezeigt wird, wurde auf die gleiche Weise hergestellt, ist jedoch von der A-Stellen Subdomäne der dekodierenden Region abgeleitet und weist die Nukleotidsequenzen 5'-CGUCACA-3' und 5'-UGAAGGUCG-3' auf. Bezogen auf die zweite Nukleinsäurestruktur hat das zweite Analog die gleiche Tetra-Schleife wie im ersten Analog, umfasst jedoch eine kürzere Nukleotidklemme, bestehend aus zwei Nukleotidsequenzen 5'-GG-3' und 3'-CC-5'. Die vollständige Nukleotidsequenz des zweiten Analogs ist 5'-GGCGUCACACCUUCGGGUGAAGUCGCC-3' (SEQ ID NO: 11).

Gel-aufgereinigte RNA wurde durch Ethanolpräzipitation konzentriert, für 1 Minute auf 80°C erhitzt und unmittelbar für 5 Minuten bei 37°C gehalten.

Aminoglykosid-Schutzexperimente

Wechselwirkungs-(oder „Bindungs-")Reaktionen (12,5 &mgr;l) die 125 ng Oligoribonukleotid-Analog-RNA und Antibiotika in 80 mM HEPES (pH 7,9), 50 mM NH4Cl und 5% PEG Puffer enthalten, wurden bei 37°C für 15 Minuten angelagert und für 1 Stunde auf Eis inkubiert. DMS (1 &mgr;l einer 1 : 5-Verdünnung in Ethanol) wurde zugegeben, und die Modifikationsreaktionen wurden 40 Minuten lang auf Eis inkubiert. Die Reaktionen wurden mit DMS Stop (Peattie et al., 1980, Proc. Natl. Acad. Sci USA, 77: 4679–82) gestoppt und die RNA wurde durch Ethanolpräzipitation aufgereinigt.

DMS/N7-Reaktionen wurden gemäß Standardprotokollen durchgeführt (Peattie et al., supra), mit der Ausnahme, dass die Lyophilisierungsschritte durch Säure-Phenol Extraktion und Ethanol-Präzipitation ersetzt wurden. Für die Primerverlängerung wurden 10 ng Analog RNA an 0,75 ng endmarkierten Primer angelagert und mit 10–15 U MoMuLV reverser Transkriptase für 1 Stunde verlängert. Die Reaktionen wurden durch Ethanolpräzipitation gestoppt, die Pellets in 10 &mgr;l 8 M Harnstoff, 0,05 × TBE Ladepuffer resuspendiert und 2 &mgr;l wurden auf ein 8%, 19 : 1 Acrylamid : Bisacrylamid, 0,5 × TBE Sequenziergel geladen.

tRNA Schutzexperimente

Bindereaktionen wurden wie vorstehend für die Aminoglycosid-Schutzexperimente beschrieben durchgeführt, mit der Ausnahme, dass der Bindepuffer 200 mM NH4Cl und 80 mM MgCl2 enthielt. E. coli tRNAphe Antikodon Stammschleife (GGGGAUUGAAAAUCCCC; SEQ ID NO: 3) wurde mit T7 RNA Polymerase transkribiert, über ein Gel aufgereinigt, durch Ethanolpräzipitation konzentriert und mit einem kurzem Hitzeschritt angelagert (80°C/1 Minute gefolgt von 10 Minuten auf Eis).

Selektivitätsexperimente

Die Reaktionen entsprachen den bei den tRNA-Schutzexperimenten beschriebenen Experimenten. TRNApro Antikodon Stammschleife (GGUCAUCUUGGGGUGAUGACC; SEQ ID NO: 4), scrambled tRNAphe (GGGAGCGUCAUCACAUA; SEQ ID NO: 5), Tetra-Schleife-Element (GGGACUUCGGUCCC; SEQ ID NO: 6) und Tri-U-Schleife-Element (GGCGCUUUGCGCC; SEQ ID NO: 7) wurden wie für die E. coli tRNAphe Antikodon Stammschleife transkribiert und behandelt. Der Assay und die Ergebnisse werden nachstehend und in 4B beschrieben.

Experimenteller Aufbau und Erlebnisse

Die Analyse von RNA-Struktur mit chemischen Sonden ist eine gut etablierte und leistungsfähige Technik, die die Überwachung einzelner Atome von Nukleotidbasen oder des Phosphodiester-Gerüstes hinsichtlich inter- oder intramolekularer Wechselwirkungen ermöglicht. So methyliert z. B. Dimethylsulfat (DMS) N1 von A, N7 von G und N3 von C-Resten, Kethoxal (KE) bildet einen Zusammenschluss mit N1 und N2 von G und ein lösliches Carbodiimid (1-cyclohexyl-3-(2-morpholinoethyl) Carbodiimid metho-p-toluol sulfonat (CMCT) modifiziert N3 von U-Resten. Nukleotidbasen-Modifikationen, die mit der Bildung von Watson-Crick-Paaren interferieren, werden typischerweise durch reverse Transkription überwacht, da der Fortschritt der reversen Transkriptase stark behindert wird, wenn sie auf solche Modifikationen trifft. Dies führt zur Entstehung eines trunkierten reversen Transkriptionsproduktes, dessen Länge effektiv die Position der modifizierten Base widerspiegelt, wenn die Produkte auf standardmäßigen Sequenziergelen aufgetrennt werden.

Andere Modifikationen, die nicht selbst mit der Bildung von Watson-Crick-Basenpaaren interferieren, können auf ähnliche Weise überwacht werden, indem zuerst das Aufschneiden des RNA-Strangs induziert wird. So kann z. B. die Methylierung von N7 von G durch DMS durch Behandlung der methylierten RNA mit Natriumborhydrid und Anilin zur Induktion des Aufschneiden des Stranges an den Stellen der N7-Methylierung überwacht werden. Die reverse Transkriptase fällt an dieser Stelle einfach von der Matrize ab, was wiederum zu einem trunkierten Produkt führt, welches die Position der N7 Methylierung anzeigt.

Wir haben diese Prinzipien und Techniken dazu verwendet, die erfindungsgemäßen Oligoribonukleotid-Analoga zu analysieren und Screening-Assays unter Verwendung dieser Analoga zu entwickeln.

Wir haben zuerst ein Oligoribonukleotid-Analog der in den 1C und 1D (SEQ ID NO: 1) gezeigten dekodierenden Region entworfen, wie vorstehend beschrieben, und stellten die Frage, ob es mit Aminoglykosidantibiotika wie Neomycin wechselwirken könnte, von dem zuvor gezeigt wurde, dass es N1 von A1408 (dies bezeichnet das Adenin an Position 1408) und N7 von G1491 und G1494 innerhalb der A-Stellen Subdomäne der dekodierenden Region (Moazed et al, 1987, Nature, supra; Woodcock et al., supra) schützen kann; ähnliche Wechselwirkungen mit dem Analog wären ein starker Indikator für seine richtige Faltung und das funktionale Potential. Umgekehrt interagieren andere Antibiotika wie Streptomycin, Tetracyclin und Erythromycin mit anderen Segmenten von 16S rRNA oder 23S rRNA (Moazed et al., 1987, Nature, supra; Woodcock et al., supra, Moazed et al., 1987, Biochimie, 69: 879–84) und man würde daher nicht erwarten, dass sie mit dem Analog interagieren. Ein zweites Analog, das von der A-Stellen Subdomäne der dekodierenden Region abgeleitet ist (und in 1E gezeigt wird) wurde auf die gleiche Weise getestet.

Wie in den 1C, 1D und 1E zusammengefasst, zeigen die Wechselwirkungen der Aminoglykoside wie Neomycin und Paromomycin mit Oligoribonukleotid-Analoga der dekodierenden Region eine auffallende Ähnlichkeit zu ihren Gegenstück-Wechselwirkungen mit dem dekodierenden Bereich in Untereinheiten von vollständiger 16S rRNA in Ribosomen. Insbesondere zeigen der dekodierende Bereich von Ribosomen (1A) und ein kleines Analog, das nur die A-Stellen Subdomäne enthält (1E) quasi identische Aminoglykosid-Wechselwirkungen, die durch eine einzelne Transversion von G zu U an Position 1491 zerstört werden.

Die Analoga wurden mit Dimethylsulfat (DMS; Stern et al., 1988, Meth. Enzymol., 164: 481–89) alleine als nackte RNA getestet, oder in Anwesenheit steigender Konzentrationen von Neomycin, Paromomycin, Hygromycin, Streptomycin, Tetrazyklin und Erythromycin. 2A zeigt, dass Neomycin (Spuren 7–10) und das eng verwandte Aminoglykosid Paromomycin (Spuren 11–14) N1 an A 1408 bei Konzentrationen von 10 und 0,1 &mgr;M stark schützten. Zusätzlich verstärkte Hygromycin (Spuren 15–18), ein strukturell unterschiedliches Aminoglykosid, die Reaktivität von N1 von A1408 schwach. Im Gegensatz dazu interagierten Streptomycin (Spuren 19–22), Tetrazyklin (Spuren 23–26) und Erythromycin (Spuren 27–30), d. h., Antibiotika, die nicht mit der dekodierenden Region in 16S rRNA interagieren, nicht in nachweisbarer Weise mit den Analoga.

2B zeigt, dass zusätzlich zu N1 von A1408, N7 von G1405 und G1494 stark durch Neomycin und Paromomycin geschützt wurden, während N7 von G1491 und G1497 schwach geschützt wurden. Diese Ergebnisse sind in 1C zusammengefasst. Da diese Ergebnisse eng mit denen übereinstimmen, die zuvor mit Antibiotika und intakten, vollständigen Ribosomen erhalten wurden (Moazed et al., 1987, Nature, supra, Woodcock et al., supra, Moazed et al., 1987, Biochimie, supra), zogen wir die Schlussfolgerung, dass die A-Stelle Subdomäne unseres Oligoribonukleotid-Analogs sich in eine biologisch relevante Konformation faltet.

Wir stellten uns danach die Frage, ob das Analog ähnlich wie die dekodierte Region der 16S rRNA im Ribosom durch Interaktion mit tRNA und/oder mRNA agieren könnte. In dem in 3 gezeigten Experiment wurden ansteigende Konzentrationen einer minimalen tRNA für diese Zwecke (Rose et al., 1983, J. Mol. Biol., 167: 103–17), einem T7 Transkript der Antikodon Stammschleife von E. coli tRNAPhe entweder alleine (Spuren 7–10 und 17–20), oder in Anwesenheit bekannter Poly U Message (Spuren 11–15 und 21–25) inkubiert. 3 zeigt, dass das Antikodon Stammschleifen-Transkript N3 von C1402 und C1403 (vgl. Spuren 6 mit Spuren 7–10) und N7 von G1401 (vgl. Spur 16 mit den Spuren 17–20) schützte, während poly U N1 von A1408, A1492, A1493, A1499 und A1502 stark, N1 von A1500, A1503 schwach und N7 von G1494 schwach (vgl. Spur 6 mit Spuren 11–15 und Spur 16 mit Spuren 21–25) schützte, wobei diese Effekte in Anwesenheit von poly U abgeschwächt wurden (vgl. Spuren 7–10 mit Spuren 12–15).

Ein Vergleich der gegenwärtigen Ergebnisse mit Ergebnissen aus früheren Studien mit Ribosomen (Moazed et al., 1986, Cell, supra; Moazed et al., 1990, J. Mol. Biol., supra) zeigt, das die durch das tRNA Antikodon Stammschleifen-Transkript im Analog (G1401, C1402 und C1403) geschützten Nukleotide eng mit jenen Nukleotiden assoziiert sind und nahezu überlappen, die in An- oder Abwesenheit von Message durch an die P-Stelle gebundene tRNA geschützt werden (C1399, C1400 und G1401). Weiterhin sind innerhalb der A-Stellen Subdomäne des Analogs durch mRNA geschützte Nukleotide (A1408, A1492-G1494) identisch zu jenen, die mit der mRNA-abhängigen Interaktion von tRNA mit der A-Stelle von Ribosomen assoziiert sind (Moazed et al., 1986, Cell, supra; Moazed et al., 1990, J. Mol. Biol. Supra). Die anderen Nukleotide, die durch mRNA geschützt werden (A1499, A1500, A1502 und A1503) wurden früher weder mit A- noch in P-Stellen Funktion in chemischen Testversuchen identifiziert.

Zur Hilfe bei der Bestimmung, ob poly U mRNA Wechselwirkungen durch Watson-Crick-Basenpaarungen mit A-Resten im Analog vermittelt wurden, untersuchten wir als nächstes poly C, eine mRNA ohne Potential zur Bildung von Watson-Crick-Basenpaaren mit A-Resten und mit polydesoxy U, einer 2'-desoxy-Form von poly U, mit ähnlichem Potential zur Watson-Crick Basenpaarung. Das Experiment von 4A zeigte, dass während Poly U A1408, A1492 und A1493 so stark wie erwartet schützte (vgl. Spuren 6–8 mit den Spuren 12–14), Polydesoxy U nicht nachweisbar mit irgendwelchen Nukleotiden im Analog interagieren konnte (vergleiche Spuren 6–8. mit den Spuren 9–11). Die Wechselwirkungen von polyC waren komplexer, da die Reaktivitäten von N1 von A1410 und N3 von C1402 und C1403 erhöht waren (vgl. Spuren 6–8 mit Spuren 15–17). Mit der Ausnahme von A1492 jedoch schützte Poly C die gleichen Nukleotide wie Poly U, einschließlich A1408, A1493, A1499, A1500, A1502 und A1503. Somit war trotz der durch Poly C induzierten offensichtlichen Zerstörung der Analogstruktur sein Schutzmuster quasi identisch zu dem von Poly U. Zusammen betrachtet legen diese Ergebnisse nahe, dass die Wechselwirkungen von mRNA mit der dekodierenden Region nicht einfach durch Watson-Crick-Basenpaarung vermittelt werden.

C1402 und C1403 sind in 16S rRNA unreaktiv (Moazed et al., 1986, J. Mol. Biol., 187: 399–416); ihre Reaktivität im Analog und ihr Schutz durch das tRNA Antikodon Stammschleifen-Transkript legen nahe, dass sich die Struktur der P-Stelle Subdomäne des Oligoribonukleotid-Analogs sich von der von Ribosomen unterscheidet.

Zum besseren Verständnis der diskriminatorischen Fähigkeit, oder Selektivität der P-Stellen Subdomäne des Oligoribonukleotid-Analogs stellten wir als nächstes die Frage, ob sie zwischen eng verwandten RNA-Strukturen unterscheidet. In dem in 4B gezeigten Experiment wurden eine zweite (mit unterschiedlicher Sequenz) Prolin-spezifische tRNA Antikodon Stammschleife (tRNApro) (GGUCAUCUUGGGGUGAUGACC; SEQ ID NO: 4), eine scrambled-Sequence E. coli tRNAphe mit wenig Potential zur Bildung von Sekundärstrukturen (sctRNAphe) (GGGAGCGUCAUCACAUA; SEQ ID NO: 5), ein hoch stabiles Tetra-Schleife-Stamm Schleifenelement (Tetra-Schleife) (GGGACUUCGGUCCC; SEQ ID NO: 6) und ein anderes, kleineres Stamm-Schleifen-Element mit einer Schleife, die nur aus drei U-Resten besteht (triUloop) (GGCGCUUUGCGCC; SEQ ID NO: 7) jeweils in eine Bindereaktion mit dem Analog titriert.

4B zeigt, dass nur die tRNAphe und tRNApro Antikodon Stamm-Schleifen Transkripte interagierten und jeweils C1402 und C1403 stark schützten. Das Fehlen von Interaktion des scrambled tRNAphe und der anderen Stamm-Schleifen Elemente unterstützt nachweisbar die Hypothese, dass trotz ihrer veränderten Konformation die P-Stellen Subdomäne selektiv mit RNA Liganden interagiert. Diese Ergebnisse legen nahe, dass die P-Stelle Subdomäne des Oligoribonukleotid-Analogs eine signifikante diskriminatorische Kapazität aufweist, die mit ribosomaler P-Stellen Funktion verwandt sein kann.

Angesichts des Weglassens von 1500 Nukleotiden aus der vollständigen 16S rRNA, aller Nukleotidmodifikationen, und der 21 kleinen Untereinheit-Proteine, die man normalerweise in der 30S ribosomalen Untereinheit findet, war das Aufzeigen der Wechselwirkungen zwischen den kleinen dekodierende Region Oligoribonukleotid-Analoga und den 30S Untereinheitsliganden, die mit den normalen 30S Untereinheit-Aktivitäten korrelieren, überraschend und unerwartet. Positive Korrelationen werden wahrscheinlich am besten beispielhaft dargestellt durch die Interaktionen der Antibiotika mit der A-Stellen Subdomäne, wo eine fast perfekte Übereinstimmung zwischen den Eigenschaften der dekodierenden Region in Ribosomen und dem Oligoribonukleotid-Analog mit einer großen Vielzahl von Verbindungen beobachtet wurde.

Verwendungen/Vorteile der Erfindung

Die erfindungsgemäßen Oligoribonukleotide sind insoweit unterschiedlich, als dass sie von jeder ribosomalen RNA (z. B., 16S, 23S), RNA von menschlichem Immundefizienzvirus (HIV) (vgl. Green (1993) AIDS Res. Rev. 3: 41–55 für Beispiele gewünschter Bereiche wie Tat oder Rev Interaktionsstellen) oder von jeder anderen RNA, die manipuliert werden kann, um eine funktionell relevante Struktur beizubehalten, abgeleitet werden können. Obwohl der dekodierende Bereich der 16s rRNA und Aminoglykosidantibiotika in den hier beschriebenen Experimenten umfasst sind, sind sie nicht der einzige Bereich oder die einzige chemische Klasse, die in dieser Erfindung verwendet werden kann.

So können z. B. auch regulatorische Elemente von messenger RNA, Telomerase RNA (vgl., z. B. Bahattacharyya und Blackburn, EMBO J., 13: 5721–31, 1994), Onkogen-mRNAs, mRNAs von Cytokinen und Lymphokinen, Thymidylatsynthase mRNAs und verschiedene virale Elemente wie der dreiteilige Leader für späte RNA von Adenovirus, RNA von Hepatitis Delta Virus und „ribosomal landing pads" von Picornavirus oder „internal ribosomal entry sites", die im 5' untranslatierten Bereich liegen, dazu verwendet werden, die erfindungsgemäßen Oligoribonukleotid-Analoga zu entwerfen.

Weiterhin werden selbst-spleissende Gruppe I Introns, einschließlich des HDV Gruppe I Intron durch die Bindung von Aminoglykosiden gehemmt und können somit dazu verwendet werden, RNA Oligoribonukleotid-Analoga zu entwerfen. Weiterhin wird das HIV Rev Response Element (RRE) durch einige der gleichen Antibiotika gebunden, die an den dekodierenden Bereich der 16S rRNA binden. Die Bindung von Neomycin an das RRE hemmt die Funktion von Rev und von viraler Replikation in Zellkulturmodellen. Somit ist das RRE ein geeignetes Ziel zum Entwerfen von Oligoribonukleotid-Analoga, die nützlich sind, um gegen das RRE wirksame Antibiotika zu testen.

Jedes bekannte RNA-Strukturmotiv kann als parentale RNA verwendet werden, um ein Oligonukleotid-Analog zu entwerfen, das als Screening-Ziel verwendet werden kann, und da der Transport, das Prozessieren und die Translation von mRNA von solchen Strukturen und deren Wechselwirkungen mit verschiedenen Bindepartnern abhängen, existiert eine Vielzahl von möglichen Zielen in viraler und zellulärer mRNA. Wenn man diese Ideen noch weiter denkt, angenommen, dass mutierte zelluläre mRNA Sequenzen veränderte mRNA Strukturen produzieren, kann es sogar möglich sein, spezifische mutierte mRNA Sequenzen mit kleinen Molekülen zu erreichen.

Zusätzlich zu den ersten Nukleotidsequenzen, die von der parentalen RNA abgeleitet sind, enthalten die erfindungsgemäßen Oligoribonukleotid-Analoga auch zweite, heterologe Sequenzen (z. B. künstliche Stammschleifen und Nukleotidklemmen) die die geeignete dreidimensionale Konformation der ersten Nukleotidsequenzen hinsichtlich normaler Wechselwirkung mit Kandidatenarzneistoffen, Nukleinsäuremolekülen etc. unterstützen. Durch die geringe Größe dieser Kandidatenarzneistoffe und Moleküle sind diese für zahlreiche kostengünstige in vitro Assays zugänglich, die eine Vielzahl von Oligoribonukleotid-Analoga verwenden.

Proteinsyntheseinhibitoren haben in erster Linie zwei ribosomale Ziele: der dekodierende Bereich von 16S rRNA und der Peptidyltransferase-Bereich (Domäne V) der 23S rRNA. Aminoglykoside interagieren mit der dekodierenden Region, während MLS Antibiotika (Macrolide, Lincosamine und Streptogramine) mit dem Peptidyltransferase-Bereich interagieren. Peptide, Nukleinsäuremoleküle und eine Vielzahl anderer chemischer Verbindungen und Moleküle können als Therapeutika nützlich sein und können unter Verwendung der erfindungsgemäßen Oligoribonukleotid-Analoga und Verfahren leicht gescreent werden.

Die Oligoribonukleotid-Analoga ermöglichen die Verwendung verbesserter Verfahren zum Screening neuartiger therapeutischer Verbindungen, insbesondere von antibiotischen Verbindungen, die die Proteinsynthese hemmen. Standardverfahren zum Screenen von Antibiotika beinhalten den Nachweis von antimikrobieller oder bakterizider Aktivität in kultivierten Zellen über lange Zeiträume (bis zu einigen Tagen). Das Screening vieler potentieller antibiotischer Verbindungen unter diesen Bedingungen kann teuer und zeitaufwändig sein. Andererseits besitzen Screening-Assays, in denen die erfindungsgemäßen Oligoribonukleotid-Analoga verwendet werden, mehrere deutliche Vorteile gegenüber diesen bekannten Screeningverfahren.

Die neuen Screeningassays sind viel schneller (ein erfindungsgemäßer Assay kann in einer Stunde durchgeführt werden), die einzelnen Assays benötigen nur geringe Stoffmengen (Volumina von etwa 100 &mgr;l) und zahlreiche Reaktionen können parallel durchgeführt werden (z. B. in einer 96-Loch Mikrotiterplatte). Mit den erfindungsgemäßen Verfahren können wahrscheinliche Kandidatenverbindungen schnell identifiziert werden und dann könnten nur die wahrscheinlichen Kandidaten mit Zellkulturassays weitergetestet werden.

Einige der Vorteile leiten sich, verglichen mit Ribosomen vollständiger Größe, von den Analoga selbst ab. Die Oligoribonukleotid-Analoga sind klein genug, um einfach produziert zu werden, entweder enzymatisch als T7 Polymerase-Transkripte oder chemisch durch automatisierte RNA Synthese.

Die Analoga sind viel stabiler als Ribosomen, da sie radikal einfacher sind. Weiterhin kann, anders als bei Ribosomen, deren labiles Ribophosphodiestergerüst durch Einbau von 2'-O-methyl Ribonukleotiden, Desoxyribonukleotiden oder Phosphorthioaten entweder gleichmäßig oder an ausgewählten Positionen stabilisiert werden.

Zusätzlich können Analoga während automatisierter chemischer Synthese leicht derivatisiert werden. So können z. B. fluoreszierende Reste an jedem Ende (5' oder 3') oder intern, und Kopplungsreste, wie primäre Amine oder Biotin an jedem Ende eingebaut werden (siehe nachstehende Diskussion). Weiterhin ist der Nachweis von Wechselwirkungen zwischen neuen Testverbindungen und Analoga eher für potentielle antibiotische Aktivität relevant, da im Gegensatz zu Ribosomen die neuen Analoga ein kleines, gut definiertes Ziel darstellen.

Screening-Assays

Durch die folgenden Screeningverfahren wird keine besondere Klasse molekularer Struktur selektiert. Die Verfahren sind eher nur für die Existenz hoch spezifischer Wechselwirkungen selektiv, an denen bestimmte Nukleotidatome im analogen RNA-Ziel beteiligt sind. Daher können spezifische Verbindungen getestet werden, um zu bestimmen, ob sie wahrscheinlich antibiotische Aktivität haben.

Allgemeine Betrachtungen

Aminoglykoside sind Polykationen, und Ladung-Ladung Wechselwirkungen mit dem negativ geladenen Phosphodiestergerüst der Oligoribonukleotid-Analoga sind wahrscheinliche wichtige Determinanten ihrer Bindespezifität und Affinität. Somit umfassen wichtige Faktoren, die die Bildung und Stabilität von Aminoglykosid-RNA-Wechselwirkungen steuern, ein- und zweiwertige Kation(Salz)-Konzentrationen, und die An- oder Abwesenheit nichtspezifischer Nukleinsäuren. Demgemäss begünstigen niedrige Salzkonzentrationen (< 100 mM K+, NH4+, Na+, < 5 mM Mg++) die Komplexbildung, während die Anwesenheit von unspezifischen Nukleinsäuren ungünstig ist. Zu testende Kandidatenverbindungen sollten daher in Niedrigsalz-Puffern hergestellt werden, die größtenteils frei von kontaminierenden Nukleinsäuren sind.

Um das Screening mit hohem Durchsatz zu erleichtern, wird ein standardmäßiges Mikrotiterplattenformat mit einem standardmäßigem Fluoreszenz- oder Strahlungsdetektor verwendet. Ein Robotersystem wird dazu verwendet, in jeder Vertiefung zu beladen, zu waschen und um ein Signal nachzuweisen. Kationenkonzentrationen, unspezifische Nukleinsäuren und andere Variable, einschließlich Temperatur und Zeit können während der Binde- und Waschschritte angepasst werden, um die Hintergrund-Bindekonzentrationen anzupassen.

Drei Screening-Verfahren

5A und 5B veranschaulichen zwei spezifische Screening Assays basierend auf 1) Bindung von Testverbindungen an immobilisierte (nackte) Oligoribonukleotid-Analoga, die als Reporter wirken („Affinitätsassay"), bzw. 2) Verdrängung eines vorgebundenen Reportermoleküls aus einem immobilisierten Analog durch Testverbindungen („kompetitiver Bindeassay"). Diese beiden Verfahren sind sich, obwohl sie unterschiedlich sind, in der Gesamtstrategie und Organisation ähnlich. Ein drittes Verfahren (7A, 7B, 8A und 8B), das auf Oligomerbindung an ein in situ „footprinted" Analog basiert, unterscheidet sich in Organisation und Strategie von den ersten beiden Verfahren und wird getrennt diskutiert.

Verfahren 1: Affinitätsassay

Dieses Screeningverfahren kann, wie in 5A gezeigt, mit einem immobilisierten, fluoreszenzmarkierten Oligoribonukleotid-Analog implementiert werden. Das Verfahren besteht aus (1) Inkubation des immobilisierten Analogs mit Testverbindungen, (2) Waschschritt(en), und nachfolgendem Nachweis von Komplexbildung beruhend auf Veränderungen der Fluoreszenzeigenschaften des immobilisierten RNA-Analogs. Das RNA-Analog kann derivatisiert werden, z. B. während automatisierter chemischer Synthese, sowohl für die Immobilisierung als auch für die Markierung. Mögliche Positionen für die Derivatisierung in einem Oligoribonukleotid-Analog werden durch Kästchen um die Nukleotide in 6 gezeigt.

Für die Immobilisierung kann das Analog z. B. entweder mit terminalem Biotin (mit Biotin Phosphoramidit (5'-Biotin) oder CPG (3'-Biotin)) oder einer freien primären Aminogruppe (mit Amino Modifikator Phosphoramidit (5'-NH2) oder CPG (3'-NH2)) derivatisiert werden. Die Immobilisierung in Vertiefungen von Mikrotiterplatten kann dann durch Polystyrolplatten durchgeführt werden, die mit Streptavidin bzw. Maleinanhydrid aktiviert wurden. Nach der Kopplung sollten die Platten zur Entfernung von löslicher Analog-RNA gründlich gewaschen werden.

Zur Markierung werden die Analoga derivatisiert, um die Addition eines Fluorophors an einem der RNA Termini mit Fluorescein Phosphoramidit (3' Markierung) oder CPG (5' Markierung) oder den Einbau von fluoreszierendem Adenosin oder von Cytosinnukleotiden (mit EthenoA bzw. EthenoC Phosphoramiditen) an spezifischen internen Positionen in der RNA zu ermöglichen. Der letztere Ansatz kann aufgrund der Nähe des Fluorophors und der Antibiotika-Bindestelle viel sensitiver sein. Alternativ dazu kann ein Fluoreszenzfarbstoff wie Ethidiumbromid oder möglicherweise Hoechst 33258 mit underivatisierter RNA verwendet werden. Diese Markierung ermöglicht den Nachweis jeder Veränderung entweder bei der Bindung oder den Fluoreszenzeigenschaften des Farbstoffs oder von beiden, nach der Komplexbildung zwischen Testverbindung und Analog.

Typische (Lösung-) Bindereaktionen enthalten 25 mM neutralen pH Puffer (Tris oder Hepes) und 50 mM einwertiges Salz (KCl, NH4Cl, etc). Es ist vorteilhaft, Bindungsreaktionen bei 30–37°C für ca. 30 Minuten durchzuführen und die gleichzeitige Anlagerung der RNA zu erleichtern. Bei den Waschschritten kann derselbe Puffer verwendet werden.

Testverbindungen und Salzkonzentrationen sollten empirisch angepasst werden, um den Assay zu optimieren. So sollte die Konzentration der Testverbindung im mikromolaren Bereich liegen, und die Salzkonzentrationen sollten im Bereich von 10 bis 500 mM sein, aber diese Zahlen müssen in Abhängigkeit der spezifischen Assaybedingungen angepasst werden. Zusätzlich können beim Bindungsschritt nichtspezifische Nukleinsäuren zugegeben werden, um die Auswirkungen irgendwelcher kontaminierender Verbindungen mit unspezifischer Affinität für Nukleinsäuren zu reduzieren. Die unspezifische Nukleinsäure kann Gesamt-tRNA von Hefe, Poly 1-C, etc. sein. Eine weitere, möglicherweise nützliche unspezifische Nukleinsäure wäre ein (lösliches) A-Stelle Analog, das die G1491U Punktmutation aufweist.

Verfahren 2: Kompetitiver Bindeassay

Wie in 5B gezeigt, basiert dieses Screeningverfahren auf der Hypothese, dass nützliche Testverbindungen vorgebundene Reporterliganden aus ihren immobilisierten Analog-Bindestellen verdrängen. So kann z. B. immobilisiertes Neomycin (ein antibiotischer Ligand, von dem man weiß, dass er an Analoga bindet, die von der dekodierenden Region von 16S rRNA abgeleitet sind) (1) mit einem markierten Analog vorbeladen und (2) Testverbindungen zugegeben werden und die Kompetition mit immobilisiertem Neomycin um das markierte Analog, das als Reporter dient, wird zugelassen. Nach einem Waschschritt zur Entfernung von verdrängtem Analog, das noch mit der Testverbindung komplexiert ist, würde der Nachweis des Fehlens der Markierung in spezifischen Vertiefungen anzeigen, dass spezifische Testverbindungen die Analog RNA wirksam gebunden haben, d. h. ein positives Ergebnis. Die umgekehrte Konfiguration, mit immobilisierter Analog-RNA und markiertem Neomycin kann ebenfalls verwendet werden.

Neomycin und andere Aminoglykoside enthalten zahlreiche primäre Aminogruppen, die ideale Ziele für die Kopplung entweder an Amin-reaktive Fluoreszenzsonden oder aktiviertes Polystyrol sind. So kann z. B. ein lösliches Neomycin-Reportermolekül durch Kopplung von Neomycin an NHS-Fluorescein hergestellt werden. Andererseits kann Neomycin auf Malein-Anhydrid-aktivierten Polystyrol-Mikrotiterplatten immobilisiert werden. Wie vorstehend diskutiert, kann das Oligoribonukleotid-Analog ähnlich markiert oder immobilisiert werden.

Verfahren 3: Screening durch in situ Footprinting

7A und 7B und 8A und 8B veranschaulichen ein drittes Screeningverfahren, das direkt auf unseren Erfahrungen mit chemischer Austestung beruht, die gezeigt haben, dass das N1 Atom von A1408 in Abwesenheit von Neomycin durch DMS stark methyliert ist und umgekehrt in Anwesenheit von Neomycin stark vor DMS Methylierung geschützt ist. In herkömmlichen Footprinting-Experimenten stellt diese differentielle Modifizierung ein Verfahren zum Nachweis der Komplexbildung (überwacht durch Hemmung der Primerverlängerung) bereit. Verfahren 3 nützt in ähnlicher Weise die differentielle Methylierung aus, aber überwacht diese Methylierung z. B. über die differentielle Anlagerung eines markierten komplementären Oligomers (z. B. CAGUGU) mit einer Bindestelle, die mit der Methylierungsstelle überlappt, A1408 (7A und 7B).

In diesem Verfahren wird das N1 Atom vom A1408 durch Dimethylsulfat (DMS) in Abwesenheit von Neomycin (7A) stark methyliert und umgekehrt in Anwesenheit von Neomycin („gebundenes kleines Molekül") (7B) stark vor DMS Methylierung geschützt. Somit gibt nach der Komplexbildung (Schritt 1) und DMS Modifikation (Schritt 2) der Methylierungszustand von A1408 seine (vorherige) Beteiligung an Komplexbildung mit Neomycin an.

Die Schritte des Assays sind ähnlich zu Verfahren 1, insofern als das der erste Schritt die Bildung von Komplexen zwischen den immobilisierten (aber hier unmarkierten) Analoga- und Testverbindungen (Schritt 1) beinhaltet. Nach der Komplexbildung und den Waschschritten wird die Platte mit DMS behandelt, um die RNA differentiell zu methylieren (Schritt 2). DMS-Reaktionen werden dann mit einem 1 M &bgr;ME Waschschritt gestoppt und markiertes Reporteroligo zugegeben und angelagert (Schritt 3).

Die Technik zur Überwachung der differentiellen Methylierung, die in 7A und 7B veranschaulicht wird, beruht auf der Unfähigkeit von N1-methyliertem A zur Bildung von Watson-Crick-Basenpaaren mit einem kurzem markierten Oligomer. In 7A, mit unkomplexiertem Analog und methyliertem N1 kann das kurze Oligo nicht an das Analog anlagern und wird weggewaschen, wobei keine Markierung in der Vertiefung zurückbleibt. In 7B, mit komplexiertem Analog und unmethyliertem N1, lagert sich das Oligo an das Analog an und wird effektiv davon immobilisiert, wobei eine Markierung in der Vertiefung zurückbleibt. Vertiefungen, die das Reporter-Oligo zurückhalten, zeigen, dass A1408 nicht methyliert war, was wiederum zeigt, das A1408 durch einen gebundenen antibiotischen Liganden geschützt war. Somit stellt die Anwesenheit einer Markierung in einer Vertiefung ein positives Ergebnis dar.

Ein alternatives Verfahren zur Überwachung der differentiellen Methylierung, die in 8A und 8B gezeigt wird, beruht auf der reversen Transkription der modifizierten Matrize. Schritte 1 und 2 sind identisch zu den in 7A und 7B gezeigten, mit der Ausnahme, dass das Zielanalogon (RNA) nicht länger immobilisiert ist. Stattdessen wird ein biotinylierter Primer (z. B. mit der Nukleotidsequenz TTCACCCGGAAGGTG; SEQ ID NO: 12) zu jeder Reaktion zugegeben (8A und 8B), und die Primerverlängerung wird in Anwesenheit von markiertem TTP (z. B., &agr;-32P-TTP) und reverser Transkriptase initiiert.

In 8A wird die Primerverlängerung durch Methylierung von N1 von A1408 gehemmt und keine Markierung wird eingebaut. In 8B ist die Primerverlängerung erfolgreich, woraus der Einbau von Markierung in den Primer resultiert. In beiden Fällen wird der biotinylierte Primer durch Interaktion mit Streptavidin-beschichteten Vertiefungen immobilisiert. Nach einem Waschschritt zur Entfernung von nicht-eingebautem markiertem TTP wird nur das Szenario aus 8B das Zurückhalten der Markierung in der Vertiefung ermöglichen, wodurch die Anwesenheit von gebundenem Liganden in Schritt 1 angezeigt wird.

Die auf reverser Transkriptase basierende Reportermethodologie ähnelt oberflächlich gesehen standardmäßigen chemischen Hybridisierungsverfahren. Der Hauptunterschied, abgesehen vom immobilisierten Primern besteht darin, dass die Primer-Verlängerungsbedingungen, z. B. Mg Konzentration, Reaktionszeit, Temperatur und Menge an Enzym durch Standardverfahren angepasst werden, so dass die Methylierung von A1408 die Verlängerung eines hohen Prozentsatzes (ca. 90%) der Transkripte vollständig stoppen wird. Dies ist das Gegenteil der gewünschten Situation in Standardexperimenten, wobei die Bedingungen so angepasst werden, dass mehr als 90% der Transkripte vollständig lang sind.

SEQUENZPROTOKOLL

Anspruch[de]
  1. Künstliches Oligoribonukleotid-Analog, das sowohl natürliche als auch heterologe Sequenzen darin enthält, wobei das Analog eine dreidimensionale Struktur aufweist, welche eine Ligandenbindungsregion eines größeren Stamm-Ribonukleinsäure(RNA)-Moleküls imitiert, wobei das Analog umfasst:

    eine erste Nukleinsäurestruktur, dessen Sequenz sich von dem Stamm-RNA-Molekül ableitet, und eine zweite Nukleinsäurestruktur, die eine heterologe Sequenz umfasst, die, wenn sie mit der ersten Nukleinsäurestruktur verbunden ist, das Analog bildet, und das Analog mit einer Konformation ausstattet, die den Liganden mit einem Ligandenbindungsmuster bindet, welches im Wesentlichen identisch mit dem Stamm-RNA-Bindungsmuster ist.
  2. Analog nach Anspruch 1, wobei die Sequenz der ersten Nukleinsäurestruktur identisch mit einer Ligandenbindungsregion einer 16S-ribosomalen RNA (rRNA) ist.
  3. Analog nach Anspruch 2, wobei die Region die dekodierende Region von 16S-rRNA umfasst.
  4. Analog nach Anspruch 3, wobei die Region die Nukleotide 1398–1410 und 1490–1505 von 16S-rRNA umfasst.
  5. Analog nach Anspruch 3, wobei die Region die A-Stellen-Subdomäne der dekodierenden Region von 16S-rRNA umfasst.
  6. Analog nach Anspruch 5, wobei die Region die Nukleotide 1404–1410 und 1490–1497 von 16S-rRNA umfasst.
  7. Analog nach Anspruch 1, wobei die zweite Nukleinsäurestruktur eine Tetra-Schleife umfasst.
  8. Analog nach Anspruch 7, wobei die Tetra-Schleife die Nukleotidsequenz umfasst: 5'-CCUUCGGG-3'.
  9. Analog nach Anspruch 1, wobei die zweite Nukleinsäurestruktur zwei Nukleotidsequenzen umfasst, die eine basengepaarte Nukleotidklemme bilden.
  10. Analog nach Anspruch 9, wobei die basengepaarte Nukleotidklemme die Nukleotidsequenz umfasst:

    3'-CGUGUC-5'

    5'-GCACAG-3'.
  11. Analog nach Anspruch 9, wobei die basengepaarte Nukleotidklemme die Nukleotidsequenz umfasst:

    3'-CC-5'

    5'-GG-3'.
  12. Analog nach Anspruch 1, wobei die Sequenz der ersten Oligoribonukleinsäurestruktur sich von einer dekodierenden Region von 16S-rRNA ableitet und die zweite Nukleinsäurestruktur eine Tetra-Schleife und eine basengepaarte Nukleotidklemme umfasst.
  13. Analog nach Anspruch 12, wobei die dekodierende Region die Nukleotide 1398–1410 und 1490–1505 von 16S-rRNA umfasst, die Tetra-Schleife die Nukleotidsequenz 5'-CCUUCGGG-3' umfasst, die basengepaarte Nukleotidklemme die Nukleotidsequenz umfasst:

    3'-CGUGUC-5'

    5'-GCACAG-3'

    und die vollständige lineare Nukleotidsequenz der kombinierten ersten und zweiten Nukleotidstrukturen des Analogs

    5'-GCACAGACCGCCCGUCACACCUUCGGGUGAAGUCGUAACAAGGCUGUGC-3' (SEQ ID NO: 1) ist.
  14. Analog nach Anspruch 12, wobei die dekodierende Region die Nukleotide 1404–1410 und 1490–1497 von 16S-rRNA umfasst, die Tetra-Schleife die Nukleotidsequenz 5'-CCUUCGGG-3' umfasst, die basengepaarte Nukleotidklemme die Nukleotidsequenz umfasst:

    3'-CC-5'

    5'-GG-3'

    und die vollständige lineare Nukleotidsequenz der kombinierten ersten und zweiten Nukleotidstrukturen des Analogs

    5'-GGCGUCACACCUUCGGGUGAAGUCGCC-3' (SEQ ID NO: 11) ist.
  15. Affinitäts-Assays zum Bestimmen der potenziellen therapeutischen Aktivität einer Testverbindung, wobei der Assay die Schritte umfasst:

    Vermischen einer Testverbindung mit einem Analog nach Anspruch 1 unter Bedingungen, welche die Bildung eines Bindungskomplexes zwischen dem Analog und der Testverbindung ermöglichen und

    Nachweisen der Bildung eines Bindungskomplexes, wobei das Vorliegen eines Bindungskomplexes anzeigt, dass die Testverbindung eine potenzielle therapeutische Aktivität besitzt.
  16. Assay nach Anspruch 15, wobei das Analog auf einer Oberfläche markiert und immobilisiert ist und der Bindungskomplex durch Beobachten von Veränderungen bei dem Signal der Markierung nachgewiesen wird, wenn eine Testverbindung an das Analog gebunden ist.
  17. Assay nach Anspruch 15, wobei das Analog auf einer Oberfläche immobilisiert ist, die Testverbindung markiert ist und der Bindungskomplex durch Nachweisen der Markierung, die an das immobilisierte Analog gebunden ist, nachgewiesen wird.
  18. Assay nach Anspruch 16, wobei das Analog Fluoreszenz- oder radioaktiv markiert ist.
  19. Kompetitiver Bindungs-Assay zum Bestimmen der potenziellen therapeutischen Aktivität einer Testverbindung, wobei der Assay die Schritte umfasst:

    Vermischen eines Analogs nach Anspruch 1 mit einem Analog-bindenden Liganden unter Bedingungen, welche die Bildung eines ersten Bindungskomplexes zwischen dem Analog und dem Liganden ermöglichen,

    Vermischen einer Testverbindung mit dem ersten Bindungskomplex unter Bedingungen, welche es der Testverbindung ermöglichen, den ersten Bindungskomplex zu trennen, um einen zweiten Bindungskomplex zwischen dem Analog und der Testverbindung zu bilden, und

    Nachweisen der Trennung des ersten Bindungskomplexes, wobei die Trennung des ersten Bindungskomplexes anzeigt, dass die Testverbindung eine potenzielle therapeutische Aktivität besitzt.
  20. Assay nach Anspruch 19, wobei der Ligand markiert ist, das Analog auf einer Oberfläche immobilisiert ist und die Trennung des ersten Bindungskomplexes durch Beobachtung eines beliebigen Abfalls beim Signal der Markierung nachgewiesen wird, wenn eine Testverbindung den Liganden von dem ersten Bindungskomplex verdrängt.
  21. Assay nach Anspruch 19, wobei das Analog markiert ist, der Ligand auf einer Oberfläche immobilisiert ist und die Trennung des ersten Bindungskomplexes durch Beobachtung eines beliebigen Abfalls beim Signal der Markierung nachgewiesen wird, wenn eine Testverbindung das Analog von dem ersten Bindungskomplex verdrängt.
  22. Assay nach Anspruch 21, wobei das Analog Fluoreszenz- oder radiaktiv markiert ist.
  23. Assay nach Anspruch 21, wobei der Ligand Fluoreszenz- oder radioaktiv markiert ist.
  24. In situ-Footprinting-Assay zum Bestimmen der potenziellen therapeutischen Aktivität einer Testverbindung, wobei der Assay die Schritte umfasst:

    Vermischen eines Analogs nach Anspruch 1 mit einer Testverbindung unter Bedingungen, welche die Bildung eines Bindungskomplexes zwischen dem Analog und der Testverbindung ermöglichen,

    Inkubieren des Bindungskomplexes mit einem chemischen Sonden-Reagenz und Beobachten, ob das Reagenz auf das Analog in dem Komplex eine Wirkung hat,

    Inkubieren des Analogs, das an keine Testverbindung gebunden ist, mit dem chemischen Sonden-Reagenz und Beobachten, ob das Reagenz auf das ungebundene Analog in einer getrennten Kontrollreaktion eine Wirkung hat, und

    Vergleichen von jeder der Wirkungen des Sonden-Reagenzes auf das Analog in dem Bindungskomplex und auf das ungebundene Analog, wobei eine Verhinderung einer Wirkung des Reagenz auf das Analog in dem Bindungskomplex, die durch das Reagenz auf dem ungebundenen Analog verursacht wird, anzeigt, dass die Testverbindung eine potenzielle therapeutische Aktivität besitzt.
  25. In situ-Footprinting-Assay nach Anspruch 24, wobei das chemische Sonden-Reagenz Dimethylsulfat, Kethoxal oder Carbodiimid ist.
  26. In situ-Footprinting-Assay nach Anspruch 24, wobei das Sonden-Reagenz ein Nukleotid in dem Analog kovalent modifiziert, wenn es an eine beliebige Testverbindung ungebunden ist.
  27. In situ-Footprinting-Assay nach Anspruch 26, wobei die Wirkung des Sonden-Reagenzes durch Verwendung eines markierten Oligonukleotids beobachtet wird, das an das Analog hybridisiert, wenn es durch die Testverbindung gegen Methylierung geschützt ist und das nicht an das Analog hybridisiert, wenn es durch das Reagenz methyliert ist, wobei das Vorliegen der Markierung nach Abschluss des Assays anzeigt, dass die Testverbindung eine potenzielle therapeutische Aktivität besitzt.
  28. Analog nach Anspruch 1, wobei der Ligand ein Aminoglykosid ist.
Es folgen 9 Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com