PatentDe  


Dokumentenidentifikation DE69924738T2 02.03.2006
EP-Veröffentlichungsnummer 0001105728
Titel MODULIERUNG VON MLK- (MULTIPLE LINEAGE KINASE) PROTEINEN
Anmelder Cephalon, Inc., West Chester, Pa., US
Erfinder MARONEY, Anna, Media, US;
WALTON, M., Kevin, Old Saybrook, US;
DIONNE, A., Craig, Downington, US;
NEFF, Nicola, Wallingford, US;
KNIGHT, Jr., Ernest, Hilton Head Island, US;
GLICKSMAN, A., Marcie, Swarthmore, US
Vertreter Müller-Boré & Partner, Patentanwälte, European Patent Attorneys, 81671 München
DE-Aktenzeichen 69924738
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 18.08.1999
EP-Aktenzeichen 999437593
WO-Anmeldetag 18.08.1999
PCT-Aktenzeichen PCT/US99/18864
WO-Veröffentlichungsnummer 0000013015
WO-Veröffentlichungsdatum 09.03.2000
EP-Offenlegungsdatum 13.06.2001
EP date of grant 13.04.2005
Veröffentlichungstag im Patentblatt 02.03.2006
IPC-Hauptklasse G01N 33/50(2006.01)A, F, I, ,  ,  ,   
IPC-Nebenklasse C12Q 1/68(2006.01)A, L, I, ,  ,  ,      G01N 33/68(2006.01)A, L, I, ,  ,  ,      A61K 31/40(2006.01)A, L, I, ,  ,  ,      A61K 31/535(2006.01)A, L, I, ,  ,  ,      A61K 31/55(2006.01)A, L, I, ,  ,  ,      

Beschreibung[de]

Die vorliegende Erfindung ist teilweise auf Verfahren zum Modulieren von Mitgliedern der Multiple Lineage Kinase (MLK) Familie, Verfahren zum Identifizieren von Verbindungen, die ein Multiple Lineage Kinase-Protein modulieren und entweder das Zellüberleben oder den Zelltod fördern, Verfahren zum Identifizieren von Verbindungen, die in der Behandlung von neurodegenerativen Störungen und/oder Entzündung verwendbar sind, und Verfahren zum Behandeln neurodegenerativer Störungen mit Verbindungen, die ein Multiple Lineage Kinase-Protein inhibieren, gerichtet.

Hintergrund der Erfindung

Die MLK Familie umfasst eine Gruppe von Proteinen, in denen die Proteinsequenz der Kineasedomänen der Familienmitglieder den MAPKKKs stark gleicht, aber die größere Ähnlichkeit zueinander haben als andere MAPKKKs. MLK Familienmitglieder umfassen einen Anteil von sehr komplexen Kinasekaskasen wie, z.B. die Stresssignalkaskade, welche die Modulation von inter alia der c-Jun N terminalen Kinase (JNK) einschließt, die wiederum, inter alia, Transkriptionsfaktoren einschließlich c-Jun, ATF2 und ELK-1 moduliert. JNK ist in den US Patenten 5,534,426, 5,593,884, 5,605,808 und WO 95/03324 beschrieben, von denen jede hier in ihrer Gesamtheit durch Bezugnahme eingeschlossen ist.

Die MLK Familie schließt teilweise die folgenden Gruppen ein: 1) Multiple Lineage Kinase 1(MLK1); 2) Multiple Lineage Kinase 2(MLK2); 2) Multiple Lineage Kinase (MLK3); 4) Leucin-Zipper aufweisende Kinase (LZK); 5) zweifachen Leucin-Zipper aufweisende Kinase (DLK); und 6) Multiple Lineage Kinase 6 (MLK6). MLK1 weist eine katalytische Domäne auf, die ähnlich ist zu beiden Kinasen, die spezifisch sind für Tyr und Ser/Thr. Dorow, et al., Eur. J. Biochem., 1993, 213, 701–710.

MLK2 weist auch eine katalytische Domäne auf, die ähnlich ist zu beiden Kinasen, die spezifisch sind für Tyr oder Ser/Thr. Dorow, et al., Eur. J. Biochem., 1993, 213, 701–710. MLK2 ist auch als MST bekannt. Katoh, et al., Oncogene, 1995, 10, 1447–1451. MLK3 umfasst ein Protein, das zusätzlich zu der Kinasedomäne zwei Leucin-Zipper mit einer benachbarten Carboxy terminalen basischen Region und eine Prolin reiche Region aufweist. Ing, et al., Ongcogene, 1994, 9, 1745–1750. MLK3 ist auch als SPRK (Gallo, et al., J. Biol. Chem., 1994, 269, 15092–15100) und PTK1 (Ezoe, et al., Oncogene, 1994, 9, 935–938) bekannt. LZK ist eine Leucin-Zipper aufweisende Kinase. Sakuma, et al., J. Biol. Chem., 1997, 272, 28622–28629. DLK weist eine Kinasedomäne und zwei putative Leucin-Zipper Motive auf. Holzman, et al., J. Biol. Chem., 1994, 269, 30808–30817. DLK ist auch als ZPK (Reddy, et al., Biochem. Biophys. Res. Comm., 1994, 202, 613–620) und MUK (Hirai, et al., Oncogene, 1996, 12, 641–650) bekannt. Mitglieder der MLK Familie sind zum Beispiel auch beschrieben in den US Patenten 5,676,945, 5,554,523, WO93/15201, dem kanadischen Patent 2,148,898, Diener, et al., Proc. Natl. Acad. Sci USA, 1997, 94, 9687–9692, DeAizpurua, et al., J. Biol. Chem., 1997, 272, 16364–16373, Tung, et al., Oncogene, 1997, 14, 653–659, Sells, et al., Trends in Cell Biol., 1997, 7,161–167, Mata, et al., J. Biol. Chem., 1996, 271, 16888–16896, Hirai, et al., J. Biol. Chem., 1997, 272, 15167–15173, Fan, et al., J. Biol. Chem., 1996, 271, 24788–24793, Blouin, et al., DNA and Cell Biol., 1996, 15, 631–642, Pombo, et al., Nature, 1995, 377, 750–754, Kiefer, et al., EMBO J., 1996, 15, 7013–7025, Hu, et al., Genes & Dev., 1996, 10, 2251–2264, Su, et al., EMBO J., 1997, 16, 1279–1290 und Dorow, et al., Eur. J. Biochem., 1995, 234, 492–500. Kürzlich wurde eine andere MLK verwandte Kinase in der EST Datenbank identifiziert. Die DNA Sequenz dieses Klons, MLK6, ist durch sieben überlappende Einträge beschrieben. Ihre Klon Nummern sind: 1007489, 1460085, 510915, 666323, F5555, 482188 und 178522, deren jeweilige Sequenzen hier durch Bezugnahme in ihrer Gesamtheit eingeschlossen sind. Jede der in dem vorliegenden Absatz zitierten Referenzen ist hier durch Bezugnahme in ihrer Gesamtheit eingeschlossen.

Kürzlich wurde gezeigt, dass die stabile Expression von ZPK die proliferative Kapazität von NIH 3T3 Fibroblasten reduziert, wie durch einen Koloniebildungsassay gemessen wurde. Bergeron, et al., Biochem. Biophys. Res. Comm., 1997, 231, 153–155. Bergeron, et al., scheiterten jedoch irgendwelche Daten bereitzustellen, die zeigen, dass ZPK die Aktivität eines ZPK Substrats modulierte oder ob ZPK den Zelltod förderte.

Es wurde gezeigt, dass die Expression eines Konstrukts, das Myc-MLK2 in Swiss 3T3 Zellen kodiert, ungefähr 20 Stunden nach Injektion zu Apoptose führt. Nagata, et al., EMBO J., 1998, 17, 149–158.

Die Anmelder haben zahlreiche Indolo- und Indenoverbindungen entwickelt, die inter alia das Zellwachstum, das mit hyperproliferativen Zuständen assoziiert ist, inhibieren und den Tod in einer Vielzahl von embryonalen Kulturen, wie dorsalem Wurzelganglion, Streifenhügel, Ganglien cervicale superius und motorischen Neuronen, inhibieren. Die US Patente 5,475,110, 5,591,855, 5,594,009, 5,461,146, 5,621,100, 5,621,101, 5,705,511 und 5,756,494, von denen jedes auf den Inhaber der vorliegenden Anmeldung übertragen ist, wird jedes hier durch Bezugnahme in seiner Gesamtheit eingeschlossen. Verbindungen, die in dem US Patent 5,705,511 mit der Formel G zitiert sind, werden in der vorliegenden Anmeldung mit Formel I bezeichnet. Die Anmelder haben auch gezeigt, dass die Apoptose von motorischen Neuronen durch ein Derivat von K-252a, einem Indolocarbazol inhibiert wird, das auch die Stresssignalkaskade moduliert. Maroney, et al., J. Neurosci., 1998, 18, 104–111, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist.

Aufgrund der Unzulänglichkeiten von Screeningverbindungen, die Mitglieder der Stresssignalkaskade modulieren und entweder den Zelltod oder das Zellüberleben fördern, besteht fortwährend ein Bedarf für neue, selektive Verfahren von Screeningverbindungen. Zusätzlich besteht fortwährend ein Bedarf für Screeningassays für Therapeutika, die verwendbar sein können in der Behandlung von Entzündung und neurodegenerativen Störungen. Die vorliegende Erfindung ist auf diese, ebenso wie auf andere wichtige Ziele gerichtet.

Zusammenfassung der Erfindung

Die vorliegende Erfindung stellt Verfahren zum Identifizieren von Verbindungen bereit, welche die Aktivität eines Multiple Lineage Kinase-Proteins modulieren und das Zellüberleben fördern, umfassend die Schritte des Inkontaktbringens der das Multiple Lineage Kinase-Protein enthaltenden Zelle mit der Verbindung, des Bestimmens, ob die Verbindung die Aktivität des Multiple Lineage Kinase-Proteins erhöht oder vermindert, und des Bestimmens, ob die Verbindung das Zellüberleben fördert.

Die vorliegende Erfindung stellt auch Verfahren zum Identifizieren von Verbindungen bereit, welche die Aktivität des Multiple Lineage Kinase-Proteins modulieren und den Zelltod fördern, umfassend die Schritte des Inkontaktbringens der das Multiple Lineage Kinase-Protein enthaltenden Zelle mit der Verbindung, des Bestimmens, ob die Verbindung die Aktivität des Multiple Lineage Kinase-Proteins erhöht oder vermindert, und des Bestimmens, ob die Verbindung den Zelltod fördert.

Die vorliegende Erfindung stellt auch Verfahren zum Identifizieren von Verbindungen bereit, die in der Behandlung von neurodgenerativen Störungen verwendbar sein können, umfassend das Inkontaktbringen einer Zelle oder eines Zellextraktes, enthaltend ein Multiple Lineage Kinase-Protein, mit der Verbindung und das Bestimmen, ob die Verbindung die Aktivität des Multiple Lineage Kinase-Proteins verringert.

Die vorliegende Erfindung stellt auch Verfahren zum Identifizieren von Verbindungen bereit, die in der Behandlung von Entzündung verwendbar sein können, umfassend das Inkontaktbringen einer Zelle oder eines Zellextraktes, umfassend ein Multiple Lineage Kinase-Protein, mit der Verbindung und das Bestimmen, ob die Verbindung die Aktivität des Multiple Lineage Kinase-Proteins verringert.

Die vorliegende Erfindung stellt auch Verfahren zur Behandlung eines Säugers mit einer oder der im Verdacht steht eine neurodegenerative Störung aufzuweisen bereit, umfassend das Verabreichen einer Verbindung an den Säuger, welche die Multiple Lineage Kinase-Proteinaktivität inhibiert oder verringert.

Die vorliegende Erfindung stellt auch Verfahren zur Behandlung eines Säugers mit einer Entzündung bereit, umfassend das Verabreichen einer Verbindung an den Säuger, welche die Multiple Lineage Kinase-Proteinaktivität inhibiert oder verringert.

Die vorliegende Erfindung stellt auch Verfahren zum Modulieren der Aktivität eines Multiple Lineage Kinase-Proteins bereit, umfassend das Inkontaktbringen des Proteins oder einer das Protein enthaltenden Zelle mit einer Verbindung mit der Formel II:

wobei:

Ring B und Ring F unabhängig voneinander und jeder zusammen mit den Kohlenstoffatomen, an die sie gebundne sind, aus der Gruppe, bestehend aus

einem ungesättigten 6-gliedrigen carbocyclischen aromatischen Ring, in dem 1 bis 3 Kohlenstoffatome durch Stickstoffatome ersetzt sein können,

einem ungesättigten 5-gliedrigen carbocyclischen aromatischen Ring, und

einem ungesättigten 5-gliedrigen carbocyclischen aromatischen Ring, in dem entweder

ein Kohlenstoffatom durch ein Sauerstoff-, Stickstoff- oder Schwefelatom ersetzt ist,

zwei Kohlenstoffatome durch ein Schwefel- und ein Stickstoffatom, ein Sauerstoff- und ein Stickstoffatom oder zwei Stickstoffatome ersetzt sind, oder

drei Kohlenstoffatome durch drei Stickstoffatome ersetzt sind,

ausgewählt sind,

R1 aus der Gruppe, bestehend aus

H, substituiertem oder nicht substituiertem Alkyl mit 1 bis 4 Kohlenstoffen, substituiertem oder nicht substituiertem Aryl, substituiertem oder nicht substituiertem Arylalkyl, substituiertem oder nicht substituiertem Heteroaryl oder substituiertem oder nicht substituiertem Heteroarylalkyl,

-C(=O)R9, wobei R9 ausgewählt ist aus der Gruppe, bestehend aus Alkyl, Aryl und Heteroaryl,

-OR10, wobei R10 ausgewählt ist aus der Gruppe, bestehend aus H und Alkyl mit 1 bis 4 Kohlenstoffen,

-C(=O)NH2, -NR11R12, -(CH2)pNR11R12, -(CH2)pOR10, -O(CH2)pOR10 und -O(CH2)pNR11R12, wobei p 1 bis 4 ist und wobei entweder

R11 und R12 jeweils unabhängig voneinander ausgewählt sind aus der Gruppe, bestehend aus H und Alkyl mit 1 bis 4 Kohlenstoffen, oder

R11 und R12 zusammen eine Verbindungsgruppe der Formel -(CH2)2-X1-(CH2)2- bilden, wobei X1 ausgewählt ist aus der Gruppe, bestehend aus -O-, -S-, -CH2-,

ausgewählt ist,

R2 aus der Gruppe, bestehend aus H, Alkyl mit 1 bis 4 Kohlenstoffen, -OH, Alkoxy mit 1 bis 4 Kohlenstoffen, -OC(=O)R9, -OC(=O)NR11R12, -O(CH2)pNR12R12, -O(CH2)pOR10, substituiertem oder nicht substituiertem Arylalkyl mit 6 bis 10 Kohlenstoffen und substituiertem und nicht substituiertem Heteroarylalkyl, ausgewählt ist,

R3, R4, R5 und R6 jeweils unabhängig voneinander aus der Gruppe, bestehend aus

H, Aryl, Heteroaryl, F, Cl, Br, K, -CN, CF3, -NO2, -OH, -OR9, -O(CH2)pNR11R12, -OC(=O)R9, -OC(=O)NR2R7, -OC(=O)NR11R12, -O(CH2)pOR10, -CH2OR10, -NR11R12, -NR10S(=O)2R9, -NR10C(=O)R9,

-CH2OR14, wobei R14 der Rest einer Aminosäure ist, nachdem die Hydroxylgruppe der Carboxylgruppe entfernt ist,

-NR10C(=O)NR11R12, -CO2R2, -C(=O)R2, -C(=O)NR11R12, -CH=NOR2, -CH=NR9, -(CH2)pNR11R12, -(CH2)pNHR14 der -CH=NNR2R2A, wobei R2A das Gleiche ist wie R2,

-S(O)yR2, -(CH2)pS(O)yR9, -CH2S(O)yR14, wobei y 0, 1 oder 2 ist,

Alkyl mit 1 bis 8 Kohlenstoffen, Alkenyl mit 2 bis 8 Kohlenstoffen und Alkinyl mit 2 bis 8 Kohlenstoffen, wobei

jede Alkyl-, Alkenyl- oder Alkinylgruppe nicht substituiert ist oder

jede Alkyl-, Alkenyl- oder Alkinylgruppe mit 1 bis 3 Gruppen, ausgewählt aus der Gruppe, bestehend aus Aryl mit 6 bis 10 Kohlenstoffen, Heteroaryl, Arylalkoxy, Heterocycloalkoxy, Hydroxyalkoxy, Alkyloxy-Alkoxy, Hydroxyalkylthio, Alkoxy-Alkylthio, F, Cl, Br, I, -CN, -NO2, -OH, -OR9, -X2(CH)pNR11R12, -X2(CH2)pC(=O)NR11R12, -X2(CH2)pOC(=O)NR11R12, -X2(CH2)pCO2R9, -X2(CH2)pS(O)yR9, -X2(CH2)pNR10C(=O)NR11R12, -OC(=O)R9, -OCONHR2, -O-Tetrahydropyranyl, -NR11R12, -NR10C(=O)R9, -NR10CO2R9, -NR10C(=O)NR11R12, -NHC(=NH)NH2, NR10S(O)2R9, -S(O)yR9, -CO2R2, -C(=O)NR11R12, -C(=O)R2, -CH2OR10, -CH=NNR2R2A, -CH=NOR2, -CH=NR9, -CH=NNHCH(N=NH)NH2, -S(=O)2NR2R2A, -P(=O)(OR10)2, -OR14 und einem Monosaccharid mit 5 bis 7 Kohlenstoffen, wobei jede Hydroxylgruppe des Monosaccharids unabhängig voneinander entweder nicht substituiert oder durch H, Alkyl mit 1 bis 4 Kohlenstoffen, Alkylcarbonyloxy mit 2 bis 5 Kohlenstoffen oder Alkoxy mit 1 bis 4 Kohlenstoffen ersetzt ist, substituiert ist,

ausgewählt sind,

X2 O, S oder NR10 ist,

R7 und R8 jeweils unabhängig voneinander ausgewählt sind aus der Gruppe, bestehend aus H, Alkyl mit 1 bis 4 Kohlenstoffen, Alkoxy mit 1 bis 4 Kohlenstoffen, substituiertem oder nicht substituiertem Arylalkyl mit 6 bis 10 Kohlenstoffen, substituiertem oder nicht substituiertem Heteroarylalkyl, -(CH2)pOR10, -(CH2)pOC(=O)NR11R12 und -(CH2)pNR11R12 oder R7 und R8 zusammen eine Verbindungsgruppe mit der Formel -CH2-X3-CH2- bilden, wobei X3 X2 oder eine Bindung ist,

m und n jeweils unabhängig voneinander 0, 1 oder 2 sind,

Y aus der Gruppe, bestehend aus -O-, -S-, -N(R10)-, -N+(O)(R10)-, -N(OR10)- und -CH2- ausgewählt ist,

Z aus der Gruppe, bestehend aus einer Bindung, -O-, -CH=CH-, -S-, -C(=O)-, -CH(OR10)-, -N(R10)-, -N(OR10)-, -CH(NR11R12)-, -C(=O)N(R17)-, -N(R17)C(=O)-, -N(S(O)yR9)-, -N(S(O)yNR11R12)-, -N(C(=O)R17)-, -C(R15R16)-, -N+(O)(R10)-, -CH(OH)-CH(OH)- und -CH(O(C=O)R9)CH(OC(=O)R9A)-, ausgewählt ist, wobei R9A das Gleiche wie R9 ist,

R15 und R16 unabhängig voneinander aus der Gruppe, bestehend aus H, -OH, -C(=O)R10, -O(C=O)R9, Hydroxyalkyl und -CO2R10, ausgewählt sind,

R17 aus der Gruppe, bestehend aus H, Alkyl, Aryl und Heteroaryl, ausgewählt ist,

A1 und A2 aus der Gruppe, bestehend aus H, H; H, OR2; H, -SR2; H, -N(R2)2 und einer Gruppe, in der A1 und A2 zusammen eine Einheit, ausgewählt aus der Gruppe, bestehend aus =O, =S und =NR2 bilden, ausgewählt sind,

B1 und B2 aus der Gruppe, bestehend aus H, H; H, -OR2; H, -SR2; H, -N(R2)2 und einer Gruppe, in der B1 und B2 zusammen eine Einheit, ausgewählt aus der Gruppe, bestehend aus =O, =S und =NR2 bilden, ausgewählt sind, mit der Maßgabe, dass mindestens eines der Paare A1 und A2 oder B1 und B2 =O bilden.

Die vorliegende Erfindung stellt auch Verfahren zum Modulieren der Aktivität eines Multiple Lineage Kinase-Proteins bereit, umfassend das Inkontaktbringen des Proteins oder einer das Protein enthaltenden Zelle mit einer Verbindung mit der Formel III:

wobei:

Z1 H ist und Z2 H ist oder Z1 und Z2 zusammen =O bilden,

R1 aus der Gruppe, bestehend aus H, Cl, CH2SO2C2H5, Br, CH2S(CH2)2NH2, CH2S(CH2)2N(CH3)2, CH2S(CH2)2NH2, n-C4H9, NHCONHC6H5, NHCONHC2H5, CH2SC2H5, CH2SC6H5, N(CH3)2, CH3, CH2OCONHC2H5, NHCO2CH3, CH2OC2H5, CH2N(CH3)2, OH, O-n-Propyl, CH=NNH-C(=NH)NH2, CH=N-N(CH3)2, CH2S(CH2)2NH-n-C4H9, CH2OCH2OCH2CH3, CH2S[3-(1,2,4-Triazin)], CH2CH2SCH3 und
ausgewählt ist,

R2 aus der Gruppe, bestehend aus H, Br, Cl, I, CH2S(CH2)2N(CH3)2, NHCONHC2H5, CH2SC2H5, CH2OCH2OCH2CH3, CH2S(3-(1,2,4-Triazin)), CH2CH2SCH3 und CH2OH, ausgewählt ist,

X aus der Gruppe, bestehend aus H, CH2OH, CH2NH-SerinH, CO2CH3, CONHC6H5, CH2NHCO2C6H5, CH2NHCO2CH3, CH2N3, CONHC2H5, CH2NH-Glycin, CON(CH3)2, -CH2NHCO2-, CONH2, CONHC3H7, CH2NH-Serin, CH2SOCH3, CH=NOH, CH2NH-Prolin, CH2CH2(2-Pyridyl), CH=NNHC(=NH)NH2, CONH(CH2)2OH, CH=NNHCONH2, CH2OCOCH3, -CH2OC(CH3)2O-, CH2SC6H5, CH2SOC6H5, CO2n-Hexyl, CONHCH3, CO2(CH2)4CH3; oder eine der folgenden Formeln
ausgewählt ist und

R aus der Gruppe, bestehend aus OH und OCH3, ausgewählt ist.

Die vorliegende Erfindung stellt auch Verfahren zum Modulieren der Aktivität eines Multiple Lineage Kinase-Proteins bereit, umfassend das Inkontaktbringen des Proteins oder einer das Protein enthaltenden Zelle mit einer Verbindung mit der Formel IV:

wobei

Z1 H ist und Z2 H ist oder Z1 und Z2 zusammen =O bilden,

R1 H oder Br ist,

R2 H ist,

R3 H, CH2CH=CH2, CH2CH2CH2OH oder

und

R4 H, CH2CH=CH2 oder CH2CH2CH2OH ist.

Kurzbeschreibung der Figuren

Zum Zweck der Darstellung von Ausführungsformen der vorliegenden Erfindung sind in den Zeichnungen gewisse Merkmale gezeigt. Es sollte jedoch verstanden werden, dass diese Erfindung nicht auf die exakt gezeigten Ausführungsformen beschränkt ist.

1 ist eine schematische Zeichnung, die eine allgemeine Herstellung von überbrückten Indenopyrrolocarbazolen zeigt.

2 ist eine schematische Zeichnung, die eine allgemeine Herstellung von überbrückten Indenopyrrolocarbazolen zeigt.

3 ist eine schematische Zeichnung, die eine Herstellung von harzgebundenen Indenopyrrolocarbazolen zeigt.

4 ist eine schematische Zeichnung, die die Herstellung von geschützten, löslichen Indenopyrrolocarbazolen zeigt.

5 ist eine schematische Zeichnung, die die Herstellung von Zwischenprodukt V zeigt.

6 ist eine schematische Zeichnung, die die Herstellung von überbrückten Indenopyrrolocarbazolen unter Verwendung von Verfahren A zeigt.

7 ist eine schematische Zeichnung, die die Herstellung von überbrückten Indenopyrrolocarbazolen unter Verwendung von Verfahren B zeigt.

8 ist eine schematische Zeichnung, die die Herstellung von B Ring substituierten überbrückten Indenopyrrolocarbazolen zeigt.

9 ist eine schematische Zeichnung, die die Derivatisierung des E Rings von überbrückten Indenopyrrolocarbazolen zeigt.

10 zeigt eine Graphik von zwei getrennten Experimenten, welche die Menge von lebenden neuronalen differenzierten PC-12 Zellen darstellen, die nach 5 Tagen des Kultivierens in der Abwesenheit von NGF verbleiben. Die Ergebnisse sind als Prozent NGF Kontrolle innerhalb jeder Gruppe (Vektorkontrolle in der Abwesenheit von NGF, n = 12; alle anderen Gruppen, n = 3) ausgedrückt. Die Differenz zwischen Vektorkontrolle und stabilem Pool von Zellen, die eine dominant negative MLK-3 Mutante in der Abwesenheit von NGF exprimieren, ist statistisch signifikant, wie durch einen zweiseitigen T-Test (p < 0,05) bestimmt wurde.

11A zeigt die Phosphorylierung von Kinase-totem GST-SEK-1 durch Baculovirus exprimierte FLAG-MLK-3 (Mischung von Gesamtlänge und Kinasedomäne) unter Verwendung eines radioaktiven Gel basierten Assays.

11B zeigt 32P-markiertes phosphoryliertes Myelin basisches Proteinprodukt, das als ein Ergebnis einer Kineasereaktion gebildet wird, die durch Baculovirus exprimierte FLAG-MLK-3 (Mischung von Gesamtlänge und Kinasedomäne) oder GST-MLK-3 Kineasedomäne katalysiert wird.

12 ist eine Immunblot Analyse, welche die Phosphorylierung von Kinasetotem GST-SEK-1 durch Baculovirus exprimierte FLAG-MLK-3 (Mischung von Gesamtlänge und Kinasedomäne) zeigt, wie durch einen phospho-spezifischen SEK-1 Antikörper gezeigt wurde.

13 zeigt die Phosphorylierung von Myelin basischem Protein durch bakteriell exprimierte GST-MLK-3 Kinasedomäne unter Verwendung eines (o) Multiscreen Trichloressigsäure Präzipitationsassays oder des (•) Phosphocellulose Membranverfahrens.

14 zeigt eine Sättigungsbindungskurve von [3H]K252a, das mit Lysat von MLK-3 Baculovirus infizierten Insektenzellen inkubiert wurde.

15A zeigt die Menge an 32P-markiertem c-jun in einer Immunpräzipitation/Kineasereaktion von Zellen, die MLK-3, MLK-2 oder DLK überexprimieren und entweder mit 0,025% DMSO (Kontrolle) oder 500 nM K-252a behandelt wurden.

15B zeigt eine Graphik, welche die prozentuale Aktivität quantifiziert, die in den Immunpräzipitat/Kineasereaktionen aus Proben, die in 15A beschrieben sind, verbleibt. Die Säulen stellen den Durchschnitt von zweifachen Proben dar, wobei der Fehlerbalken den Bereich des Mittels anzeigt.

15C zeigt die Menge an 32P-markiertem c-jun in einer Immunpräzipitation/Kinasereaktion aus Zellen, die HA-JNK1 alleine oder mit MEKK1 bei verschiedenen Mengen an cDNA wie angegeben exprimieren, und die mit entweder 0,025% DMSO (Kontrolle) oder 500 nM von Verbindung III-3 (siehe Tabelle 3) behandelt wurden. Die Säulen stellen den Durchschnitt von zweifachen Proben dar, wobei der Fehlerbalken den Bereich des Mittels anzeigt.

16 zeigt, dass Verbindung III-3 das neuronale Überleben in einer konzentrationsabhängigen Weise fördert. Dissoziierte Neuronen wurden von sympathischen Ganglien (SA)(A), dorsalen Wurzelganglien (DRG)(B), Ziliarganglien (CG)(C) und motorischen Neuronen (MN)(D) in der Anwesenheit oder Abwesenheit der angegebenen trophischen Faktoren, kultiviert. Die Zellen wurden 48 h nach dem Ausplattieren, wie in Materialien und Methoden beschrieben, gezählt. Die Daten repräsentieren Mittelwerte ±SD von dreifachen oder vierfachen Bestimmungen. Gezeigt ist eines der drei Experimente.

17 zeigt Phasenkontrastmikrogramme von Kulturen von E12 DRG (A, E), E9 sympathischen (B, F), E8 Ziliar-(C, G) und E5,5 motorischen Neuronen (D, H) nach 48 h in Kultur (24 h für Ziliarneurone) in der Anwesenheit des jeweiligen neurotrophen Faktors (20 ng/ml NGF für sympathische und sensorische Neurone, 10 ng/ml CNTF für Ziliarneurone, 30 &mgr;g/ml Muskelextrakt (MEX) für motorische Neurone (A-D) oder in der Anwesenheit von 1 &mgr;M Verbindung III-3 (E-H). Maßstab = 200 &mgr;m.

18 zeigt ein Photomikrogramm von dorsalen Wurzelganglien Explantaten in vitro. Explante von Hühnchen DRG (E9) wurde in 96 Vertiefungsplatten mit Medium enthaltend 0,05% BSA ausplattiert. Nach 2 h Anheftungszeit wurden hinzugefügt: (A) Kontrolle DMSO; (B) 20 ng/ml NGF; (C) 250 nM Verbindung III-3. Achtundvierzig h später wurde das Medium entfernt, und die Explantate wurden mit 4 Paraformaldehyd in Phosphat gepufferter Salzlösung fixiert.

19 zeigt die Zahl von Hühnchen Lumbar motorischen Neuronen, die auf E10 nach der täglichen Behandlung (E5-9) mit spezifischen Dosen von Verbindung III-3 überleben. Die dargestellten Daten sind der Durchschnitt ± S.D. von 5–6 Tieren/Behandlungsgruppe. Das berichtete Experiment wurde zweimal wiederholt. Die Daten stammen von einem repräsentativen Experiment und stellen eine Seite der Lumbarsäule dar. *p < 0,01, **p < 0,001, Studenten t Test zwischen Verbindung III-3 und Kontrollgruppen mit Bonferroni Korrektur.

20 zeigt die Zahl von motorischen Neuronen in dem weiblichen Ratten spinalen Kern des Bulbo spongiosus (SNB), die auf PN10 oder PN60 nach täglicher Behandlung (PN1-5) mit Verbindung III-3 oder Kontrollvehikel (5% SolutolTM) überleben. An PN10(A, B) oder PN60(B) wurden die Ratten geopfert, und die Region des Rückenmarks mit dem SNB wurde seziert und für die Histologie verarbeitet; Cresylecht violett gefärbte motorische Neurone wurden danach in Reihenschnitten von der lumbalen 5-sakralen 1 Region des Rückenmarks, wie kürzlich beschrieben (Wingfield, et al., Steroids, 1975, 26, 31–327) gezählt. Die experimentellen Daten sind die Mittelwerte ± S.E.M. von 4–8 Tieren/Behandlungsgruppen.

21 zeigt den Verlust von ChAT Immunreaktivität nach hypoglosaler Axotomie in der adulten Ratte nach Behandlung mit Verbindung III-3. Gezeigt sind Photomikrogramme des hypoglosalen Kerns nach Transsektion des hypoglosalen Nervs und Behandlung mit (A) Vehikellösung alleine (5% SolutolTM) und (B) 200 &mgr;g von Verbindung III-3, angewendet auf die Stelle der Transsektion. (C) zeigt die Zahl von ChAT immunreaktiven hypoglosalen motorischen Neuronen nach Behandlungen, die in (A) und (B) oben beschrieben sind. Die Ergebnisse sind als der Prozentsatz der ChAT immunreaktiven motorischen Neuronen ausgedrückt, wobei 100% definiert sind als die Zahl von ChAT immunreaktiven motorischen Neuronen in dem kontralateralen unverletzten hypoglosalen Kern.

22 zeigt die Inhibierung des MLK-3 Weges, was die in vivo Wirksamkeit und Blockierung unterhalb von Phosphorylierungsereignissen zeigt. 22A zeigt den Anstieg von Substantia nigra Tyrosinhydroxylase immunreaktiven Neuronen nach MPTP Läsion nach systematischer Verabreichung von Verbindung III-3. 22B ist ein repräsentativer Immunblot, der den MPTP induzierten Anstieg der Mengen an phosphorylierter MKK4 zeigt. 22C zeigt einen repräsentativen Immunblot und ELISA, der die Attenuation von MPTP induzierter phosphorylierter MKK4 in der Anwesenheit von Verbindung III-3 zeigt.

23 zeigt die Induktion von IL-2 in Jurkat Zellen. 23A zeigt den Zeitverlauf der IL-2 Induktion. 23B zeigt die Inhibierung von IL-2 Induktion durch Verbindung III-3. 23C zeigt die Inhibierung von IL-2 Induktion durch Verbindung III-3 und Verbindung I-4.

Detaillierte Beschreibung der Erfindung

Wie oben angezeigt und innerhalb der Offenbarung sollen die folgenden Begriffe, außer es ist anders angegeben, in den folgenden Bedeutungen verstanden werden.

"Apoptose" betrifft eine spezifische morphologische Form des Zelltods, gekennzeichnet durch Fragmentierung von Zellen und ihrer Kerne in Membran gebundene Partikel. Apoptose kann zum Beispiel ausgelöst werden durch die Behandlung mit Apoptose induzierenden Verbindungen, wie Etoposid, Staurosporin, Tumornekrose Faktor-&agr;, Ceramid und ähnlichem oder durch Bedingungen, wie X-Bestrahlung.

Der Begriff "Zelltod" betrifft den Tod von Zellen durch Apoptose, Nekrose oder durch andere Mittel, die dem Fachmann gut bekannt sind. "Zelltod" kann zum Beispiel gekennzeichnet sein durch einen Abfall in den Gesamtzellzahlen von Zellen oder einen Abfall im Zellüberleben im Vergleich zu unbehandelten Kontrollpopulationen von Zellen. Verbindungen, die "den Zelltod fördern" führen zu einem Abfall in den Zellzahlen oder einem Abfall in dem Zellüberleben im Vergleich zu Kontrollpopulationen. Im Gegensatz dazu führen Verbindungen, die "das Zellüberleben fördern" zu einem Anstieg in den Zellzahlen oder dem Zellüberleben, oder sie verlangsamen oder reduzieren die Geschwindigkeit des Zelltods.

Die Begriffe "reagiert selektiv" oder "bindet spezifisch" beschreibt Verbindungen, die physikalisch oder chemisch direkt mit einem MLK Protein interagieren. Im Gegensatz dazu können Verbindungen, die nicht "selektiv reagieren" oder "spezifisch binden" Proteine unterhalb oder oberhalb des MLK Proteins beeinflussen und können so die Aktivität von MLK Proteinen beeinflussen, aber sie interagieren nicht direkt physikalisch oder chemisch mit einem MLK Protein.

Der Begriff "moduliert" betrifft das Steigern oder Verringern an Aktivität eines bestimmten Proteins oder Substrats davon.

Die vorliegende Erfindung ist zum Teil auf Verfahren zum Identifizieren von Verbindungen gerichtet, welche die Aktivität eines MLK Proteins modulieren und entweder das Zellüberleben oder den Zelltod fördern. Verbindungen, die zu gesteigerter MLK Proteinaktivität führen, können den Zelltod fördern, wohingegen Verbindungen, die zu verringerter MLK Proteinaktivität führen, das Zellüberleben fördern können.

Das MLK Protein kann irgendein Protein sein, das als zu der MLK Klasse von Proteinen gehörend identifiziert wurde. Vorzugsweise ist das MLK Protein aus der Gruppe, bestehend aus MLK1, MLK2, MLK3 (SPRK, PTK1), LZK, DLK (ZPK, MUK) und MLK6, die oben beschrieben sind, ausgewählt. In bevorzugten Ausführungsformen der Erfindung identifizieren die Verfahren Verbindungen, die direkt mit dem MLK Protein interagieren oder es binden, wie durch Bindungsassays, Kinaseassays oder durch äquivalente Assays bestimmt wird.

Um Verbindungen zu identifizieren, welche die MLK Proteinaktivität modulieren und das Zellüberleben oder den Zelltod fördern, wird/werden das MLK Protein enthaltende Zelle/n mit der Testverbindung in Kontakt gebracht. Das Inkontaktbringen kann in Puffern oder Medien stattfinden, die dem Fachmann gut bekannt sind. Zusätzlich können verschiedene Zahlen von Zellen und Konzentrationen von Testverbindungen verwendet werden. Ob die Testverbindung die Aktivität des MLK Proteins steigert oder verringert, wird bestimmt. Zusätzlich wird auch bestimmt, ob die Testverbindung das Zellüberleben oder den Zelltod fördert.

Die Zellen, die mit den Testverbindungen in Kontakt gebracht werden, kann irgendeine Säugerzelle sein. Vorzugsweise ist die Zelle eine neuronale Zelle. Vorzugsweise ist die Zelle in eine neurodegenerative Erkrankung involviert. Für die Zwecke dieser Erfindung sind eine "neurodegenerative Erkrankung", eine "neurodegenerative Störung" und ein "neurodegenerativer Zustand" austauschbar, und sie werden verwendet, um irgendeine Erkrankung oder Störung zu beschreiben, die neuronale Zellen oder Zellen, die in das neuronale System eingeschlossen sind, einschließt, einschließlich, aber nicht beschränkt auf Alzheimersche Erkrankung, Erkrankung der motorischen Neuronen, amyotrophe laterale Sklerose, Parkinsonsche Erkrankung, zerebrovaskulare Erkrankung, ischämische Zustände, AIDS Demenz, Epilepsie, Huntingtonsche Erkrankung und konkussive oder penetrierende Verletzungen des Gehirns oder Rückenmarks.

Die MLK Proteinaktivität kann durch eine Vielzahl von Techniken bestimmt werden. Zum Beispiel kann die MLK Aktivität durch Messen der Aktivität eines Substrats des MLK Proteins bestimmt werden. Solche Substrate sind gut bekannt und für den Fachmann einfach erhältlich. Vorzugsweise ist das Substrat ein Mitglied der Mitogen aktivierten Proteinkinasekinasefamilie oder der Mitogen aktivierten Proteinkinasefamilie oder Substraten weiter unten des Weges das einschließt, aber nicht beschränkt auf ein Protein das aus der Gruppe, bestehend aus JNK1, JNK2, JNK3, ERK1, ERK2, p38&agr;, p38&bgr;, p38&ggr;, p38&dgr;, MEK1, MEK2, MKK3, MKK4 (SEK1), MEK5, MKK6, MKK7, jun, ATF2, ELK1 und das Säuger-Homolog von AEX-3, ausgewählt ist, und auch allgemeine Substrate von Ser/Thr Proteinkinasen, wie das Myelin basische Protein (MBP). Reagenzien und Verfahren zum Messen der Aktivität der Substrate sind dem Fachmann ebenfalls gut bekannt. Die Anwesenheit von MLK kann auch durch Messen der Menge des MLK Proteins oder der mRNA, die das MLK Protein kodiert, bestimmt werden. Reagenzien, einschließlich Antikörpern und Oligonukleotidsonden, ebenso wie Verfahren zum Messen der Menge von DNA oder Protein, einschließlich Northern und Western Blots, sind dem Fachmann gut bekannt. Die MLK Proteinaktivität kann auch durch einen in vitro Kinaseassay bestimmt werden. In vitro Kinaseassays sind dem Fachmann gut bekannt. Andere Techniken zum Messen von Proteinaktivität sind dem Fachmann bekannt, und es ist beabsichtigt, dass sie durch die vorliegende Erfindung abgedeckt sind. Somit kann der Fachmann bestimmen, ob die Testverbindung die MLK Proteinaktivität moduliert, d.h. steigert oder verringert.

Ob oder ob nicht die Testverbindung das Zellüberleben oder den Zelltod fördert, kann auf eine Vielzahl von Wegen bestimmt werden. Vorzugsweise wird das Fördern des Zellüberlebens oder des Zelltods bestimmt indem Zellen verwendet werden, die ein Risiko haben zu sterben, und durch das Vergleichen der Menge der Zellen, die mit der Testverbindung in Kontakt gebracht wurden und lebend bleiben mit der Menge der Zellen, die nicht mit der Testverbindung in Kontakt gebracht wurden und lebend bleiben. Vorzugsweise sind die Zellen primäre embryonale motorische neuronale Zellen, die vorbestimmt sind zu sterben. Primäre embryonale motorische neuronale Zellen sind in Maroney, et al., J. Neurosci., 1998, 18, 104–111 beschrieben, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen wird. Primäre embryonale motorische neuronale Zellen werden sterben, außer sie werden durch die Testverbindung gerettet. Somit zeigt eine größere Zahl von lebenden motorischen neuronalen Zellen in der Population von motorischen neuronalen Zellen, die mit der Testverbindung behandelt wurden im Vergleich zu der Zahl von motorischen neuronalen Zellen in der Population von motorischen neuronalen Zellen, die nicht mit der Testverbindung behandelt wurden, eine Verbindung an, die das Zellüberleben fördert. Im Gegensatz dazu zeigt eine geringere Zahl von lebenden motorischen neuronalen Zellen in der Population von motorischen neuronalen Zellen, die mit der Testverbindung behandelt wurden im Vergleich zu der Zahl von lebenden motorischen neuronalen Zellen in der Population von motorischen neuronalen Zellen, die nicht mit der Testverbindung behandelt wurden, eine Testverbindung an, die den Zelltod fördert.

In einer anderen Ausführungsform der Erfindung werden normale Zellen, oder Wildtypzellen, durch Überexprimieren des MLK Proteins in Zellen umgewandelt, die ein Risiko haben zu sterben, wie unten in den Beispielen beschrieben ist, und anschließend werden sie mit der Testverbindung in Kontakt gebracht. Zellen die MLK Proteine überexprimieren können sterben, es sei denn sie werden durch die Testverbindung gerettet. Die Überexpression von MLK Proteinen kann unter Verwendung von Vektoren erreicht werden, die befähigt sind, das bestimmte Protein in einer Zelle zu exprimieren. Expressionsvektoren sind dem Fachmann gut bekannt. Zusätzlich sind Verfahren zum Herstellen von Expressionsvektoren dem Fachmann ebenfalls gut bekannt. Expressionsvektoren, die irgendeines der MLK Proteine exprimieren, können in einer Weise hergestellt werden, die ähnlich ist zu jener, die in den Beispielen beschrieben ist. Eine größere Zahl von lebenden Zellen in der Population von überexprimierenden Zellen, die mit der Testverbindung behandelt wurden, im Vergleich zu der Zahl von lebenden Zellen in der Population von überexprimierenden Zellen, die nicht mit der Testverbindung behandelt wurden, zeigt eine Testverbindung an, die das Zellüberleben fördert. Im Gegensatz dazu zeigt eine geringere Zahl von lebenden Zellen in der Population von überexprimierenden Zellen, die mit der Testverbindung behandelt wurden, im Vergleich zu der Zahl der lebenden Zellen in der Population von überexprimierenden Zellen, die nicht mit der Testverbindung behandelt wurden, eine Testverbindung an, die den Zelltod fördert.

In einer anderen Ausführungsform der Erfindung wird das Fördern des Zellüberlebens durch Beobachten oder Messen einer Verringerung in der Apoptose bestimmt. Cytoplasmatisches Schrumpfen und Kernkondensation sind mit Apoptose assoziiert. Somit kann der Fachmann eine Verringerung in der Apoptose durch Messen oder Beobachten einer Verringerung im cytoplasmatischen Schrumpfen und/oder der Kernkondensation messen. Zusätzlich kann der Fachmann die Apoptose durch Verwenden von herkömmlichen Färbungstechniken messen.

In anderen Ausführungsformen der Erfindung können normale, Wildtyp neuronale Zellen verwendet werden, um Verbindungen zu identifizieren, die den Zelltod fördern. Normale neuronale Zellen werden überleben, es sei denn sie werden durch die Testverbindung induziert zu sterben. Eine geringere Zahl von lebenden Zellen in der Population von normalen Zellen, die mit der Testverbindung behandelt wurden, im Vergleich zu der Zahl von lebenden Zellen in der Population von normalen Zellen, die nicht mit der Testverbindung behandelt wurden, zeigt eine Testverbindung an, die den Zelltod fördert. Im Gegensatz dazu zeigt eine größere oder gleiche Zahl von lebenden Zellen in der Population von normalen Zellen, die mit der Testverbindung behandelt wurden, im Vergleich zu der Zahl von lebenden Zellen in der Population von normalen Zellen, die nicht mit der Testverbindung behandelt wurden, keine Testverbindung an, die den Zelltod fördert.

Die vorliegende Erfindung ist auch teilweise gerichtet auf Verfahren zum Modulieren der Aktivität eines MLK Proteins umfassend das Inkontaktbringen des Proteins oder einer Zelle enthaltend das Protein mit einer Verbindung mit der Formel G (hier als Formel I bezeichnet), die in dem US Patent Nr. 5,705,511 angegeben ist, das an den Inhaber der vorliegenden Erfindung übertragen wurde und hier in seiner Gesamtheit durch Bezugnahme eingeschlossen ist.

Die vorliegende Erfindung ist auch teilweise auf Verfahren zum Modulieren der Aktivität eines MLK Proteins gerichtet, umfassend das Inkontaktbringen des Proteins oder einer das Protein enthaltenden Zelle mit einer Verbindung mit der Formel III unten:

wobei:

Z1 H ist und Z2 H ist oder Z1 und Z2 zusammen =O bilden,

R1 aus der Gruppe, bestehend aus H, Cl, CH2SO2C2H5, Br, CH2S(CH2)2NH2, CH2S(CH2)2N(CH3)2, CH2S(CH2)2NH2, n-C4H9, NHCONHC6H5, NHCONHC2H5, CH2SC2H5, CH2SC6H5, N(CH3)2, CH3, CH2OCONHC2H5, NHCO2CH3, CH2OC2H5, CH2N(CH3)2, OH, O-n-Propyl, CH=NNH-C(=NH)NH2, CH=N-N(CH3)2, CH2S(CH2)2NH-n-C4H9, CH2OCH2OCH2CH3, CH2S[3-(1,2,4-Triazin)], CH2CH2SCH3 und
ausgewählt ist,

R2 aus der Gruppe, bestehend aus H, Br, Cl, I, CH2S(CH2)2N(CH3)2, NHCONHC2H5, CH2SC2H5, CH2OCH2OCH2CH3, CH2S(3-(1,2,4-Triazin)), CH2CH2SCH3 und CH2OH, ausgewählt ist,

X aus der Gruppe, bestehend aus H, CH2OH, CH2NH-SerinH, CO2CH3, CONHC6H5, CH2NHCO2C6H5, CH2NHCO2CH3, CH2N3, CONHC2H5, CH2NH-Glycin, CON(CH3)2, -CH2NHCO2-, CONH2, CONHC3H7, CH2NH-Serin, CH2SOCH3, CH=NOH, CH2NH-Prolin, CH2CH2(2-Pyridyl), CH=NNHC(=NH)NH2, CONH(CH2)2OH, CH=NNHCONH2, CH2OCOCH3, -CH2OC(CH3)2O-, CH2SC6H5, CH2SOC6H5, CO2n-Hexyl, CONHCH3, CO2(CH2)4CH3; oder einer der folgenden Formeln
ausgewählt ist und

R aus der Gruppe, bestehend aus OH und OCH3, ausgewählt ist.

In bevorzugten Ausführungsformen der Erfindung sind Z1 und Z2 H, X ist CO2CH3, R1 ist NHCONHC2H5, R2 ist CH2CH2(2-Pyridyl) und R ist OH. In anderen bevorzugten Ausführungsformen der Erfindung sind Z1 und Z2 H, X ist CO2CH3; R1 und R2 sind CH2OCH2OCH2CH3 und R ist OH; oder Z1 und Z2 sind H, X ist CO2CH3, R1 und R2 sind CH2SCH2CH3, und R ist OH; oder Z1, Z2, R1 und R2 sind H, X ist CO2CH; und R ist OH; oder Z1, Z2, R1 und R2 sind H, X ist CO2(CH2)4CH3, und R ist OH; oder Z1, Z2 und R1 sind H, R2 ist CH2OH, X ist CO2CH3 und R ist OH; oder Z1 und Z2 sind H, R1 und R2 sind H2S[3-(1,2,4-triazin)], X ist CO2CH2 und R ist OH; oder Z1 und Z2 sind H, R1 ist Br, R2 ist I, X ist CO2CH3; und R ist OH; oder Z1 und Z2 sind H, R1 und R2 sind CH2CH2SCH3, X ist CO2CH3 und R ist OH; oder Z1, Z2, R1 und R2 sind H, X ist CO2CH3 und R ist OCH3; oder Z1 und Z2 bilden zusammen =O, R1 und R2 sind Br, X ist CO2CH3 und R ist OH.

Die vorliegende Erfindung ist zum Teil auch gerichtet auf Verfahren zum Modulieren der Aktivität eines MLK Proteins umfassend Inkontaktbringen des Proteins oder einer das Protein enthaltenden Zelle mit einer Verbindung mit der Formel II unten:

wobei:

Ring B und Ring F unabhängig voneinander und jeder zusammen mit den Kohlenstoffatomen, an die sie gebunden sind, aus der Gruppe, bestehend aus
  • a) einem ungesättigten 6-gliedrigen carbocyclischen aromatischen Ring, in dem 1 bis 3 Kohlenstoffatome durch Stickstoffatome ersetzt sein können,
  • b) einem ungesättigten 5-gliedrigen carbocyclischen aromatischen Ring, und
  • c) einem ungesättigten 5-gliedrigen carbocyclischen aromatischen Ring, in dem entweder
  • 1) ein Kohlenstoffatom durch ein Sauerstoff-, Stickstoff- oder Schwefelatom ersetzt ist,
  • 2) zwei Kohlenstoffatome durch ein Schwefel- und ein Stickstoffatom, ein Sauerstoff- und ein Stickstoffatom oder zwei Stickstoffatome ersetzt sind, oder
  • 3) drei Kohlenstoffatome durch drei Stickstoffatome ersetzt sind,


ausgewählt sind,

R1 aus der Gruppe, bestehend aus
  • a) H, substituiertem oder nicht substituiertem Alkyl mit 1 bis 4 Kohlenstoffen, substituiertem oder nicht substituiertem Aryl, substituiertem oder nicht substituiertem Arylalkyl, substituiertem oder nicht substituiertem Heteroaryl oder substituiertem oder nicht substituiertem Heteroarylalkyl,
  • b) -C(=O)R9, wobei R9 ausgewählt ist aus der Gruppe, bestehend aus Alkyl, Aryl und Heteroaryl,
  • c) -OR10, wobei R10 ausgewählt ist aus der Gruppe, bestehend aus H und Alkyl mit 1 bis 4 Kohlenstoffen,
  • d) -C(=O)NH2, -NR11R12, -(CH2)pNR11R12, -(CH2)pOR10, -O(CH2)pOR10 und -O(CH2)pNR11R12, wobei p 1 bis 4 ist und wobei entweder
  • 1) R11 und R12 jeweils unabhängig voneinander ausgewählt sind aus der Gruppe, bestehend aus H und Alkyl mit 1 bis 4 Kohlenstoffen, oder
  • 2) R11 und R12 zusammen eine Verbindungsgruppe der Formel -(CH2)2-X1-(CH2)2- bilden, wobei X1 ausgewählt ist aus der Gruppe, bestehend aus -O-, -S-, -CH2-,


ausgewählt ist,

R2 aus der Gruppe, bestehend aus H, Alkyl mit 1 bis 4 Kohlenstoffen, -OH, Alkoxy mit 1 bis 4 Kohlenstoffen, -OC(=O)R9, -OC(=O)NR11R12, -O(CH2)pNR12R12, -O(CH2)pOR10, substituiertem oder nicht substituiertem Arylalkyl mit 6 bis 10 Kohlenstoffen und substituiertem und nicht substituiertem Heteroarylalkyl, ausgewählt ist,

R3, R4, R5 und R6 jeweils unabhängig voneinander aus der Gruppe, bestehend aus
  • a) H, Aryl, Heteroaryl, F, Cl, Br, I, -CN, CF3, -NO2, -OH, -OR9, -O(CH2)pNR11R12, -OC(=O)R9, -OC(=O)NR2R7, -OC(=O)NR11R12, -O(CH2)pOR10, -CH2OR10, -NR11R12, -NR10S(=O)2R9, -NR10C(=O)R9,
  • b) -CH2OR14, wobei R14 der Rest einer Aminosäure ist, nachdem die Hydroxylgruppe der Carboxylgruppe entfernt ist,
  • c) -NR10C(=O)NR11R12, -CO2R2, -C(=O)R2, -C(=O)NR11R12, -CH=NOR2, -CH=NR9, -(CH2)pNR11R12, -(CH2)pNHR14 der -CH=NNR2R2A, wobei R2A das Gleiche ist wie R2,
  • d) -S(O)yR2, -(CH2)pS(O)yR9, -CH2S(O)yR14, wobei y 0, 1 oder 2 ist,
  • e) Alkyl mit 1 bis 8 Kohlenstoffen, Alkenyl mit 2 bis 8 Kohlenstoffen und Alkinyl mit 2 bis 8 Kohlenstoffen, wobei
  • 1) jede Alkyl-, Alkenyl- oder Alkinylgruppe nicht substituiert ist oder
  • 2) jede Alkyl-, Alkenyl- oder Alkinylgruppe mit 1 bis 3 Gruppen, ausgewählt aus der Gruppe, bestehend aus Aryl mit 6 bis 10 Kohlenstoffen, Heteroayl, Arylalkoxy, Heterocycloalkoxy, Hydroxyalkoxy, Alkyloxy-Alkoxy, Hydroxyalkylthio, Alkoxy-Alkylthio, F, Cl, Br, I, -CN, -NO2, -OH, -OR9, -X2(CH)pNR11R12, -X2(CN2)pC(=O)NR11R12, -X2(CN2)pOC(=O)NR11R12, -X2(CH2)pCO2R9, -X2(CN2)pS(O)yR9, -X2(CN2)pR10C(=O)NR11R12, -OC(=O)R9, -OCONHR2, -O-Tetrahydropyranyl, -NR11R12, -NR10C(=O)R9, -NR10CO2R9, -NR10C(=O)NR11R12, -NHC(=NH)NH2, NR10S(O)2R9, -S(O)yR9, -CO2R2, -C(=O)NR11R12, -C(=O)R2, -CH2OR10, -CH=NNR2R2A, -CH=NOR2, -CH=NR9, -CH=NNHCH(N=NH)NH2, -S(=O)2NR2R2A, -P(=O)(OR10)2, -OR14 und einem Monosaccharid mit 5 bis 7 Kohlenstoffen, wobei jede Hydroxylgruppe des Monosaccharids unabhängig voneinander entweder nicht substituiert oder durch H, Alkyl mit 1 bis 4 Kohlenstoffen, Alkylcarbonyloxy mit 2 bis 5. Kohlenstoffen oder Alkoxy mit 1 bis 4 Kohlenstoffen ersetzt ist, substituiert ist,


ausgewählt sind,

X2 O, S oder NR10 ist,

R7 und R8 jeweils unabhängig voneinander ausgewählt sind aus der Gruppe, bestehend aus H, Alkyl mit 1 bis 4 Kohlenstoffen, Alkoxy mit 1 bis 4 Kohlenstoffen, substituiertem oder nicht substituiertem Arylalkyl mit 6 bis 10 Kohlenstoffen, substituiertem oder nicht substituiertem Heteroarylalkyl, -(CH2)pOR10, -(CH2)pOC(=O)NR11R12 und -(CH2)pNR11R12 oder R7 und R8 zusammen eine Verbindungsgruppe mit der Formel -CH2-X3-CH2- bilden, wobei X3 X2 oder eine Bindung ist,

m und n jeweils unabhängig voneinander 0, 1 oder 2 sind,

Y aus der Gruppe, bestehend aus -O-, -S-, -N(R10)-, -N+(O)(R10)-, -N(OR10)- und -CH2- ausgewählt ist,

Z aus der Gruppe, bestehend aus einer Bindung, -O-, -CH=CH-, -S-, -C(=O)-, -CH(OR10)-, -N(R10)-, -N(OR10)-, -CH(NR11R12)-, -C(=O)N(R17)-, -N(R17)C(=O)-, -N(S(O)yR9)-, -N(S(O)yNR11R12)-, -N(C(=O)R17)-, -C(R15R16)-, -N+(O)(R10)-, -CH(OH)-CH(OH)- und -CH(O(C=O)R9)CH(OC(=O)R9A)-, ausgewählt ist, wobei R9A das Gleiche wie R9 ist,

R15 und R16 unabhängig voneinander aus der Gruppe, bestehend aus H, -OH, -C(=O)R10, -O(C=O)R9, Hydroxyalkyl und -CO2R10, ausgewählt sind,

R17 aus der Gruppe, bestehend aus H, Alkyl, Aryl und Heteroaryl, ausgewählt ist,

A1 und A2 aus der Gruppe, bestehend aus H, H; H, OR2; H, -SR2; H, -N(R2)2 und einer Gruppe, in der A1 und A2 zusammen eine Einheit, ausgewählt aus der Gruppe, bestehend aus =O, =S und =NR2 bilden, ausgewählt sind,

B1 und B2 aus der Gruppe, bestehend aus H, H; H, -OR2; H, -SR2; H, -N(R2)2 und einer Gruppe, in der B1 und B2 zusammen eine Einheit, ausgewählt aus der Gruppe, bestehend aus =O, =S und =NR2 bilden, ausgewählt sind,

mit der Maßgabe, dass mindestens eines der Paare A1 und A2 oder B1 und B2 =O bilden.

Die vorliegende Erfindung ist zum Teil auch gerichtet auf Verfahren zum Modulieren der Aktivität eines MLK Proteins, umfassend das Inkontaktbringen des Proteins oder einer das Protein enthaltenden Zelle mit einer Verbindung mit der Formel IV unten:

wobei:

Z1 H ist und Z2 H ist oder Z1 und Z2 zusammen =O bilden,

R1 H oder Br ist,

R2 H ist,

R3 H, CH2CH=CH2, CH2CH2CH2OH oder
und

R4 H, CH2CH=CH2 oder CH2CH2CH2OH ist.

In bevorzugten Ausführungsformen der Erfindung sind R1, R2, R4, Z1 und Z2 H und R3 ist CH2CH=CH2. In anderen bevorzugten Ausführungsformen der Erfindung ist R1 Br und R2, R3, R4, Z1 und Z2 sind H; oder R1, R2, Z1 und Z2 sind H und R3 und R4 sind CH2CH=CH2; oder R1, R2, R3, Z1 und Z2 sind H und R4 ist CH2CH=CH2; oder R1, R2, Z1 und Z2 sind H und R3 und R4 sind CH2CH2CH2OH; oder R1, R2, R4, Z1 und Z2 sind H und R3 ist

Die vorliegende Erfindung stellt auch Verfahren zum Identifizieren von Verbindungen bereit, die in der Behandlung von neurodegenerativen Störungen verwendbar sein können, umfassend das Inkontaktbringen einer Zelle oder eines Zellextraktes enthaltend ein Multiple Lineage Kinase-Protein mit der Verbindung und das Bestimmen, ob die Verbindung die Aktivität des Multiple Lineage Kinase-Proteins verringert. Die Zellen und die Extrakte davon schließen die oben beschriebenen ein. Verbindungen, die durch die vorliegenden Verfahren gefunden werden (d.h. jene Verbindungen, welche die Aktivität eines Multiple Lineage Kinase-Proteins inhibieren oder verringern) können verwendbar sein, um neurodegenerative Störungen zu behandeln. Das Protein ist vorzugsweise aus der Gruppe, bestehend aus Multiple Lineage Kinase 1, Multiple Lineage Kinase 2, Multiple Lineage Kinase 3, Leucin-Zippen aufweisende Kinase, zweifachen Leucin-Zippen aufweisende Kinease und Multiple Lineage Kinase 6, ausgewählt. Die Zelle wird in vitro in Kontakt gebracht. Vorzugsweise wird die Proteinaktivität bestimmt durch das Messen der Aktivität oder des Phosphorylierungszustandes eines Substrates des Proteins. Vorzugsweise ist das Substrat aus der Gruppe, bestehend aus JNK1, JNK2, JNK3, ERK1, ERK2, p38&agr;, p38&bgr;, p38&ggr;, p38&dgr;, MEK1, MEK2, MKK3, MKK4 (SEK1), MEK5, MKK6, MKK7, jun, ATF2, ELK1 und das Säuger-Homolog von AEX-3, ausgewählt, ebenso wie allgemeine Ser/Thr Substrate, wie zum Beispiel das Myelin basische Protein (MBP). Die Proteinaktivität kann auch bestimmt werden durch das Messen der Aktivität eines Substrats des Proteins, der Menge eines Substrats des Proteins oder der mRNA, die das Substrat des Proteins kodiert. Die Proteinaktivität kann auch durch einen in vitro Kinaseassay oder Bindungsassay bestimmt werden. Die Zellen sind vorzugsweise primäre embryonale motorische neuronale Zellen, Zellen die ein Multiple Lineage Kinase-Protein überexprimieren oder eine neuronale Zelle, aber sie können irgendeine Zelle oder Extrakt davon sein. Vorzugsweise werden Verbindungen, die direkt das Multiple Lineage Kinase-Protein binden, identifiziert, wie oben beschrieben.

Die vorliegende Erfindung stellt auch Verfahren zum Identifizieren von Verbindungen bereit, die verwendbar sein können in der Behandlung von Entzündung, umfassend das Inkontaktbringen einer Zelle oder eines Zellextraktes enthaltend ein Multiple Lineage Kinase-Protein mit der Verbindung und das Bestimmen, ob die Verbindung die Aktivität des Multiple Lineage Kinase-Proteins verringert. Die Zellen und die Extrakte daraus schließen die oben beschriebenen ein. Verbindungen, die durch die vorliegenden Verfahren gefunden werden (d.h. jene Verbindungen, welche die Aktivität eines Multiple Lineage Kinase-Proteins inhibieren oder verringern) können verwendbar sein, um Entzündung zu behandeln. Das Protein ist vorzugsweise aus der Gruppe bestehend aus Multiple Lineage Kinase 1, Multiple Lineage Kinase 2, Multiple Lineage Kinase 3, Leucin-Zipper aufweisende Kinase, zweifachen Leucin-Zippen aufweisende Kinase und Multiple Lineage Kinase 6, ausgewählt. Die Zelle wird in vitro in Kontakt gebracht. Vorzugsweise wird die Proteinaktivität bestimmt durch das Messen der Aktivität oder des Phosphorylierungszustandes eines Substrats des Proteins. Vorzugsweise ist das Substrat aus der Gruppe, bestehend aus JNK1, JNK2, JNK3, ERK1, ERK2, p38&agr;, p38&bgr;, p38&ggr;, p38&dgr;, MEK1, MEK2, MKK3, MKK4 (SEK1), MEK5, MKK6, MKK7, jun, ATF2, ELK1 und das Säuger-Homolog von AEX-3, ausgewählt, ebenso wie allgemeine Ser/Thr Substrate, wie zum Beispiel das Myelin basische Protein (MBP). Die Proteinaktivität kann auch bestimmt werden durch das Messen der Aktivität eines Substrats des Proteins, der Menge eines Substrats des Proteins oder der mRNA, die das Substrat des Proteins kodiert. Die Proteinaktivität kann auch durch einen in vitro Kinaseassay oder Bindungsassay bestimmt werden.

Die Zellen sind vorzugsweise primäre embryonale motorische neuronale Zellen, Zellen, die ein Multiple Lineage Kinase-Protein überexprimieren oder eine neuronale Zelle, aber sie können irgendeine Zelle oder Extrakt davon sein. Die Zellen schließen auch ein, aber sie nicht beschränkt auf jene, die in Entzündung involviert sind, wie zum Beispiel Lymphozyten, Makrophagen und andere weiße Blutzellen, die dem Fachmann gut bekannt sind. Vorzugsweise werden Verbindungen identifiziert, die das Multiple Lineage Kinase-Protein direkt binden.

Die vorliegende Erfindung stellt auch Verfahren zum Behandeln eines Säugers bereit, der eine neurodegenerative Störung aufweist oder im Verdacht steht, sie aufzuweisen, umfassend das Verabreichen einer Verbindung an den Säuger, die Multiple Lineage Kinase-Proteinaktivität inhibiert oder verringert. Eine Verbindung, welche die Multiple Lineage Kinase-Proteinaktivität inhibiert oder verringert, schließt ein, aber ist nicht beschränkt auf Verbindungen mit der Formel I, II, III und IV. Bevorzugte Verbindungen schließen jene ein, die oben bezüglich dem Verfahren zum Screenen von Verbindungen beschrieben sind, welche die Aktivität eines Multiple Lineage Kinase-Proteins modulieren und entweder das Zellüberleben oder den Zelltod fördern. Ein bevorzugter Säuger ist ein Mensch. Eine Person kann unter dem Verdacht stehen, eine neurodegenerative Erkrankung aufzuweisen, wenn die Person Symptome einer besonderen neurodegenerativen Erkrankung aufweist, sich in einer Hochrisikogruppe befindet oder eine Familiengeschichte einer neurodegenerativen Erkrankung aufweist.

Die vorliegende Erfindung stellt auch Verfahren zum Behandeln eines Säugers bereit, der eine Entzündung aufweist, umfassend das Verabreichen an den Säuger einer Verbindung, welche die Multiple Lineage Kinase-Proteinaktivität inhibiert oder verringert. Eine Verbindung, welche die Multiple Lineage Kinase-Proteinaktivität inhibiert oder verringert, schließt ein, aber ist nicht beschränkt auf Verbindungen mit der Formel I, II, III und IV. Bevorzugte Verbindungen schließen jene ein, die oben beschrieben wurden bezüglich des Verfahrens zum Screenen von Verbindungen, welche die Aktivität eines Multiple Lineage Kinase-Proteins modulieren und entweder das Zellüberleben oder den Zelltod fördern. Ein bevorzugter Säuger ist ein Mensch.

Das Inkontaktbringen mit Verbindungen mit den Formeln I–IV kann in Puffern oder Medien stattfinden, die dem Fachmann gut bekannt sind. Alternativ dazu kann das Inkontaktbringen stattfinden durch das Verabreichen einer pharmazeutischen Zusammensetzung, welche die Testverbindung und ein pharmazeutisch verträgliches Salz, Träger oder Verdünnungsmittel enthält, an ein geeignetes Tier oder Säuger, wie zum Beispiel eine Maus oder ein anderes geeignetes Tier, das dem Fachmann bekannt ist. Zusätzlich können verschiedene Zahlen von Zellen und Konzentrationen von Verbindungen verwendet werden. Die Zellen, die mit den Testverbindungen in Kontakt gebracht werden, können irgendeine Säugerzelle sein. Vorzugsweise ist die Zelle eine neuronale Zelle. Vorzugsweise ist die Zelle in eine neurodegenerative Erkrankung, wie zum Beispiel Alzheimersche Erkrankung, motorische neuronale Erkrankung, amyotrophe laterale Sklerose, Parkinsonsche Erkrankung, zerebrovaskuläre Erkrankung, ischämische Zustände, AIDS Demenz, Epilepsie, Huntingtonsche Erkrankung und konkussive oder penetrierende Verletzungen des Gehirns oder Rückenmarkes, involviert. Verbindungen mit Formel I und Verfahren zur Herstellung derselben, sind in dem US Patent 5,705,511 beschreiben, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist. Verbindungen mit der Formel III und Verfahren zu ihrer Herstellung sind in den US Patenten 5,741,808, 5,621,100, 5,621,101, 5,461,146 und 5,756,494 und WO97/46567 beschrieben, von denen jede hier durch Bezugnahme in ihrer Gesamtheit eingeschlossen ist. Verbindungen mit der Formel IV und Verfahren zur Herstellung derselben sind in den US Patenten 5,741,808, 5,621,100, 5,621,101, 5,461,146 und 5,756,494 und WO 97/46567 beschrieben, von denen jede hier durch Bezugnahme in ihrer Gesamtheit eingeschlossen ist.

Verbindungen mit der Formel II schließen Diastereomere und Enantiomere um die Kohlenstoffatome ein, an welche die Substituenten R2, R7 und R8 angeheftet sind.

Bevorzugte überbrückte Indenopyrrolocarbazole sind durch die Formel II dargestellt:

In einigen bevorzugten Ausführungsformen der Verbindungen der Formel II ist R1 H. In weiteren bevorzugten Ausführungsformen ist R2 H, Hydroxyl oder substituiertes oder nicht substituiertes Alkyl.

In anderen bevorzugten Ausführungsformen sind R3, R4, R5 und R6 unabhängig voneinander H, substituiertes oder nicht substituiertes Alkyl, Halogen, substituiertes oder nicht substituiertes Alkoxy, substituiertes oder nicht substituiertes Amino oder substituiertes oder nicht substituiertes Aryl. In weiteren bevorzugten Ausführungsformen sind R7 und R8 unabhängig voneinander H oder substituiertes oder nicht substituiertes Alkyl.

In einigen bevorzugten Ausführungsformen ist Y O. In weiteren bevorzugten Ausführungsformen ist Z eine Bindung, O, S oder substituiertes oder nicht substituiertes N. In noch weiteren bevorzugten Ausführungsformen sind m und n unabhängig voneinander 1 oder 2. In einigen besonders bevorzugten Ausführungsformen ist Y O, Z ist eine Bindung oder O und m und n sind unabhängig voneinander 1 oder 2.

In weiteren bevorzugten Ausführungsformen sind A1A2 und B1B2 =O oder H,H.

In einigen besonders bevorzugten Ausführungsformen sind R1, R4, R6 und R7 jeweils N, Y ist =O, n ist 1, A1A2 und B1B2 sind =O oder H,H, R2 ist H, OH oder Niederalkyl, R3 ist H oder substituiertes Alkyl, R5 und R6 sind jeweils H oder Alkoxy, wobei Methoxy bevorzugt ist, Z ist eine Bindung oder O und m ist 1 oder 2.

Einige besonders bevorzugte Ausführungsformen der Verbindungen der Formel II sind die Verbindungen II-1, II-2, II-3, II-4a, II-4b, II-5, II-6, II-7a, II-7b, II-8, II-9, II– 10, II-11 und II-12, die in der Tabelle 1, infra angegeben sind.

Die Verbindungen, die durch Formel II dargestellt sind, werden im Folgenden als Verbindung (II) bezeichnet.

So wie hier verwendet, bedeutet der Begriff "carbocyclisch" cyclische Gruppen, in denen der Ringabschnitt nur aus Kohlenstoffatomen zusammengesetzt ist. Die Begriffe "heterocyclo" und "heterocyclisch" betreffen cyclische Gruppen, in denen der Ringabschnitt mindestens ein Heteroatom, wie O, N oder S einschließt.

So wie hier verwendet, bedeutet der Begriff "Alkyl" gerade Ketten, cyclische oder verzweigte Alkylgruppen mit 1 bis 8 Kohlenstoffatomen, wie Methyl, Ethyl, Propyl, Isopropyl, Butyl, Isobutyl, sec-Butyl, tert-Butyl, Pentyl, Isoamyl, Neopentyl, 1-Ethylpropyl, Hexyl, Octyl, Cyclopropyl und Cyclopentyl. Der Alkylrest von Alkyl enthaltenden Gruppen, wie Alkoxy, Alkoxycarbonyl und Alkylaminocarbonylgruppen besitzt dieselbe Bedeutung wie das oben definierte Alkyl. Niederalkylgruppen, die bevorzugt sind, sind Alkylgruppen, wie oben definiert, die 1 bis 4 Kohlenstoffe enthalten. Der Begriff "Alkenyl" soll gerade Ketten oder verzweigte Kohlenwasserstoffketten mit mindestens einer Kohlenstoff-Kohlenstoff Doppelbindung einschließen. Beispiele von Alkenylgruppen schließen Ethenyl und Propenylgruppen ein. So wie hier verwendet, soll der Begriff "Alkinyl" gerade Ketten oder verzweigte Kohlenwasserstoffketten mit mindestens einer Kohlenstoff-Kohlenstoff Dreifachbindung einschließen. Beispiele von Alkinylgruppen schließen Ethynyl und Propynylgruppen ein.

Der Acylrest von Acyl enthaltenden Gruppen, wie Acyloxygruppen soll eine gerade Kette oder eine verzweigte Alkanoylgruppe mit 1 bis 6 Kohlenstoffatomen, wie Formyl, Acetyl, Propanoyl, Butyryl, Valeryl, Pivaloyl oder Hexanoyl einschließen.

So wie hier verwendet, bedeutet der Begriff "Aryl" eine Gruppe mit 6 bis 12 Kohlenstoffatomen, wie Phenyl, Biphenyl und Naphthyl. Bevorzugte Arylgruppen schließen nicht substituierte oder substituierte Phenyl- und Naphthylgruppen ein. Der Begriff "Heteroaryl", so wie hier verwendet, bezeichnet eine Arylgruppe, in der eines oder mehrere Ringkohlenstoffatom(e) durch ein Hetero (d.h. nicht Kohlenstoff) Atom, wie O, N oder S ersetzt ist. Bevorzugte Heteroarylgruppen schließen Pyridyl, Pyrimidyl, Pyrrolyl, Furyl, Thienyl, Imidazolyl, Triazolyl, Tetrazolyl, Chinolyl, Isochinolyl, Benzoimidazolyl, Thiazolyl, Pyrazolyl und Benzothiazolylgruppen ein.

Der Begriff "Aralkyl" (oder "Arylalkyl") soll eine Gruppe mit von 7 bis 15 Kohlenstoffen bezeichnen, die aus einer Alkylgruppe bestehen, die eine Arylgruppe aufweist. Beispiele von Aralkylgruppen schließen Benzyl, Phenethyl, Benzhydryl und Naphthylmethylgruppen ein.

Alkylgruppen und Alkylreste, die innerhalb von Substituentengruppen enthalten sind, wie Aralkyl, Alkoxy, Arylalkoxy, Hydroxyalkoxy, Alkoxy-Alkoxy, Hydroxy-Alkylthio, Alkoxy-Alkylthio, Alkylcarbonyloxy, Hydroxyalkyl und Acyloxygruppen können substituiert oder nicht substituiert sein. Ein substituierte Alkylgruppe weist 1 bis 3 unabhängig ausgewählte Substituenten auf, vorzugsweise Hydroxy, Niederalkyl, Niederalkoxy-Alkoxy, substituiertes oder nicht substituiertes Arylalkoxy-Niederalkoxy, substituiertes oder nicht substituiertes Heteroarylalkoxy-Niederalkoxy, substituiertes oder nicht substituiertes Arylalkoxy, substituiertes oder nicht substituiertes Heterocycloalkoxy, Halogen, Carboxyl, Niederalkoxycarbonyl, Nitro, Amino, mono- oder di-Niederalkylamino, Dioxolan, Dioxan, Dithiolan, Dithion, Furan, Lacton oder Lactam.

Substituierte Aryl-, substituierte Heteroaryl- und substituierte Aralkylgruppen weisen jeweils 1 bis 3 unabhängig ausgewählte Substituenten auf, die vorzugsweise Niederalkyl, Hydroxy, Niederalkoxy, Carboxy, Niederalkoxycarbonyl, Nitro, Amino, mono- oder di-Niederalkylamino und Halogen sind.

Heterocyclische Gruppen, die mit einem Stickstoffatom gebildet werden, schließen Pyrrolidinyl, Piperidinyl, Piperidino, Morpholinyl, Morpholino, Thiomorpholino, N-Methylpiperazinyl, Indolyl, Isoindolyl, Imidazol, Imidazolin, Oxazolin, Oxazol, Triazol, Thiazolin, Thiazol, Pyrazol, Pyrazolon und Triazolgruppen ein. Heterocyclische Gruppen, die mit einem Sauerstoffatom gebildet werden, schließen Furan, Tetrahydrofuran, Pyran und Tetrahydropyrangruppen ein.

"Hydroxyalkyl" Gruppen sind Alkylgruppen, die eine Hydroxylgruppe daran angehängt aufweisen. Halogene schließen Fluor, Chlor, Brom und Iod ein.

So wie hier verwendet, bedeutet der Begriff "Heteroarylalkyl" eine Arylalkylgruppe, die ein Heteroatom enthält. Der Begriff "Oxy" bezeichnet die Anwesenheit eines Sauerstoffatoms. So sind "Alkoxy" Gruppen Alkylgruppen, die durch ein Sauerstoffatom verbunden sind, und "Carbonyloxy" Gruppen sind Carbonylgruppen, die durch ein Sauerstoffatom verbunden sind.

Der Begriff "Heterocycloalkoxy" bezeichnet eine Alkoxygruppe, die eine Heterocyclogruppe angeheftet an den Alkylrest davon, aufweist, und der Begriff "Arylalkoxy" bedeutet eine Alkoxygruppe, die eine Arylgruppe, angeheftet an den Alkylrest davon, aufweist. Der Begriff "Alkylcarbonyloxy" bedeutet eine Gruppe der Formel -O-C(=O)-Alkyl.

So wie hier verwendet, bezeichnet der Begriff "Alkyloxy-Alkoxy" eine Alkoxygruppe, die einen Alkyloxy Substituenten angeheftet an seinen Alkylrest enthält. Der Begriff "Alkoxy-Alkylthio" bedeutet eine Alkylthiogruppe (d.h. eine Gruppe der Formel -S-Alkyl), die einen Alkoxy Substituenten angeheftet an ihren Alkylrest enthält. Der Begriff "Hydroxy-Alkylthio" bedeutet einen Alkoxy Substituenten, der an seinen Alkylrest angeheftet ist. Der Begriff "Hydroxyalkylthio" bedeutet eine Alkylthiogruppe (d.h. eine Gruppe der Formel -S-Alkyl), die einen Hydroxy Substituenten angeheftet an ihren Alkylrest enthält.

So wie hier verwendet, weist der Begriff "Monosaccharid" seine gewöhnliche Bedeutung als ein einfacher Zucker auf.

So wie hier verwendet, bezeichnet der Begriff "Aminosäure" ein Molekül, das sowohl eine Aminogruppe als auch eine Carboxylgruppe enthält. Ausführungsformen von Aminosäuren schließen &agr;-Aminosäuren, d.h. Carbonsäuren der allgemeinen Formel HOOC-CH(NH2)-(Seitenkette) ein.

Seitenketten von Aminosäuren schließen natürlich vorkommende und nicht natürlich vorkommende Reste ein. Nicht natürlich vorkommende (d.h. unnatürliche) Aminosäure Seitenketten sind Reste, die anstelle von natürlich vorkommenden Aminosäure Seitenketten in beispielsweise Aminosäureanaloga verwendet werden. Siehe zum Beispiel Lehninger, Biochemistry, Zweite Auflage, Worth Publishers, Inc., 1975, Seiten 73–75, hier durch Bezugnahme eingeschlossen.

Bevorzugte &agr;-Aminosäuren schließen Glycin, Alanin, Prolin, Glutaminsäure und Lysin mit der D Konfiguration, der L Konfiguration oder als ein Racemat ein.

Die Seitenketten von weiteren repräsentativen &agr;-Aminosäuren sind unten in Tabelle 1 gezeigt.

Tabelle 1

In einigen bevorzugten Ausführungsformen schließen Substituentengruppen für die Verbindungen der Formel II den Rest einer Aminosäure nach dem Entfernen des Hydroxylrests in der Carboxylgruppe davon ein; d.h. Gruppen der Formel -C(=O)-CH(NH2)-(Seitenkette).

Funktionelle Gruppen, die in den Verbindungen der Formel II anwesend sind, können Schutzgruppen enthalten. Zum Beispiel können die Aminosäure Seitenketten Substituenten der Verbindungen der Formel II mit Schutzgruppen, wie Benzyloxycarbonyl oder t-Butoxycarbonylgruppen geschützt sein. Schutzgruppen sind per se als chemische funktionelle Gruppen bekannt, die selektiv an Funktionalitäten, wie Hydroxylgruppen und Carboxylgruppen angehängt oder entfernt werden können. Diese Gruppen sind in einer chemischen Verbindung anwesend, um eine solche Funktionalität inert gegenüber chemischen Reaktionsbedingungen zu machen, denen die Verbindung ausgesetzt ist. Irgendeine einer Vielzahl von Schutzgruppen kann in der vorliegenden Erfindung verwendet werden. Eine solche Schutzgruppe ist die Benzyloxycarbonyl (Cbz; Z) Gruppe. Andere erfindungsgemäße bevorzugte Schutzgruppen können gefunden werden in Greene, T. W. und Wuts, P. G. M., "Protective Groups in Organic Synthesis", 2. Aufl., Wiley & Sons, 1991.

Die überbrückten Indenopyrrolocarbazol Verbindungen haben wichtige funktionelle pharmakologische Aktivitäten bewiesen, die nützlich sind in einer Vielzahl von Umgebungen, einschließlich sowohl Forschungs- und therapeutischen Bereichen. Diese Derivate sind als therapeutische Mittel verwendbar. Die Aktivitäten der Verbindungen zeigen positive Wirkungen auf die Funktion und/oder das Überleben von trophischem Faktor responsiven Zellen. Die Wirkung auf die Funktion und/oder das Überleben von trophischen Faktor responsiven Zellen, z.B. Zellen einer neuronalen Linie, wurde unter Verwendung eines der folgenden Assays gezeigt: (1) kultivierter Rückenmarkscholinacetyltransferase ("ChAT") Assay; oder (2) kultivierter basaler Vorderhirnneuron ChAT Aktivitätsassay.

So wie hier verwendet, bedeutet der Begriff "bewirken" wenn er verwendet wird, um die Begriffe "Funktion" und "das Überleben" zu modifizieren, eine positive oder negative Änderung oder Veränderung. Eine Wirkung, die positiv ist, kann hier als eine "Verstärkung" oder "das Verstärken" bezeichnet werden, und eine Wirkung, die negativ ist, kann hier als eine "Inhibierung" oder "das Inhibieren" bezeichnet werden.

So wie hier verwendet, bedeuten die Begriffe "Verstärken" oder "das Verstärken", wenn sie verwendet werden, um die Begriffe "Funktion" oder "das Überleben" zu modifizieren, dass die Anwesenheit einer überbrückten Indenopyrrolocarbazol Verbindung eine positive Wirkung auf die Funktion und/oder das Überleben einer trophischen Faktor responsiven Zelle im Vergleich zu einer Zelle in der Abwesenheit der Verbindung aufweist. Zum Beispiel, und nicht als Einschränkung, bezüglich dem Überleben von z.B. einem cholinergen Neuron, würde die Verbindung Verstärkung des Überlebens einer cholinergen neuronalen Population, die ein Risiko hat zu sterben, (aufgrund von z.B. Verletzung, einem Erkrankungszustand, einem degenerativen Zustand oder natürlicher Progression) beweisen, wenn sie mit einer cholinergen neuronalen Population verglichen wird, die nicht mit einer solchen Verbindung in Kontakt kam, wenn die behandelte Population einen vergleichsweise größeren Zeitraum der Funktionalität als die nicht behandelte Population aufweist.

So wie hier verwendet bedeutet "Inhibieren" und "Inhibierung", dass eine einzelne Antwort eines bestimmten Materials (z.B. enzymatische Aktivität) vergleichsweise verringert ist in der Anwesenheit einer überbrückten Indenopyrrolocarbazol Verbindung.

So wie hier verwendet betrifft der Begriff "trk" eine Familie von Hochaffinitätsneurotrophin Rezeptoren, die gegenwärtig trkA, trkB und trkC und andere Membran assoziierte Proteine, an die ein Neurotrophin binden kann, umfasst.

So wie hier verwendet, impliziert die Inhibierung von VEGFR Verwendbarkeit in beispielsweise Erkrankungen, wo Angiogenese wichtige Rollen spielt, wie Krebs von festen Tumoren, Endometriosis, diabetische Retinopathie, Psoriasis, Hämangioblastom, ebenso wie andere okulare Erkrankungen und Krebsarten.

Die Inhibierung von trk impliziert Verwendbarkeit in zum Beispiel Erkrankungen der Prostata, wie Prostatakrebs und gutartige Prostatahyperplasie und Behandlung von Entzündungsschmerz.

Die Inhibierung des von Plättchen abgeleiteten Wachstumsfaktor Rezeptor (PDGFR) impliziert Verwendbarkeit in beispielsweise verschiedenen Formen von Neoplasie, rheumatoider Arthritis, pulmonarer Fibrose, Myelofibrose, abnormaler Wundheilung, Erkrankungen mit kardiovaskulären Endpunkten, wie Arteriosklerose, Restenose, Postangioplastierestenose, etc.

So wie hier verwendet betreffen die Begriffe "Krebs" und "krebsartig" irgendeine bösartige Proliferation von Zellen in einem Säuger. Beispiele schließen Prostata, gutartige Prostatahyperplasie, Ovar, Brust, Gehirn, Lunge, Bauchspeicheldrüse, kolorektal, gastrisch, Magen, feste Tumoren, Kopf und Hals, Neuroblastom, Nierenzellkarzinom, Lymphom, Leukämie und andere erkannte bösartige Erkrankungen des hämatopoetischen Systems und andere erkannte Krebsarten, ein.

So wie hier verwendet schließen die Begriffe "Neuron", "Zelle einer neuronalen Linie" und "neuronale Zelle" ein, aber sind nicht beschränkt auf eine heterogene Population von neuronalen Typen mit singulären oder multiplen Transmittern und/oder singulären oder multiplen Funktionen; vorzugsweise sind dies cholinerge und sensorische Neurone. So wie hier verwendet, bedeutet der Ausdruck "cholinerges Neuron" Neuronen des zentralen Nervensystems (ZNS) und des peripheren Nervensystems (PNS), deren Neurotransmitter Acetylcholin ist; beispielhaft sind basale Vorderhirn-, Striatal- und Rückenmarksneurone. So wie hier verwendet schließt der Ausdruck "sensorisches Neuron" Neurone ein, die auf Umweltauslöser (z.B. Temperatur, Bewegung) von z.B. Haut, Muskel und Gelenken antworten; exemplarisch ist ein Neuron vom dorsalen Wurzelganglion.

Eine "trophische Faktor responsive Zelle", so wie hier definiert, ist eine Zelle, die einen Rezeptor einschließt, an den ein trophischer Faktor spezifisch binden kann; Beispiele schließen Neurone (z.B. cholinerge und sensorische Neurone) und nicht neuronale Zellen (z.B. Monozyten und neoplastische Zellen) ein.

Die hier beschriebenen überbrückten Indenopyrrolocarbazol Verbindungen sind verwendbar sowohl in Forschungs- als auch in therapeutischen Umgebungen, in beispielsweise der Inhibition von enzymatischer Aktivität. Zum Beispiel können die Verbindungen in einer Forschungsumgebung in der Entwicklung von Assays und Modellen zur weiteren Verbesserung des Verstehens der Rollen verwendet werden, die Inhibierung von Serin/Threonin. oder Tyrosin Proteinkinase (z.B. PKC, trk Tyrosinkinase) in den mechanistischen Aspekten der assoziierten Störungen und Erkrankungen spielen. In einer therapeutischen Umgebung können diese Verbindungen, die diese enzymatischen Aktivitäten inhibieren, verwendet werden, um die zerstörerischen Konsequenzen dieser Enzyme bezüglich der Störungen, wie Krebs, zu inhibieren.

Wie die Beispiele unten zeigen, kann die Inhibierung von enzymatischer Aktivität unter Verwendung der überbrückten Indenopyrrolocarbazol Verbindungen unter Verwendung von beispielsweise den folgenden Assays bestimmt werden:

  • 1. trkA Tyrosin Kinase Inhibierungsassay;
  • 2. Inhibierung von NGF stimulierter trk Phosphorylierung in einer Gesamtzellpräparation;
  • 3. vaskulärer endothelialer Wachstumsfaktor Rezeptor (VEGFR) Kinase Inhibierungsassay;
  • 4. PKC Aktivitätsinhibierungsassay;
  • 5. PDGFR Inhibierungsassay.

Die offenbarten überbrückten Indenopyrrolocarbazol Verbindungen können verwendet werden, um die Funktion und/oder das Überleben von Zellen von neuronalen Linien in einem Säugetier, z.B. einem Menschen zu verstärken. In diesem Zusammenhang können die Verbindungen einzeln oder fusioniert mit anderen Pyrrolocarbazolen und/oder Indolocarbazolen oder in Kombination mit anderen vorteilhaften Molekülen verwendet werden, die auch die Fähigkeit die Funktion und/oder das Überleben einer bestimmten Zelle zu bewirken, beweisen.

Eine Vielzahl von neurologischen Störungen ist gekennzeichnet durch neuronale Zellen, die sterben, verletzt sind, funktionell eingeschränkt sind, axonale Degeneration durchlaufen, ein Risiko haben zu sterben, etc. Diese Störungen schließen ein, aber sind nicht beschränkt auf: Alzheimersche Erkrankung, motorische Neuronenstörungen (z.B. amyotrophische laterale Sklerose); Parkinsonsche Erkrankung, zerebrovaskuläre Störungen (z.B. Schlaganfall, Ischämie); Huntingtonsche Erkrankung; AIDS Demenz; Epilepsie; Multiple Sklerose; periphere Neuropathien (z.B. jene, die DRG Neurone in Chemotherapie assoziierter peripherer Neuropathie beeinflussen) einschließlich diabetischer Neuropathie; Störungen, die durch exzitatorische Aminosäure induziert werden; und Störungen, die mit konkussiven oder penetrierenden Verletzungen des Gehirns oder des Rückenmarks assoziiert sind.

ChAT katalysiert die Synthese des Neurotransmitters Acetylcholin und es wird als ein enzymatischer Marken für ein funktionelles cholinerges Neuron erachtet. Ein funktionales Neuron ist auch in der Lage zu überleben. Neuronales Überleben wird durch Quantifizierung der spezifischen Aufnahme und enzymatischen Umwandlung eines Farbstoffs (z.B. Calcein AM) durch lebende Neurone untersucht.

Aufgrund ihrer verschiedenen Verwendbarkeiten sind die hier beschriebenen Verbindungen, einschließlich jener Verbindungen, die durch die hier beschriebenen Verfahren identifiziert werden, in einer Vielzahl von Umgebungen verwendbar. Diese Verbindungen können in der Entwicklung von in vitro Modellen von neuronalem Zellüberleben, Funktion, Identifizierung oder für das Screenen von anderen synthetischen Verbindungen, die Aktivitäten ähnlich jener der hier beschriebenen Verbindungen aufweisen, oder Verbindungen, die durch die hier beschriebenen Verfahren Identifiziert werden, verwendet werden. Die hier beschriebenen Verbindungen, ebenso wie jene, die unter Verwendung der hier beschriebenen Verfahren identifiziert werden, können in einer Forschungsumgebung verwendet werden, um molekulare Ziele, die mit funktionellen Antworten assoziiert sind, zu untersuchen, zu definieren und zu bestimmen. Zum Beispiel durch radioaktive Markierung einer überbrückten Indenopyrrolocarbazol Verbindung oder einer Verbindung, die durch die hier beschriebenen Verfahren identifiziert wird, die mit einer spezifischen zellulären Funktion (z.B. Mitogenese) assoziiert ist, die Zieleinheit, an die das Derivat bindet, identifiziert, isoliert und für die Charakterisierung gereinigt werden.

Die Verbindungen, jene die hier beschrieben sind ebenso wie jene, die durch die hier beschriebenen Verfahren identifiziert werden, sind verwendbar, inter alia, nicht nur zum Verstärken von trophischen Faktor induzierten Aktivitäten von trophisch responsiven Zellen, z.B. cholinergen Neuronen, sondern sie können auch als überlebensfördernde Agenzien für andere neuronale Zelltypen, z.B. dopaminerge oder glutamaterge diene. Wachstumsfaktoren können das Überleben von Neuronen durch Signalkaskaden unterhalb der kleinen GTP bindenden Proteine regulieren, die einschließen, aber nicht beschränkt sind auf ras, rac und cdc42 (Denhardt, Biochem. J., 1996, 318, 729). Insbesondere führt die Aktivierung von ras zu Phosphorylierung und Aktivierung von extrazellulärer Rezeptor aktivierter Kinase (ERK), die mit biologischem Wachstum und Differenzierungsvorgängen in Verbindung gebracht wurde. Die Stimulierung von rac/cdc42 führt zu einem Anstieg in der Aktivierung von JNK und p38, Antworten, die mit Stress, Apoptose und Entzündung assoziiert sind. Obwohl Wachstumsfaktorantworten primär über den ERK Weg verlaufen, kann das Beeinflussen dieser letztgenannten Vorgänge zu alternativen Mechanismen des neuronalen Überlebens führen, die Wachstumsfaktor verstärkende Überlebenseigenschaften nachahmen können (Xia et al., Science, 1995, 270, 1326). Die Verbindungen können auch als überlebensfördernde Agenzien für neuronale und nicht neuronale Zellen durch Mechanismen wirken, die verwandt sind mit aber verschieden sind von Wachstumsfaktor vermitteltem Überleben, zum Beispiel Inhibierung der JNK und p38 Wege, die zum Überleben durch Inhibierung von apoptotischen Zelltodvorgängen führen können.

Die vorliegenden Verbindungen sind verwendbar in der Behandlung von Störungen, die mit verringerter ChAT Aktivität oder dem Tod, der Verletzung von motorischen Neuronen des Rückenmarks assoziiert sind, und sie weisen auch Verwendbarkeit in beispielsweise Erkrankungen auf, die mit apoptotischem Zelltod des zentralen und peripheren Nervensystems, des Immunsystems und in entzündlichen Erkrankungen assoziiert sind.

Die hier beschriebenen Verbindungen sind auch in der Behandlung von Erkrankungszuständen verwendbar, die bösartige Zellproliferation, wie viele Krebsarten, involvieren.

Die pharmazeutisch verträglichen Salze der hier beschriebenen Verbindungen, ebenso wie jene Verbindungen, die durch die vorliegenden Verfahren identifiziert werden, schließen pharmazeutisch verträglich Säureadditionssalze, Metallsalze, Ammoniumsalze, organische Aminadditionssalze und Aminosäureadditionssalze ein. Beispiele der Säureadditionssalze sind anorganische Säureadditionssalze, wie Hydrochlorid, Sulfat und Phosphat, und organische Säureadditionssalze, wie Acetat, Maleat, Fumarat, Tartrat, Citrat und Lactat; Beispiele der Metallsalze sind Alkalimetallsalze, wie Lithiumsalz, Natriumsalz und Kaliumsalz, alkalische Erdmetallsalze, wie Magnesiumsalz und Calciumsalz, Aluminiumsalz und Zinksalz; Beispiele der Ammoniumsalze sind Ammoniumsalz und Tetramethylammoniumsalz; Beispiele der organischen Aminadditionssalze sind Salze mit Morpholin und Piperidin; und Beispiele der Aminosäureadditionssalze sind Salze mit Glycin, Phenylalanin, Glutaminsäure und Lysin.

Die hier bereitgestellten Verbindungen, einschließlich jener, die durch die vorliegenden Verfahren identifiziert werden, können in pharmazeutische Zusammensetzungen durch Mischen mit pharmazeutisch verträglichen nicht toxischen Trägerstoffen und Trägern formuliert werden. Solche Zusammensetzungen können hergestellt werden für die Verwendung in der parenteralen Verabreichung, insbesondere in der Form von flüssigen Lösungen oder Suspensionen; oder der oralen Verabreichung, insbesondere in der Form von Tabletten oder Kapseln; oder intranasal, insbesondere in der Form von Pulvern, Nasentropfen oder Aerosolen; oder dermal über zum Beispiel transdermale Pflaster.

Die Zusammensetzung kann geeigneterweise in Einheitendosisform verabreicht und kann durch irgendeines der im pharmazeutischen Stand der Technik bekannten Verfahren hergestellt werden, zum Beispiel wie beschrieben in Remington's Pharmaceutical Sciences (Mack Pub. Co., Easton, PA, 1980). Formulierungen für die parenterale Verabreichung können als gewöhnliche Trägerstoffe steriles Wasser oder Salzlösung, Polyalkylenglykole, wie Polyethylenglykol, Öle und pflanzlichen Ursprungs, hydrogenierte Naphthalene und ähnliches enthalten. Insbesondere können bioverträgliches, bioabbaubares Lactidpolymer, Lactid/Glykolid Copolymer oder Polyoxyethylen-Polyoxypropylen Copolymere verwendbare Trägerstoffe sein, um die Freisetzung der aktiven Verbindungen zu kontrollieren. Andere möglicherweise verwendbare parenterale Verabreichungssysteme für diese aktiven Verbindungen schließen Ethylen-Vinylacetat Copolymerpartikel, osmotische Pumpen, implantierbare Infusionssysteme und Liposome ein. Formulierungen für die Inhalationsverabreichung enthalten als Trägerstoffe zum Beispiel Lactose, oder sie können wässrige Lösungen enthaltend zum Beispiel Polyoxyethylen-9-Laurylether, Glykocholat und Desoxycholat oder ölige Lösungen zur Verabreichung in der Form von Nasentropfen oder als ein Gel, das intranasal verabreicht wird, sein. Formulierungen für die parenterale Verabreichung können auch Glykocholat für die bukkale Verabreichung, ein Salicylat für die rektale Verabreichung oder Zitronensäure für vaginale Verabreichung einschließen. Formulierungen für transdermale Pflaster sind vorzugsweise lipophile Emulsionen.

Die erfindungsgemäßen Verbindungen können als das einzige aktive Mittel in einer pharmazeutischen Zusammensetzung verwendet werden. Alternativ dazu können sie in Kombination mit anderen aktiven Bestandteilen, z.B. anderen Wachstumsfaktoren, die das neuronale Überleben oder die axonale Regeneration in Erkrankungen oder Störungen fördern, verwendet werden.

Die erfindungsgemäßen Verbindungen und pharmazeutisch verträgliche Salze davon können oral oder nicht oral verabreicht werden, z.B. als eine Salbe oder eine Injektion. Die Konzentrationen der erfindungsgemäßen Verbindungen können in einer therapeutischen Zusammensetzung variieren. Die Konzentration wird von Faktoren abhängen, wie der Gesamtdosierung des zu verabreichenden Arzneimittels, den chemischen Eigenschaften (z.B. Hydrophobizität) der verwendeten Verbindungen, dem Verabreichungsweg, dem Alter, Körpergewicht und den Symptomen eines Patienten, etc. Die erfindungsgemäßen Verbindungen werden typischerweise in einer wässrigen physiologischen Pufferlösung mit ungefähr 0,1 bis 10% w/v Verbindung für die parenterale Verabreichung bereitgestellt. Typische Dosierungsbereiche sind von ungefähr 1 &mgr;g/kg bis ungefähr 1 g/kg des Körpergewichts pro Tag; ein bevorzugter Dosierungsbereich beträgt von ungefähr 0,01 mg/kg bis 100 mg/kg des Körpergewichts pro Tag und vorzugsweise ungefähr 0,1 bis 20 mg/kg ein- bis viermal pro Tag. Eine bevorzugte Dosierung des zu verabreichenden Arzneimittels wird wahrscheinlich von Variablen, wie dem Typ und dem Ausmaß des Fortschreitens der Erkrankung oder der Störung, dem gesamten Gesundheitszustand des bestimmten Patienten der relativen biologischen Wirksamkeit der ausgewählten Verbindung und der Formulierung des Trägerstoffs der Verbindung und seinem Verabreichungsweg abhängen.

Die erfindungsgemäßen Verbindungen, einschließlich der Testverbindung und Verbindungen, die durch die erfindungsgemäßen Verfahren identifiziert werden und pharmazeutisch verträglich Salze davon, können alleine oder in der Form von verschiedenen pharmazeutischen Zusammensetzungen gemäß der pharmakologischen Aktivität und dem Zweck der Verabreichung verabreicht werden. Die erfindungsgemäßen pharmazeutischen Zusammensetzungen können durch gleichmäßiges Mischen einer wirksamen Menge einer Verbindung oder eines pharmazeutisch verträglichen Salzes davon, als ein aktiver Bestandteil, mit einem pharmazeutisch verträglichen Träger hergestellt werden. Der Träger kann einen weiten Bereich von Formen gemäß den Formen der Zusammensetzung, die für die Verabreichung geeignet sind, annehmen. Es ist gewünscht, dass solche pharmazeutischen Zusammensetzungen in einer Einheitendosisform hergestellt werden, die für orale und nicht orale Verabreichung geeignet ist. Die Formen für nicht orale Verabreichung schließen Salbe und Injektion ein.

Es können Tabletten unter Verwendung von Trägerstoffen, wie Lactose, Glucose, Sucrose, Mannitol und Methylcellulose, zersetzenden Agenzien, wie Stärke, Natriumalginat, Calcium, Carboxymethylcellulose und kristalliner Cellulose, Gleitmittel, wie Magnesiumstearat und Talk, Bindemitteln, wie Gelatine, Polyvinylalkohol, Polyvinylpyrrolidon, Hydroxypropylcellulose und Methylcellulose, oberflächenaktiven Mitteln, wie Sucrosefettsäureestern und Sorbitolfettsäureestern und ähnlichem in einer herkömmlichen Weise hergestellt werden. Es ist bevorzugt, dass jede Tablette 15–300 mg des aktiven Bestandteils enthält.

Es können Körnchen unter Verwendung von Trägerstoffen, wie Lactose und Sucrose, zersetzenden Mitteln, wie Stärke, Bindemitteln, wie Gelatine und ähnlichem in einer herkömmlichen Weise hergestellt werden. Es können Pulver unter Verwendung von Trägerstoffen, wie Lactose und Mannitol und ähnlichem in einer herkömmlichen Weise hergestellt werden. Es können Kapseln unter Verwendung von Gelatine, Wasser, Sucrose, Gummi arabicum, Sorbitol, Glycerin, kristalliner Cellulose, Magnesiumstearat, Talk und ähnlichem in einer herkömmlichen Weise hergestellt werden. Es ist bevorzugt, dass jede Kapsel 15–300 mg des aktiven Bestandteils enthält.

Es können Siruppräparationen unter Verwendung von Zuckern, wie Sucrose, Wasser, Ethanol und ähnlichem in einer herkömmlichen Weise hergestellt werden.

Es können Salben unter Verwendung von Salbenbasen, wie Vaseline, flüssigem Paraffin, Lanolin und Makrogol, Emulgatoren, wie Natriumlauryllactat, Benzalkoniumchlorid, Sorbitanmonofettsäureester, Natriumcarboxymethylcellulose und Gummi arabicum und ähnlichem in einer herkömmlichen Weise hergestellt werden.

Es können injizierbare Präparationen unter Verwendung von Lösungsmitteln, wie Wasser, physiologischer Salzlösung, Pflanzenölen (z.B. Olivenöl und Erdnussöl), Ethyloleat und Propylenglykol, lösungsvermittelnden Mitteln, wie Natriumbenzoat, Natriumsalicylat und Urethan, isotonischen Mitteln, wie Natriumchlorid und Glucose, Konservierungsmitteln, wie Phenol, Cresol, p-Hydroxybenzoeester und Chlorbutanol, Antioxidanzien, wie Ascorbinsäure und Natriumpyrosulfit und ähnlichem in einer herkömmlichen Weise hergestellt werden.

Die Erfindung wird weiter durch die folgenden Beispiele dargestellt, die beabsichtigen, die Erfindung zu erläutern. Diese Beispiele beabsichtigen nicht, noch sind sie als Beschränkung des Umfangs der Offenbarung vorgesehen.

BEISPIELE Beispiel 1: Allgemeine Beschreibung der Syntheseverfahren und Beispiele

Der allgemeine Syntheseweg, der verwendet wurde um die erfindungsgemäßen überbrückten Indenopyrrolocarbazole mit der Formel II herzustellen, ist in den 1 und 2 gezeigt. Das allgemeine Verfahren zur Synthese der Indenopyrrolocarbazole (III)/(VIII) kann durchgeführt werden, wie in dem US Patent Nr. 5,705,511 beschrieben, dessen Offenbarung hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist. Wenn R1 H ist, ist der Lactamstickstoff der Indenopyrrolocarbazole (III)/(VIII) mit einer geeigneten Schutzgruppe geschützt, was zu (IV)/(IX) führt. Die geschützten Verbindungen werden in einer geeigneten Base in wasserfreiem/n organischem/n Lösungsmittel(n) behandelt, was zu der Bildung einer dunkelroten Lösung führt, von der angenommen wird, dass sie das Carbanion ist. Die Umsetzung des Carbanions mit einem bifunktionellen Reagenz (V) führt zu einer elektrophilen Addition an die C=Y Bindung von (V), was zu dem anfänglichen Zwischenprodukt (VI)/(X) führt. Die Behandlung des/der Zwischenprodukte (VI)/(X) und/oder (VII)/(XI) mit entweder einer Sulfonsäure oder einer Lewissäure, z.B. Bortrifluoridetherat, liefert die überbrückten Indenopyrrolocarbazole (I)/(II).

Die Lactamstickstoff Schutzstrategie (gezeigt in den 3 und 4) kann entweder durch ein säure- oder ein basenkatalysiertes Verfahren durchgeführt werden. Die säurekatalysierte Umsetzung kann mit einem harzgebundenen Reagenz, das die Immobilisierung der Indenopyrrolocarbazole (III)/(VIII) an einen polymeren Träger, wie ein Polystyren basiertes Ringsäureharz (XII) (3) erlaubt, durchgeführt werden, was (XIII) liefert. Alternativ dazu kann die säurekatalysierte Umsetzung mit einem löslichen Reagenz durchgeführt werden, um eine Verbindung (XIV) (4) zu erhalten. Die silylgeschützte Verbindung (XV) wird unter Basenkatalyse (4) hergestellt.

5 beschreibt einige Verfahren zur Herstellung von Zwischenprodukt (V). Das Verfahren (a) beschreibt die Transformation von verschiedenen Acetalen (XVI) bis (XVII, Z = Bindung). Zum Beispiel wird das Ester-Acetal/Ketal (XVI, D = COOR) vollständig zu dem korrespondierenden Alkohol reduziert und anschließend zu dem Aldehyd-Acetal/Ketal (XVII, R8 = H) oxidiert (z.B. Swern oder Dess-Martin Oxidation). Alternativ dazu wird der/das Ester-Acetal/Ketal (XVI, D = COOR) teilweise mit DIBAL reduziert, um den Aldehyd (XVII, R8 = H) direkt zu erhalten. Genauso ergibt die Reduktion von Nitril-Acetal (XVI, D = CN) mit DIBAL den Aldehyd (XVII, R8 = H). Keto-Acetale/Ketal werden/wird hergestellt durch Addition von Grignard Reagenz an Weinreb Amid-Acetal/Ketal (XVI, D = CON(OMe)Me).

Das Zwischenprdukt (XVII, Z = Bindung) kann auch durch ein zweistufiges Verfahren, das in Verfahren (b) dargestellt ist, erhalten werden. Die Addition von organometallischem Reagenz (XIX) an Acetal/Ketal (XVIII) ergibt Alken (XX), das nach Ozonolyse, gefolgt durch eine reduktive Aufarbeitung das Keto-Acetal/Ketal ((XVII) liefert. Die Herstellung von Zwischenprodukt (XVII, Z = Heteroatom) durch ein zweistufiges Verfahren ist in Verfahren (c) angegeben. Die Kopplung des Acetals (XXII) mit Alken (XXI), gefolgt durch Ozonolyse (mit einer reduktiven Aufarbeitung) des resultierenden Alkens ergibt Keto-Acetal/Ketal (XVII). Alternativ dazu wird das Zwischenprodukt (XVII, Z = Heteroatom) durch ein zweistufiges Verfahren, das in Verfahren (d) angegeben ist, hergestellt. Die Umsetzung von Verbindung (XXIV) mit Acetal/Ketal (XVIII) ergibt (XXV), das zu Keto-Acetal/Ketal (XVII) durch die in Verfahren (a) beschriebenen Verfahren transformiert wird. Die Kondensation von Keto-Acetal/Ketal (XVII) mit Hydroxylaminen, Hydrazinen, N-Alkyl-N-Alkoxyaminen und Aminen ergibt Zwischenprodukt (XXVI) das eine elektrophile C=N Funktionalität aufweist.

Das harzgebundene Indenopyrrolocarbazol (XIII) (6, Verfahren A) wird mit einem Überschuss eines Grignard Reagenz als einer Base behandelt, was zu der Bildung einer dunkelroten Lösung des Carbanions führt. Die anschließende Umsetzung mit M führt zu Produkten, die von der elektrophilen Addition an die C=Y Gruppe abgeleitet sind. Die wässrige Aufarbeitung und Spaltung des/der Produkte mit verdünnter Säure (1% TFA in Methylenchlorid) von dem Harz führt zur Isolierung der Verbindung/en (XXVII) und/oder (XXVIII). Die Behandlung des/der Zwischenprodukte (XXVII) und/oder (XXVIII) mit entweder einer Sulfonsäure oder einer Lewissäure, z.B. Bortrifluoridetherat, liefert die überbrückten Indenopyrrolocarbazole (II).

Eine ähnliche Strategie wird für die Umsetzung des löslichen Lactam geschützten Zwischenprodukts, z.B. (XV) (7, Verfahren B) verwendet. Jedoch wird in diesem Fall das Zwischenprodukt (XV) mit Triton B in Pyrimidin als einer Base anstelle des Grignard Reagenz behandelt. Das/die Zwischenprodukte (XXIX) und/oder (XXX) können mit der intakten Lactam geschützten Gruppe isoliert werden, die der chromatographischen Reinigung zugänglich ist. Wie in Verfahren A (6) liefert die Behandlung mit einer Lewissäure (wie Bortrifluoridetherat) die überbrückten Indenopyrrolocarbazole (II), wo R1 = H.

Die Einführung der Gruppen R3, R4, R5 und R6 kann durchgeführt werden, wie in den US Patenten Nr. 5,705,511 und 4,923,986 beschrieben ist, deren Offenbarungen durch Bezugnahme in ihrer Gesamtheit eingeschlossen sind. Ein R3 Substituent kann sonst nach der Konstruktion der überbrückten Indenopyrrolocarbazole, wie in 8 gezeigt, eingeführt werden. Die Position 3 des B Rings wird mit NBS bromiert, was Verbindung (XXXI) liefert. Ein Kohlenstofffragment wird anschließend eingeführt durch Verwenden von Palladium katalysierten Stille, Suzuki, Heck, Kumada oder Castro-Stephens Reaktionen, um Verbindungen des Typs (XXXII), (XXXIII), etc. zu liefern. Zusätzlich kann Verbindung (XXXI) Zugang zu Verbindungen liefern, in denen die Bromgruppe durch ein Heteroatom, z.B. eine Amin basierte Gruppe durch Verwendung von Buchwalds Palladium kataylisierter Aminierungschemie, ausgetauscht werden.

Durch einen oxidativen Vorgang kann eine Sauerstoff verbundene Gruppe an den Indenkohlenstoff des E Rings, wie in 9 gezeigt, Verbindung (XXXIV) eingeführt werden. Diese Chemie führt auch zu der Oxidation der Methylgruppe des Lactams (A Ring), was ein Imidderivat wie gezeigt, liefert.

Beispiel 2: Herstellung von Rink harzgebundenen Zwischenprodukten: (XIII-A), (XIII-B) und (XIII-C), (3) Beispiel 2-A

Eine Dreihalsrundbodenflasche, die mit einem Überkopf mechanischen Rühren und einer Dean-Stark Auffangvorrichtung ausgestattet war, wurde nacheinander mit Rink Säureharz XII (10,00 g, 0,64 mmol/g), 1-Methyl-2-pyrrolidon (80 ml), Benzol (350 ml), VIII-A (A1, A2 = H2, B1, B2 = O, R3 = R4 = R5 = R6 = H)) (3,00 g) und p-Toluolsulfonsäure (1,00 g) beladen. Die Reaktionsmischung wurde unter Rückfluss für 20 Stunden erwärmt und anschließend filtriert. Das Harz wurde mit THF (5 × 175 ml) gewaschen, und das Filtrat wurde zur Seite gestellt. Das Harz wurde anschließend nacheinander mit DMSO (4 × 100 ml), 2% wässrigem NaHCO3 (4 × 100 ml), Wasser (4 × 100 ml), DMSO (2 × 200 ml), THF (4 × 100 ml) und Ethylacetat (4 × 100 ml) gewaschen. Das Harz wurde unter Vakuum (24 Stunden) getrocknet, um 11,70 (0,47 mmol/g) von harzgebundenem VIII-A, (XIII-A) zu ergeben.

Die Original THF Waschungen wurden verdampft, der Rückstand wurde mit Wasser (750 ml) verdünnt, und das resultierende Präzipitat wurde gefiltert und nacheinander mit Wasser, 2% wässriger NaHCO3 (4 × 100 ml) und Wasser (4 × 100 ml) gewaschen. Nach dem Trocknen unter Vakuum wurde VIII-A (1,28 g) gewonnen.

Beispiel 2-B

In einer ähnlichen Weise wurde VIII-B (A1, A2 = O, B1, B2 = H2, R3 = R4 = R5 = R6 = H) (0,5 g) an Ringsäureharz XII (1,52 g) gekoppelt, um 1,58 g harzgebundenes VIII-B, (XIII-B) zu erhalten.

Beispiel 2-C

In einer ähnlichen Weise wurde VIII-C (A1, A2 = H2, B1, B2 = O, R3 = R4 = R5 = R6 = 10-OMe) (1,02 g) an Ringsäureharz XII (3,12 g) gekoppelt, um 3,70 (0,46 mmol/g) harzgebundener Verbindung VIII-C, (XIII-C) zusammen mit der gewonnenen Verbindung VIII-C (0,44 g) zu erhalten.

Beispiel 3: Herstellung von Verbindung (II-1), Verbindung (II-2), Verbindung (II-3), Verbindung (II-4a), Verbindung (II-4b), Verbindung (II-6) und Verbindung (II-8), (Verfahren A, 6) Beispiel 3-A

Zu einer Suspension von (XIII-A), (1,25 g) in THF (24 ml) wurde eine 1,0 M Lösung von EtMgBr (6,25 ml in THF) hinzugefügt, und die Reaktion wurde für 1 Stunde vor dem Hinzufügen von HMPA (5,0 ml) gerührt. Nach Rühren für 10 Minuten wurde Diethoxybutyraldehyd (3,0 g) (das gemäß dem Literaturverfahren von Paquette, et al., J. Am. Chem. Soc., 1997, 119, 9962–71 hergestellt wurde) hinzugefügt, und die Reaktion wurde für 20 Stunden gerührt. Die Reaktion wurde mit 10 % wässrigem NH4Cl (5 ml) gequenscht und filtriert. Das Harz wurde nacheinander mit 10% wässrigem NH4Cl (3 × 10 ml), Wasser (3 × 10 ml), THF (3 × 10 ml), DMF (3 × 10 ml), Wasser (3 × 10 ml), THF (3 × 10 ml) und Ether (3 × 10 ml) gewaschen. Das Harz wurde unter Vakuum getrocknet, in Methylenchlorid (15 ml) aufgenommen und mit Trifluoressigsäure (0,15 ml) behandelt. Nach Rühren für 1 Stunde wurde die Reaktion filtriert, und das Filtrat wurde verdampft. Der resultierende Rückstand wurde in Methylenchlorid (20 ml) aufgenommen und mit Pyridiniumtosylat (50 mg) behandelt, und die resultierende Lösung wurde für 4 Stunden gerührt. Zu dieser Zeit wurde die Reaktion mit gesättigtem wässrigem NaHCO3 und Salzlösung gewaschen und über MgSO4 getrocknet.

Nach Filtration und Lösungsmittelverdampfung wurde der Rückstand durch präparative HPLC (Zorbax RX-8, 4 × 25 cm, eluiert mit 50% MeCN/Wasser w/0,1% Trifluoressigsäure) gereinigt. Die geeigneten Fraktionen wurden mit NaHCO3 neutralisiert und in Methylenchlorid (3 × 50 ml) extrahiert und über MgSO4 getrocknet. Nach Filtration und Lösungsmittelverdampfung wurden 70,2 mg von Verbindung II-1 als ein weißes Pulver erhalten, das die folgenden Eigenschaften aufwies: 13C NMR (DMSO-d6) &dgr; 171.8, 143.3, 142.4, 141.4, 140.1, 140.0, 136.6, 129.2, 127.9, 127.4, 127.1, 126.8, 124.1 (2C), 122.7, 121.6, 121.5, 118.3, 112.1, 88.1, 79.2, 56.6, 45.6, 33.4, 24.8; 1H NMR (DMSO-d6) d 9.21 (d, J = 7.5, 1H), 8.62 (s, 1H), 7.98 (d, J = 7.7, 1H), 7.86 (d, J = 8.3, 1H), 7.71 (d, J = 7.3, 1H), 7.49 (dd, J = 7.9, 7.4, 1H), 7.41 (dd, J = 7.5, 7.4, 1H), 7.36–7.27 (m, 2H), 6.86 (d, J = 6.0, 1H), 5.63–5.58 (m, 1H), 4.91 (s, 2H), 4.53 (d, J = 3.3, 1H), 2.23–2.14 (m, 1H), 1.96–1.92 (m, 1H), 0.96–0.88 (m, 1H), 0.60–0.57 (m, 1H); MS m/z (M + H) berechnet 379, beobachtet 379.

Auch durch präparative HPLC dieser Reaktionsproduktmischung wurde Verbindung II-2 (0,5 mg) isoliert, welche die folgenden Eigenschaften aufwies: 1H NMR (DMSO-d6) &dgr; 9.17 (d, J = 8.1, 1H), 8.62 (s, 1H), 7.98 (d, J = 7.0, 1H), 7.85 (d, J = 6.8, 1H), 7.57 (d, J = 6.8, 1H), 7.49 (dd, J = 7.9, 7.4, 1H), 7.44–7.26 (m, 3H), 6.81 (d, J = 6.0, 1h), 5.43–5.33 (m, 1H), 4.43 (s, 2H), 2.23–2.14 (m, 1H), 1.96–1.92 (m. 1H), 1.45–1.55 (m, 2H), 0.96–0.88 (m, 1H), 0.60–0.57 (m, 1H), 0.29 (t, J = 7.0, 3H); MS m/z (M + H) berechnet 407, beobachtet 407.

Beispiel 3-B

In einer ähnlichen Weise, wie oben für Verbindung II-1 beschrieben, wurde Harz (XIII-A) (70,3 mg) mit 1,1-Diethoxy-2-pentanon (0,75 ml)) behandelt (das gemäß dem Literaturverfahren von Sworin, et al., J. Org. Chem., 1988, 53, 4984–6 hergestellt wurde), um Verbindung II-3 (3,5 mg) zu erhalten, die durch präparative TLC (Silicagel, eluiert mit 50% EtOAc/Toluol) isoliert wurde und die folgenden Eigenschaften aufwies: 1H NMR (DMSO-d6) &dgr; 9.42 (&dgr;, J = 8.2, 1H), 8.58 (s, 1H), 7,95 (d, J = 7.4, 1H), 7.79 (d, J = 8.3, 1H), 7.71 (d, J = 7.1), 7.50–7.20 (m, 4H), 6.81 (d, J = 5.9, 1H), 4.90 (s, 2H), 4.46 (s, 1H), 2.35–2.20 (m, 1H), 1.98 (s, 3H), 1.75–1.60 (m, 1H), 1.25–1.00 (m, 1H), 0.35–0.15 (m, 1H); MS m/z (M + H) berechnet 393, beobachtet 393.

Beispiel 3-C

In einer ähnlichen Weise wurde (XIII-A) (74,3 mg) mit 1,1-Diethoxy-2-hexanon (das gemäß dem Literaturverfahren von Brenner, J. Org. Chem., 1961, 26, 22–7 hergestellt wurde) (0,75 ml) behandelt, um Verbindung II-4a (2,10 mg) und Verbindung II-4b (1,06 mg) zu erhalten, die einzeln durch präparative HPLC (Zorbax RX-8, 4 × 25 cm, 65% MeCN/Wasser w/0,1% Trifluoressigsäure) isoliert wurden. Die Verbindung II-4a wies die folgenden Eigenschaften auf: 1H NMR (DMSO-d6) &dgr; 9.30 (d, J = 8.3, 1H), 8.55 (s, 1H), 7.97 (d, J = 7.2, 1H), 7.65 (d, J = 8.5, 1H), 7.59 (d, J = 7.5), 7.48 (dd, J = 7.8, 7.2, 1H), 7.39–7.15 (m, 3H), 6.31 (dd, J = 5.9, 5.5, 1H), 5.02 (s, 1H), 4,88 (s, 2H), 0.88 (s, 3H) andere aliphatische Signale gingen unter den Lösungsmittelpeaks verloren; MS m/z (M + H) berechnet 407, beobachtet 407. Verbindung II-4b wies die folgenden Eigenschaften auf: 1H NMR (DMSO-d6) d 9.43 (d, J = 8.1, 1H), 8.59 (s, 1H), 7.99 (d, J = 7.3, 1H), 7.75–7.65 (m, 2H), 7.49 (dd, J = 7.0, 6.4, 1J), 7.43 (dd, J = 8.2, 8.1, 1H), 7.36–7.25 (m, 2H), 6.75 (s, 1H), 4,91 (s, 2H), 4.50 (s, 1H), 1.95 (s, 3H) andere aliphatische Signale gingen unter den Lösungsmittelpeaks verloren; MS m/z (M + H) berechnet 407, beobachtet 407.

Beispiel 3-D

In einer ähnlichen Weise wurde (XIII-C) (1,00 g) mit Diethoxybutyraldehyd (3,65 g) behandelt, um Verbindung II-6 (87,8 mg) zu erhalten, die durch präparative HPLC (Zorbax RX-8, 2,5 × 25 cm, 65% MeCN/Wasser w/0,1% Trifluoressigsäure) isoliert wurde und die folgenden Eigenschaften aufwies: 1H NMR (DMSO-d6) &dgr; 9.09 (d, J = 8.6, 1H), 8.60 (s, 1H), 7.95 (d, J = 7.4, 1H), 7.84 (d, J = 8.3, 1H), 7.47 (dd, J = 7.2, 7.0, 1H), 7.35 (s, 1H), 7.29 (dd, J = 7.0, 7.0, 1H), 6.98 (dd, J = 8.6, 1.9, 1H), 6.83 (d, J = 6.0, 1H), 5.65–5.55 (m, 1H), 4.88 (s, 2H), 4.48 (d, J = 3.9, 1H), 3.82 (s, 3H), 2.25–2.10 (m, 1H), 2.08–1.85 (m, 1H), 0.96–0.75 (m, 1H), 0.65–0.50 (m, 1H); MS m/z (M + Na) berechnet 431, beobachtet 431.

Beispiel 3-E

In einer ähnlichen Weise wurde das Harz (XIII-B) (153,2 g) mit Diethoxybutyraldehyd (1,5 ml) behandelt, um Verbindung II-8 (3,6 mg) zu erhalten, die durch präparative HPLC (Zorbax RX-8, 2,5 × 25 cm, 65% MeCN/Wasser w/0,1% Trifluoressigsäure) isoliert wurde und die folgenden Eigenschaften aufwies: 1H NMR (DMSO-d6) &dgr; 9.09 (d, J = 7.9, 1H), 8.81 (s, 1H), 7.81–7.73 (m, 3H), 7.48–7.35 (m, 3H), 7.24 (dd, J = 7.6, 7.5, 1H), 6.85 (d, J = 6.2, 1H), 5.63–5.59 (m, 1H), 4.86 (s, 2H), 4.61 (d, J = 3.6, 1H), 3.82 (s, 3H), 2.21–2.13 (m, 1H), 1.96–1.90 (m, 1H), 0.87–0.79 (m, 1H), 0.61–0.56 (m, 1H); MS m/z (M + H) berechnet 379, beobachtet 379.

Bespiel 4: Herstellung von Verbindung II-7a und Verbindung II-7b (Verfahren A, 6) Beispiel 4-A Herstellung von (1,1-Diethoxyethoxy)aceton

Zu einer kalten (0°C) Suspension von NaH (2,68 g, 60%) in THF (150 ml) wurde eine Lösung von 1,1-Diethoxyethanol (die gemäß dem Literaturverfahren von Zirkle, et al., J. Org. Chem., 1961, 26, 395–407 hergestellt wurde) (9,00 g) in THF (20 ml) hinzugefügt, und die Reaktionsmischung wurde bei Raumtemperatur für 1 Stunde vor dem Hinzufügen von Methallylchlorid (8,0 ml) gerührt. Die Reaktionsmischung wurde unter Rückfluss über Nacht erhitzt, abgekühlt und durch einen Celitestopfen gefiltert. Das Lösungsmittel wurde durch Drehverdampfung entfernt, und der Rückstand wurde durch Säulenchromatographie (Silica, 20% Ether/Hexan) gereinigt, um 1,1-Diethoxyethylmethallylether (11,5 g, 90%) zu erhalten. Es wurde eine Ozonolyse einer gekühlten (–30°C) Lösung dieses Ethers (6,00 g) in EtOAc (80 ml) durchgeführt, bis kein Ausgangsmaterial mehr durch TLC (1 Stunde) nachweisbar war. Zu diesem Zeitpunkt wurde die Reaktion mit Sauerstoff beaufschlagt, mit Pd(OH)2 (150 mg) behandelt und unter einer Atmosphäre von Wasserstoff über Nacht gerührt. Der Katalysator wurde abgefiltert, und das Filtrat wurde durch Drehverdampfung konzentriert. Der resultierende Rückstand wurde durch Säulenchromatographie (Silica, 20% EtOAc/Hexan) gereinigt, um die Titelverbindung (4,53 g, 82%) zu erhalten.

Beispiel 4-B

Gemäß Verfahren A (6) wurde Harz (XIII-A) (230,2 mg) mit EtMgBr (1,25 ml) gefolgt von (1,1-Diethoxyethoxy)aceton (Beispiel 3-A) (1,2 ml) behandelt. Nach dem Aufarbeiten und Spalten von dem Harz wurde ein Anteil der Rohreaktionsproduktmischung (10,5 mg) in Methylenchlorid (20 ml) aufgenommen und mit BF3 Etherat (20 &mgr;l) behandelt. Nach Rühren für 2,5 Stunden wurde die Lösung mit gesättigter wässriger NaHCO3 und Salzlösung vor dem Trocknen über MgSO4 gewaschen. Nach Filtration und Lösungsmittelentfernung wurde der resultierende Rückstand durch präparative HPLC (Zorbax RX-8, 4 × 25 cm, 65% MeCN/Wasser w/0,1% Trifluoressigsäure) gereinigt, um Verbindung II-7a (2,34 mg/und Verbindung II-7b (1,34 mg) zu erhalten. Die Verbindung (II-7a) wies die folgenden Eigenschaften auf: 1H NMR (CDCl3) &dgr; 9.35–9.20 (m, 1H), 7.87 (d, J = 7.6, 1H), 7.62 (d, J = 7.0, 1H), 7.60–7.45 (m, 1H), 7.49 (dd, J = 7.7, 7.5, 1H), 7.40 (d, J = 8.1, 1H), 7.37–7.26 (m, 3H), 6.22 (s, 1H), 5.20–4.85 (m, 1H), 4.47 (s, 1H), 3.67 (d, J = 12.7, 1H), 3.52 (d, J = 11.8, 1H), 3.40 (d, J = 12.7, 1H), 3.38 (d, J = 11.8, 1H), 1.91 (s, 3H); MS m/z (M + H) berechnet 409, beobachtet 409. Die Verbindung II-7b wies die folgenden Eigenschaften auf: 1H NMR (CDCl3) &dgr; 9.58–9.22 (m, 1H), 7.82 (d, J = 7.4, 1H), 7.60–7.40 (m, 3H), 7.37–7.27 (m, 3H), 7.21 (d, J = 8.1, 1H), 5.81 (s, 1H), 5.21 (s, 1H), 5.10–4.80 (m, 1H), 4.59 (d, J = 13.5, 1H), 4.38 (dd, J = 13.5, 5.3, 1H), 4.21 (d, J = 13.1, 1H), 3.82 (d, J = 13.2, 1H), 1,13 (s, 3H); MS m/z (M + H) berechnet 409, beobachtet 409.

Beispiel 5: Herstellung von Verbindung II-5 (8)

Zu einer Lösung von Verbindung II-1 (8,1 mg) in THF (2 ml) wurde NBS (4,6 mg) hinzugefügt, und die Reaktion wurde über Nacht gerührt. Zusätzliches NBS (4,5 mg) wurde hinzugefügt, und die Reaktion für 2,5 Stunden gerührt. Unlösliches Material wurde abgefiltert, und das Filtrat wurde durch Drehverdampfung konzentriert. Der resultierende Rückstand wurde durch Säulenchromatographie (C-18, 65% MeCN/Wasser w/0,1% Trifluoressigsäure) gereinigt. Die geeigneten Fraktionen wurden mit NaHCO3 neutralisiert und in Methylenchlorid (3 × 20 ml) extrahiert und über MgSO4 getrocknet. Nach der Filtration und Lösungsmittelverdampfung wurde Verbindung II-5 (5,1 mg) als ein weißes Pulver erhalten, das die folgenden Eigenschaften aufwies: 1H NMR (DMSO-d6) &dgr; 9.22 (d, J = 7.4, 1H), 8.67 (s, 1H), 8.14 (s, 1H), 7.86 (d, J = 8.7, 1H), 7.72 (d, J = 7.0, 1H), 7.63 (d, J = 7.8, 1H), 7.42 (dd, J = 7.5, 7.3, 1H), 7.35 (dd, J = 7.3, 7.2, 1H), 6.86 (d, J = 6.0, 1H), 5.63–5.58 (m, 1H), 4.94 (s, 2H), 4.54 (d, J = 3.1, 1H), 2.30–2.14 (m, 1H), 2.00–1.82 (m, 1H), 0,96–0.88 (m, 1H), 0.62–0.50 (m, 1H); MS m/z (M + H) berechnet 457/9 (1:1), beobachtet 457/9 (1:1).

Beispiel 6: Herstellung von Zwischenprodukt XV (4)

Zu einer Lösung von VIII-A [A1, A2 = H2, B1, B2 = O, R3 = R4 = R5 = R6 = H] (1,05 g) in DMF (25 ml) wurde Triethylamin (0,75 ml) und t-Butyldimethylsilylchlorid (TBS-Cl) (0,65 g) hinzugefügt. Nach Rühren für 3 Stunden wurde die Reaktion mit gesättigter wässriger NaHCO3 gequenscht und in EtOAc extrahiert. Die organische Schicht wurde mit Wasser und Salzlösung gewaschen und über MgSO4 getrocknet. Nach Filtration und Lösungsmittelverdampfung wurde der resultierende Rückstand mit Ether titriert, um die Verbindung XV (848 mg) zu ergeben. Die Waschungen wurden verdampft, um einen Rückstand zurückzulassen, der durch Säulenchromatographie (Silica, 1% EtOAc/CH2Cl2) gereinigt wurde und ein zusätzliches Produkt (502 mg, vereinigte Ausbeute von 94%) ergab, das die folgenden spektralen Eigenschaften aufwies: 1H NMR (DMSO-d6) &dgr; 11.94 (s, 1H), 9.32 (d, J = 7.6, 1H), 8.03 (d, J = 7.7, 1H), 7.64 (d, J = 7.2, 1H), 7.58 (d, J = 8.1, 1H), 7.44 (dd, J = 7.7, 7.6, 1H), 7.39 (dd, J = 7.7, 7.6, 1H), 7.32 (d, J = 7.3, 1H), 7.25 (dd, J = 7.6, 7.3, 1H), 5.00 (s, 2H), 4.14 (s, 2H), 0.99 (s, 9H), 0,46 (s, 6H); MS m/z (M + H) berechnet 425, beobachtet 425.

Beispiel 7: Herstellung von Verbindung II-1 über Verfahren B (7)

Eine Lösung aus Triton B in Pyridin (0,45 M) wurde durch Lösen einer 40% Lösung von Triton B in Methanol (10 ml) in Pyridin (10 ml) hergestellt. Das Lösungsmittel wurde unter reduziertem Druck (20 mm Hg) auf ein Endvolumen von ~8 ml entfernt. Der Rückstand wurde mit Pyridin in 50 ml verdünnt, gefiltert und unter Stickstoff gelagert. Eine Lösung aus XV (20,3 mg) in Pyridin (2,0 ml) wurde mit Argon gespült und mit 300 &mgr;l Triton B (0,45 M in Pyridin) und Diethoxybutyraldehyd (50 &mgr;l) behandelt. Nach Rühren für 2 Stunden wurde die Reaktion in EtOAc extrahiert, mit 1N wässriger HCl, Salzlösung gewaschen und über MgSO4 getrocknet. Nach Filtration und Lösungsmittelverdampfung wurde das Addukt in CH2Cl2 (10 ml) aufgenommen und mit BF3 Etherat (10 &mgr;l) behandelt. Nach Rühren für 2 h wurde die Lösung mit gesättigter wässriger NaHCO3 und Salzlösung vor dem Trocknen über MgSO4 gewaschen. Das Entfernen des Lösungsmittels durch Drehverdampfung ergab einen Rückstand, der durch präparative HPLC (Zorbax RX-8, 2,5 × 25 cm, 65% MeCN/Wasser w/0,1% Trifluoressigsäure) gereinigt wurde. Die geeigneten Fraktionen wurden mit NaHCO3 neutralisiert und in Methylenchlorid (3 × 20 ml) extrahiert und über MgSO4 getrocknet. Nach Filtration und Lösungsmittelverdampfung wurde II-1 (11,8 mg, 65% Ausbeute) erhalten, dessen 1H NMR und MS Spektren und HPLC Verweilzeit identisch waren zu dem Material, das durch Verfahren A, das in Beispiel 3-A beschrieben ist, hergestellt und isoliert wurde.

Beispiel 8: Herstellung von Verbindung II-9 (8)

Zu einer Suspenion von Brom Verbindung II-5 (6,2 mg) in 1-Propanol (4,0 ml) wurde 3-Aminophenylborsäure (3,8 mg) hinzugefügt. Nach Rühren für 0,25 Stunden wurden nacheinander Pd(OAc)2 (2,0 mg), Ph3P (4,8 mg), Na2CO3 (2,8 mg) und Wasser (2,0 ml) hinzugefügt. Die Mischung wurde unter Rückfluss für 0,75 Stunden erhitzt, abgeküht, in CH2Cl2 extrahiert und mit Wasser und Salzlösung gewaschen. Die organische Schicht wurde über MgSO4 getrocknet, und das Lösungsmittel wurde durch Drehverdampfung entfernt, um einen Rückstand zu ergeben, der durch präparative HPLC (Zorbax RX-8, 2,5 × 25 cm, 50% MeCN/Wasser w/0,1% Trifluoressigsäure) gereinigt wurde. Die geeigneten Fraktionen wurden mit NaHCO3 neutralisiert und in Methylenchlorid (3 × 20 ml) extrahiert und über MgSO4 getrocknet. Nach Filtration und Lösungsmittelverdampfung wurde Verbindung II-9 (3,1 mg, 49% Ausbeute) erhalten und wies die folgenden spektralen Eigenschaften auf: 1H NMR (DMSO-d6) &dgr; 9.22 (d, J = 7.5, 1H), 8.66 (s, 1H), 8.00–7.25 (m, 8H), 7.12 (dd, J = 7.1, 7.0, 1H), 6.95–6.80 (m, 3H), 6.53 (d, J = 6.0, 1H), 5.63–5.58 (m, 1H), 4.99 (s, 2H), 4.55 (s, 1H), 2.25–2.10 (m, 1H), 1.95–1.90 (m, 1H), 0.98–0.88 (m, 1H), 0.65–0.57 (m, 1H); MS m/z (M + H) berechnet 470, berechnet 470.

Beispiel 9: Herstellung von Verbindung II-10 (9)

Zu einer Lösung von Verbindung II-1 (5,0 mg) in DMSO (1 ml) wurde NaCN (4,3 mg) hinzugefügt, und die Mischung wurde auf 145°C für 1 Stunde erwärmt. Die Mischung wurde abgekühlt, in EtOAc extrahiert und mit Wasser (3 × 20 ml) und Salzlösung gewaschen. Die organische Schicht wurde über MgSO4 gewaschen, filtriert und verdampft, um einen Rückstand zu erhalten, der durch präparative HPLC (Zorbax RX-8, 2,5 × 25 cm, 55% MeCN/Wasser w/0,1% Trifluoressigsäure) gereinigt wurde. Die geeigneten Fraktionen wurden mit NaHCO3 neutralisiert, in Methylenchlorid (3 × 20 ml) extrahiert und über MgSO4 getrocknet. Nach Filtration und Lösungsmittelverdampfung wurde Verbindung II-10 (2,7 mg, 50% Ausbeute) erhalten und wies die folgenden Eigenschaften auf: 1H NMR (DMSO-d6) &dgr; 11.4 (s, 1H), 8.86 (d, J = 7.9, 1H), 8.79 (d, J = 7.6, 1H), 7.90 (d, J = 8.3, 1H), 7.62–7.55 (m, 2H), 7.49 (dd, J = 7.6, 7.4, 3H), 7.40 (dd, J = 7.4, 7.3, 1H), 7.35 (dd, J = 7.5, 7.4, 1H), 6.86 (d, J = 6.0, 1H), 6.03 (s, 1H), 5.40–5.30 (m, 1H), 2.25–2.14 (m, 1H) 2.03–1.90 (m, 1H), 1.10–0.98 (m, 1H), 0.82–0.77 (m, 1H).

Beispiel 10: Herstellung von Verbindung II-11 (Verfahren A, 6)

Gemäß dem Verfahren A wurde Harz (XIIIa) (150,2 mg) mit EtMgBr (1,0 ml), gefolgt durch Ethyl 2,5-Dioxopentanoat (Schmidt, et al., Synthesis, 1993, 809) (1,5 ml) umgesetzt. Nach Aufarbeiten und Spalten von dem Harz wurde die Rohreaktionsproduktmischung in Methylenchlorid (20 ml) aufgenommen und mit BF3 Etherat (20 &mgr;l) behandelt. Nach Rühren für 2,5 Stunden wurde die Lösung mit gesättigter wässriger NaHCO3 und Salzlösung vor dem Trocknen über MgSO4 gewaschen. Nach Filtration und Lösungsmittelentfernung wurde der resultierende Rückstand durch präparative HPLC (Zorbax RX-8, 4 × 25 cm, 55%–75% Gradient MeCN/Wasser w/0,1% Trifluoressigsäure) gereinigt, um Verbindung II-11 (6,4 mg) zu erhalten, welche die folgenden Eigenschaften aufwies: 1H NMR (DMSO-d6) &dgr; 9.36 (d, J = 7.7, 1H), 8.68 (s, 1H), 8.00 (d, J = 7.7, 1H), 7.83 (d, J = 8.3, 1H), 7.58–7.15 (m, 5H), 6.97 (d, J = 5.9, 1H), 4.93 (s, 2H), 4.82 (s, 1H), 4.48 (q, J = 7.1, 2H), 2.42–1.91 (m, 2H), 1.37 (t, 3H, J = 7.1), 1.25–0.63 (m, 2H).

Beispiel 11: Herstellung von Verbindung II-12

Eine Lösung von Verbindung II-11 (3,4 mg) in THF (2 ml) wurde mit einer 2 M Lösung von LiBH4 (1,0 ml in THF) behandelt, und die Reaktion wurde für 1,5 h gerührt. Die Reaktion wurde durch das Hinzufügen von 1 N wässriger HCl (4 ml) gequenscht. Nach Rühren für 20 Minuten wurde 10% wässrige NaOH (15 ml) hinzugefügt, und die Mischung wurde in Methylenchlorid (3 × 10 ml) extrahiert. Nach dem Trocknen über MgSO4 wurde die Mischung filtriert und das Lösungsmittel verdampft, um Verbindung II-12 (0,32 mg) zu erhalten, welche die folgenden Eigenschaften aufwies: 1H NMR (DMSO-d6) &dgr; 9.35 (d, J = 7.7, 1H), 8.62 (s, 1H), 7.98 (d, J = 7.7, 1H), 7.83 (d, J = 8.2, 1H), 7.75 (d, J = 8.2, 1H), 7.50–7.25 (m, 4H), 6.84 (d, J = 7.7, 1H), 6.11 (s, 1H), 4.91 (s, 2H), 4.71 (s, 1H), 4.50–4.40 (m, 1H), 4.30–4.20 (m, 1H), 2.42–1.91 (m, 2H), 1.25–0.63 (m, 2H); MS m/z (M + H) berechnet 409, beobachtet 409.

Beispiel 12: Verstärkung von Rückenmark ChAT Aktivität

ChAT ist ein spezifischer biochemischer Marker für funktionelle cholinerge Neurone. Cholinerge Neurone stellen einen hauptcholinergen Eintrag in die Hippocampusbildung, den olfaktorischen Kern, den Interpeduncularkern, den Kortex, die Amygdala und Teile des Thalamus dar. Im Rückenmark sind die motorischen Neuronen cholinerge Neurone, die ChAT enthalten (Phelps, et al.,J. Comp. Neurol., 1988, 273, 459–472). Die ChAT Aktivität wurde verwendet, um die Wirkungen von Neurotrophinen (z.B. NGF oder NT-3) auf das Überleben und/oder die Funktion von cholinergen Neuronen zu untersuchen. Der ChAT Assay dient auch als ein Anzeichen der Regulation von ChAT Mengen innerhalb der cholinergen Neuronen.

Methoden: Fötale Rattenrückenmarkszellen wurden dissoziiert, und die Experimente wurden wie beschrieben durchgeführt (Smith, et al., J. Cell Biology, 1985, 101, 1608–1621; Glicksman, et al., J. Neurochem., 1993, 61, 210–221). Die dissoziierten Zellen wurden aus Rückenmark, die von Ratten (embryonaler Tag 14–15) durch Standardtrypsin Dissoziierungstechniken entnommen wurden (Smith et al., supra) hergestellt. Die Zellen wurden zu 6 × 105 Zellen/cm2 auf poly-1-Ornithin beschichteten Plastikgewebekulturvertiefungen in serumfreiem N2 Medium, das mit 0,05% Rinderserumalbumin (BSA) ergänzt worden war, ausplattiert (Bottenstein, et al., Proc. Natl. Acad. Sci. USA, 1979, 76, 514–517). Die Kulturen wurden bei 37°C in einer feuchten Atmosphäre von 5% CO2/95% Luft für 48 Stunden inkubiert. Die ChAT Aktivität wurde nach 2 Tagen in vitro unter Verwendung einer Modifikation des Fonnum Verfahrens (Fonnum, Neurochem., 1975, 24, 407–408) gemäß McMariaman, et al. und Glicksman, et al. (McManaman, et al., Develop. Biol., 1988, 125, 311–320; Glicksman, et al., J. Neurochem.,supra) gemessen.

Die Verbindungen mit der Formel II, die in den Beispielen beschrieben sind, sind in Tabelle 2 aufgelistet. Werte für R1, R4, R6 und R7 sind H; Y ist O; und n ist 1.

Tabelle 2
Beispiel 13: pcDNA3-EE-MLK3, pcDNA3-EE-MLK3 (K144R)

5 MLK3 wurde wie beschrieben kloniert (Lee, et al., Oncogene, 1993, 8, 3403–3410; Ezoe, et al., Oncogene, 1994, 9, 935–938). Die cDNA wurde aus 200 ng polyadenylierter Melanozyten mRNA hergestellt, und 5% der Reaktion wurden als Matrize verwendet, um ein Repertoire von PTK cDNAs unter Verwendung von Mischungen von entweder zwei oder vier hoch degenerierten Oligonukleotidprimern zu 0 amplifizieren, die von der Konsensussequenz der konservierten VIb und IX Subdomänen von bekannten PTKs abgeleitet waren: PTK1, 5'-CGGATCCACMGIGAYYT-3' (SEQ ID NR:1), PTK2, 5'-GGAATTCCAWAGGACCASACRTC-3' (SEQ ID NR:2); PTK3, 5'-CGGATCCRTICAYMGIGAYYTIGCIGCIMGIAA-3' (SEQ ID NR:3); PTK4, 5'-5 GGAATTIAYIGGAWAIGWCCAIACRTCISW-3' (SEQ ID NR:4). Vierzig PCR Zyklen wurden unter Verwendung von Taq DNA Polymerase (AmpliTaq; Perkin-Elmer/Cetus) in einem automatischen DNA Thermocycler durchgeführt; jeder Zyklus bestand aus 40 s bei 94°C, 2 min bei 37°C und 3 min bei 63°C. Die Produkte von acht PCRs wurden vereinigt, mit DNA Polymerase (Klenow) behandelt, mit 0 BamH1 plus EcoR1 gespalten und in einem 5% Polyacrylamidgel elektrophoretisch getrennt. Die Ethidiumbromid Färbung identifizierte eine vorherrschende 200–230 by Bande, die ausgeschnitten, eluiert und in M13mp18 kloniert wurde. In einem Experiment wurde ein Teil der PCR amplifizierten cDNA nicht gespalten, sondern anstelle dessen mit stumpfen Enden in M13mp18, der mit Sma1 gespaltnen wurde, kloniert. Die Nukleotidsequenzen wurden durch das Kettenterminationssequenzierverfahren bestimmt.

Eine cDNA, die als PTK1 identifiziert wurde, wurde als eine Sonde verwendet, um humane Melanom und Melanozyten cDNA Bibliotheken zu screenen. Ein Klon, der als PTK1-3,2 bezeichnet wurde, schloss den gesamten offenen Leserahmen von 2541 nt ein, der für ein Protein von 847 Aminosäuren kodiert. Diese cDNA wurde mit Nco1 gespalten, durch DNA Polymerase (Klenow) mit stumpfen Enden versehen, erneut mit EcoR1 gespalten und in den Vektor pCDNA3-EE, der mit BamH1 gespalten, mit stumpfen Enden versehen und anschließend mit EcoR1 gespalten worden war, ligiert. Der Vektor pCDNA3-EE wurde hergestellt durch das Einbauen eines Oligos in die HindIII/BamH1 Stelle, das für ein Startcodon, gefolgt von dem EE Epitop, MEEEEYMPME (SEQ ID NR:5) (Grussenmeyer, et al. Proc. Natl. Acad. Sci. USA, 1985, 82, 7952–7954) kodiert. Die Kinase-tote Version von MLK3 wurde hergestellt durch Einführen der Mutation K144R unter Verwendung von PCR, die eine kürzlich veröffentlichte Technik verwendet (Chen, et al., Biotechniques, 1994, 17, 657–659). Das erste mutagene Oligo war 5'-GTGGCTGTGCGGGCAGCTCGCCAG-3' (SEQ ID NR:6) und das zweite Oligo war 5'-GAGACCCTGGATCTCGCGCTT-3' (SEQ ID NR:7). Unter Verwendung von MLK3 als eine Matrize wurden diese Oligos in einer PCR verwendet, um ein Fragment von 806 by zu erzeugen und in einer zweiten PCR Reaktion unter Verwendung eines T7 Primers als dem anderen Amplimer und MLK3 als der Matrize verwendet, um ein Fragment von 1285 by zu erzeugen. Das Fragment wurde durch Agarosegelelektrophorese getrennt, isoliert, in pGEM-5 (Promega) kloniert und sequenziert. Das Fragment wurde mit HindIII und HpaI ausgeschnitten und in pCDNA3-EE-MLK3, der mit HindIII und HpaI gespalten worden war, eingebaut. Eine zusätzliche Punktmutation wurde bei Nukleotid 1342 nachgewiesen. Um dies zu korrigieren, wurde ein PfIM1 Fragment (nt 1093–1418) aus der Wildtyp MLK3 ausgeschnitten und verwendet, um das identische Fragment in der K144R mutierten MLK3 zu ersetzen.

Beispiel 14: pFB-FLAG-MLK3

Um MLK3 Protein zu erhalten wurde die cDNA in den baculoviralen Expressionsvektor pFB-FLAG kloniert. MLK3 wurde aus PTK1-3.2 durch Spaltung mit Nco1 ausgeschnitten, mit DNA Polymerase (Klenow) mit stumpfen, Enden versehen, wiederum mit Not1 geschnitten und in pFB-FLAG ligiert, der mit Stu1 und Not1 gespalten worden war. pFB-FLAG ist von pFB (Life Technologies) abgeleitet und weist die kodierende Sequenz für das FLAG Epitop (Hopp, et al., Biotechnology, 1988, 6, 1205–1210) mit dem Startcodon MDYKDDDDK (SED ID NR:8) auf, das zu dem Polylinker in der BamH1 Stelle hinzugefügt wurde.

Beispiel 15: pFB-GST-MLK3(KD)

Die baculovirale Expression der Kinasedomäne von MLK3 wurde durch Ausschneiden des MLK3 Fragments von dem pGEXKG-MLK3(KD) unter Verwendung von EcoR1 und Xho1 und sein Ligieren in einen pFB Vektor, der mit EcoR1 und Xho1 gespalten worden war, in dem die kodierende Sequenz für Glutathion S-Transferase (GST) oberhalb kloniert worden war, erreicht. Dies wurde erreicht durch Erhalten der GST kodierenden Sequenz und des Polylinkers von dem pGEXKG Vektor durch PCR unter Verwendung des Vektors als eine Matrize (Guan, et al., Anal. Biochem., 1991, 192, 262–267). Das 5' Oligo für die PCR bildete eine BgI2 Restriktionsstelle an dem 5'-Ende des Fragments. Dieses isolierte Fragment wurde anschließend mit BgI2 und HinD3 gespalten und in pFB ligiert, der mit BamH1 und HinD3 gespalten worden war.

Beispiel 16: pGEXKG-MLK3(KD)

Ein cDNA Fragment, das sowohl die MLK3 Kinasedomäne als auch einen Abschnitt des Leucin-Zippers (nt 736–1791) enthielt, wurde durch PCR unter Verwendung der PTK1 cDNA erhalten. Das isolierte Fragment wurde mit den Restriktionsenzymen EcoR1 und Xho1 gespalten, diese Stellen wurden in die PCR Oligos eingeschlossen, und in pGEX-KG kloniert, der mit EcoR1 und Xho1 gespalten worden war. Dieses Fragment in pGEX-KG wurde anschließend durch PCR verkürzt, um nur die Kinasedomäne (nt 736–1638) einzuschließen.

Beispiel 17: pKH3-MLK2, pKH3-MLK2(KA)

MLK2 wurde unter Verwendung einer degenerierten PCR kloniert (Dorow, et al., Eur. J. Biochem., 1993, 213, 701–710; Dorow, et al., Eur, J. Biochem., 1995, 234, 492–500). Segmente von cDNAs, die katalytische Unterdomänen von Proteinkinasen, die in der epithelialen Tumorzelllinie Colo 16 exprimiert werden, wurden aus RNA durch reverse Transkriptase PCR amplifiziert. Degenerierte PCR Primer basierten in Sequenzen, die konservative Motive in den Subdomänen VIb und VIII der epidermalen Wachstumsfaktor Rezeptorfamiliekinase katalytischen Domänen kodieren. Die Sequenzen der Primer waren wie folgt: Vorwärts gerichteter Primer, 5'-CGGATCCGTG(A)cacc(A)GT(CG)G(A)ACC(T)T-3' (SEQ ID NR:9), reverser Primer, 5'-GGAATTCACCA(G)TAA(G)CTCCAG(C)ACATC-3' (SEQ ID NR:10). Einige PCR Produkte wurden in M13 kloniert und unter Verwendung eines T7 Super-Base Sequenzierkits (Bresatec) sequenziert. Ein 216 by PCR Produkt wurde als eine Sonde verwendet, um eine humane Kolon &lgr;gt11 cDNA Bibliothek (Clontech, Katalog #HL10346) zu screenen. Das Fragment wurde zufällig markiert, eine Hybridisierung wurde bei 65°C durchgeführt, und die Filter wurden zu einer Stringenz von 0,2 X NaCl/Citrat (150 mM Natriumchlorid, 15 mM Natriumcitrat, pH 7,0) und 0,5% SDS bei 65°C gewaschen. Die Filter wurden für 16 Stunden bei –70°C auf einem Kodak XAR-5 Film autoradiographiert. Vier Klone wurden isoliert und der längste, 1,2 kb, wurde verwendet, um dieselbe Bibliothek unter denselben Bedingungen erneut zu untersuchen. Vier weitere Klone wurden selektiert und einer dieser Klone stellte ein 1034 bp Fragment von MLK2 dar. Dieser Klon wurde als eine Sonde verwendet, um eine humane Gehirn &lgr;gt10 Bibliothek zu untersuchen. Ungefähr 500.000 Klone wurden gescreent und ein 3454 bp Klon wurde isoliert, der die gesamte kodierende Region von MLK2 darstellte.

MLK2 wurde von dem ATG bis zu dem polyA Schwanz in den Vektor pKH3 zwischen die BamH1 und EcoR1 Stellen in zwei Schritten kloniert, weil eine BamH1 Stelle in der Mitte der MLK2 Sequenz liegt. Der Vektor pKH3 wurde durch Einführen von drei Kopien des HA Epitop tag, gefolgt durch eine BamH1 Stelle zwischen der Xba1 und EcoR1 Stelle des pRK7 Polylinkers konstruiert. Um die mutagenisierte Version K125A herzustellen, wurde das MLK2 5'-BamH1 Fragment in den Promega p Alter Vektor kloniert und mutagenisiert, wie vom Hersteller empfohlen. Das Fragment wurde anschließend in den MLK2 pKH3 Vektor zurückkloniert.

Beispiel 18: pcDNA3-HA-JNK1

Die JNK1 cDNA wurde wie beschrieben erhalten (Coso, et al., Cell, 1995, 81, 1137–1146). Die cDNA wurde durch PCR unter Verwendung humaner Skelettmuskel cDNA als Matrize (Invitrogen) erhalten und wurde in die Bgl2/Sal1 Stellen von pcDNA3-HA, ein modifiziertes pcDNA3 Expressionsplasmid, welches das HA Epitop kodiert, kloniert (Wilson, et al., Cell, 1984, 37, 767–778). Dies wurde anschließend von pcDNA3, einschließlich des HA Epitops ausgeschnitten und in pGEX-4T3 (Pharmacia) ligiert. Die JNK1 cDNA wurde aus dem pGEX-4T3 Konstrukt als ein Bgl2/Sal1 Fragment ausgeschnitten und in pcDNA3-HA ligiert, einem Vektor, in dem das HA Epitop in die HinD3/BamH1 Stelle von pcDNA3 hinzugefügt worden war.

Beispiel 19: pFLAG-DLK

DLK wurde in den Expressionsvektor pcDNA3 mit dem hinzugefügten FLAG Epitop, wie beschrieben (Holzman, et al., J. Biol. Chem., 1994, 269, 30808–30817) kloniert. Ein Fragment der cDNA für DLK wurde durch degeneriertes Oligonukleotid basiertes PCR Klonieren isoliert. Gesamt RNA wurde von Nieren vom embryonalen Tag 13,5 (32 Organe) und vom embryonalen Tag 17,5 (16 Organe) unter Verwendung eines kommerziell hergestellten Phenol/Guanidinisothiocyanat Reagenzverfahrens gemäß den Angaben des Herstellers (TRIzol Reagent, Life Technologies, Inc.) extrahiert. Anschließend an die Spaltung RNase freier DNase I wurde Gesamt RNA revers mit RNase H reverser Transkriptase (Superscript, Life Technologies, Inc.) von einem Oligo(dT) synthetischen Oligonukleotidprimer zu einzelsträngiger cDNA revers transkribiert. Degenerierte Oligonukleotidprimer, die den Proteintyrosinkinase katalytischen Subdomänen VIB und IX, die ursprünglich von Wilks (Wilks, Proc Natl Acad Sci USA, 1989, 86, 1603–1607) beschrieben wurden entsprachen wurden zu jeweils 5' EcoRI und HindIII Stellen modifiziert (5'-ATAATTC(GT)GC(TAGC)GCCA(GA)GTC(TAGC)CGGTG-3' (SEQ ID NR:11), 5'-ATAAGCTTCC(TC)(AG)T(GC)AAGTGGA(TC)(GC)GC(AGC)CC(CT)GA-3') (SEQ ID NR:12). Vierzig PCR Zyklen wurden für 1,5 min bei 94°C, 2 min bei 37°C und 3 min bei 63°C durchgeführt. Frische Reagenzien wurden hinzugefügt und zusätzliche 40 Zyklen wurden vor der finalen 10 min Extension bei 72°C abgeschlossen. Das resultierende 200–210 bp DNA Amplifikationsprodukt wurde gelisoliert, in ein vorbereitetes pGEM7zf(+) Plasmid (Promega) subkloniert und in Escherichia coli transformiert. Minipräp Plasmid DNA wurde von transformierten Bakterien hergestellt, und ein Anteil wurde mit EcoRI und HindIII Restriktionsendonukleasen gespalten; und Klone, die Inserts enthielten, wurden sequenziert.

Das 195 bp DLK cDNA Fragment, das von der degenerierten PCR erhalten wurde, wurde radioaktiv markiert, und verwendet, um ungefähr 1 × 106 Rekombinante einer Uni-ZAP II (Stratagene, La Jolla, CA), Oligo(dT) geprimten adulten Maushirn cDNA Bibliothek (Holzman, et al., Mol Cell Biol, 1990, 10, 5830–5838) zu screenen. Die Filter wurden in einem Puffer, der aus 50% Formamid, 5 × SSC, 3 × Denhard's Lösung, 0,25% SDS, 1 mg/ml polyadenylische Säure und 200 mg/ml Lachssperma DNA besteht, bei 42°C hybridisiert. Die Filter wurden einmal bei Raumtemperatur in 2 × SSC, 0,2% SDS und zweimal für 30 min bei 65°C gewaschen. Fünfundzwanzig einzelne Kolonien wurden identifiziert; 10 Klone wurden zur Homogenität gereinigt, in vivo gemäß dem Protokoll des Herstellers ausgeschnitten und restriktionskartiert. Die zwei längsten Klone (jeweils 3401 und 3397 bp, die sich nur an ihren 5'-Enden unterschieden) wurden entlang beider Stränge über ihre gesamte Länge sequenziert.

Das Gesamtlängen Notl-Xhol DLK cDNA Fragment (3401 bp) wurde in den Cytomegalovirus Promotor basierten Eukaryoten Expressionsvektor pcDNA3 (Invitrogen, San Diego, CA) (das Konstrukt wird als pcDNA3-DLK bezeichnet) subkloniert. Als nächstes wurde ein NH4-Met FLAG Epitop (DYKDDDDK) (SEQ ID NR:13) markiertes Konstrukt (pFLAG-DLK) hergestellt. Die PCR wurde verwendet, um cDNA Fragmente zu amplifizieren, die eine 5' HindIII Stelle DLK's Kozak's Konsensussequenz einschließlich dem Initiations ATG, dem FLAG Epitop und der Sequenz für den DLK cDNA offenen Leserahmen, der sich von Nukleotid 88 bis zu einer internen EcoRI Stelle bei Nukleotid 758 erstreckt, kodieren. (HPLC gereinigte synthetische Oligonukleotide wurden in äquimolaren Mengen verwendet: 5'-ATAAAGCTTCCAGAGGCCATGGACTACAAGGACGACGATGACAAGGCCTGC CTCCATGAAACCCGAACA-3' (SEQ ID NR:14) für den FLAG Konstrukt Senseprimer und 5'-GACAGGGCGGCCGGCTCT-3' (SEQ ID NR:15) für den Antisenseprimer.) Gel gereinigte HindIII und EcoR1 gespaltene amplifizierte Fragmente wurden in die HindIII-EcoR1 Stelle subkloniert, um das pcDNA3-DLK Plasmid herzustellen. Die Konstrukte wurden entlang beider Stränge sequenziert, um die Genauigkeit der Taq Polymerase und die Einhaltung des Leserahmens sicherzustellen.

Beispiel 20: pcDNA3-MLK1

Der 5' Abschnitt von MLK1 wurde aus der EST Datenbank (Zugangs #AA160611) erhalten. Dieser Klon war eine Fusion zwischen MLK1 und einer anderen cDNA mit unbekannter Identität. Sie enthielt eine zuvor nicht veröffentlichte 5' Sequenz von MLK1 zusammen mit einem Teil der zuvor veröffentlichten Kinasedomäne von MLK1 (Dorow, et al. Eur: J. Biochem., 1993, 213, 701–710). Die MLK1 cDNA Sequenz des EST Klons wie folgt: GAATTCGGCACGAGAGGACT CGCAGGTGTC CGGCGACGAG GGCTGGTGGA CCGGGCAGCT GAACCAGCGG GTGGGCATCT TCCCCAGCAA CTACGTGACC CCGCGCAGCG CCTTCTCCAG CCGCTGCCAG CCCGGCGGCG AGGACCCCAG TTGCTACCCG CCCATTCAGT TGTTAGAAAT TGATTTTGCG GAGCTCACCT TGGAAGAGAT TATTGGCATC GGGGGCTTTG GGAAGGTCTA TCGTGCTTTC TGGATAGGGG ATGAGGTTGC TGTGAAAGCA GCTCGCCACG ACCCTGATGA GGACATCAGC CAGACCATAG AGAATGTTCG CCAAGAGGCC AAGCTCTTCG CCATGCTGAA GCACCCCAAC ATCATTGCCC TAAGAGGGGT ATGTCTGAAG GAGCCCAACC TCTGCTTGGT CATGGAGTTT GCTCGTGGAG GACCTTTGAA TAGAGTGTTA TCTGGGAAAA GGATTCCCCC AGACATCCTG GTGAATTGGG CTGTGCAGAT TGCCAGAGGG ATGAACTACT TACATGATGA GGCAATTGTT CCCATCATCC ACCGCGACCT TAAGTCCAGC AAC (SEQ ID NR:16). Diese wird übersetzt in: NSAREDSQVS GDEGWWTGQL NQRVGIFPSN YVTPRSAFSS RCQPGGEDPS CYPPIQLLEI DFAELTLEEI IGIGGFGKVY RAFWIGDEVA VKAARHDPDE DISQTIENVR QEAKLFAMLK HPNILALRGV CLKEPNLCLV MEFARGGPLN RVLSGKRIPP DILVNWAVQI ARGMNYLHDE AIVPIIHRDL KSSN (SEQ ID NR:17).

Der 3' Abschnitt von MLK1 wurde ursprünglich durch degenerierte PCR kloniert, wie zuvor veröffentlicht (Dorow, et al., Eur. J. Biochem., 1993, 213, 701–710). Das Protokoll für das Klonieren des 3' Abschnitts von MLK1 war wie oben für MLK2 beschrieben, mit den folgenden Ausnahmen. Von den vier Klonen, die aus dem erneuten Screenen der Bibliothek mit dem 1,2 kb Klon erhalten wurden, stellten drei der vier Klone MLK1 dar. Keiner der Klone enthielt die gesamte Kinasedomäne, die durch PCR erhalten wurde.

Phagen aus 1 ml Aliquots von amplifizierten Bibliotheken (normales menschliches Kolonepithel und menschliche T84 Kolonkarzinom Zelllinien cDNA in 1 UniZAPXR (Stratagene, Kat. #937204) wurden durch Suspendieren in 20 ml Wasser lysiert und schockgefroren. Eine 5 ml Probe des lysierten Phagen wurde als eine PCR Matrize in zwei Reaktionen für jede Bibliothek verwendet. Primer, welche die Vektoren repräsentieren, wurden von den Nukleotidsequenzen, welche die Klonierungsstellen flankieren, verwendet. Im Falle der T84 Kolonzelllinien Bibliothek wurden die T3 und T7 Sequenzierprimer (Promega) verwendet. In jeder Reaktion war ein Primer von dem 3'–5' Strang des MLK1 Gens, ungefähr 100 bp von dem 5'-Ende der bekannten Sequenz. Der zweite Primer war einer der zwei Vektorprimer. Die PCR Reaktionen enthielten 1X PCR Puffer, 2,5 mM Magnesiumchlorid, 1U Taq Polymerase (alle von Bresatec), 0,2 mM dNTP und 0,4 mM jedes Primers in einer Gesamtheit von 50 ml. Die Reaktionsbedingungen waren 60 s bei 95°C, 90 s bei 52°C, 90 s bei 72°C für 30 Zyklen mit einer 15 min Extensionszeit in dem letzten Zyklus. Die PCR Produkte wurden wie oben beschrieben kloniert und sequenziert. Der längste Klon von dem Bibliotheksscreen und ein PCR Fragment, das eine zusätzliche MLK1 Sequenz einschloss, wurden zusammen ligiert, um eine 1,08 kb MLK1 cDNA in pUC18 zu bilden.

Der MLK1 Klon von der EST Datenbank wurde in den Vektor pBluescript (Stratagene) bereitgestellt. Die MLK1 cDNA von der Kolonbibliothek wurde in den EST Klon durch Spalten der zuerst genannten mit EcoR1, dem Herstellen von glatten Enden mit Klenow und dem Spalten mit Aflll ligiert. Diese isolierte Fragment wurde in die MLK1 cDNA aus der EST Datenbank, die mit Xhol gespalten wurde, mit Klenow glatte Enden erzeugt wurden und mit Aflll gespalten wurde, kloniert. Dieses neue Konstrukt wurde anschließend aus pBluescript durch Spalten mit Not1 und Apa1 ausgeschnitten und in pcDNA3-EE ligiert, der auch mit Not1 und Apa1 gespalten wurde. Alle Klonierungsübergänge wurden sequenzverifiziert.

Beispiel 21: E. coli Expression von GST-MLK3KD

pGEXKG-MLK3(KD) wurde in E. coli Stamm BL21 durch Elektroporation transformiert. Bakterien mit dem Plasmid wurden in einem 15 Liter Applikon Fermenten in 10 Liter Volumen des folgenden reichen Mediums inokuliert: 1,95 g/l K2HPO4, 0,9 g/l KH2PO4, 0,1 g/l Ampicillin, 0,3 g/l (NH4)2SO4, 0,92 g/l MgSO4·7H2O, 42,7 mg/l Na Citrat, 21,8 mg/l FeSO4·7H2O, 0,5 ml Pichia Spurenmetalle (Higgins, et al., Methods Molecular Biology, 1998, 103, 149–177), 20 g/l Casaminosäuren, 40 g/l Glycerol, 25,5 mg/l CaCl2. Die Bakterien wurden über Nacht bei 800 rpm/68% gelöstem Sauerstoff/30°C bis die Kultur einen OD600 = 4,4 erreichte, angezogen. Die rekombinante Proteinherstellung wurde durch das Hinzufügen von 1 mM Isopropyl-&bgr;-D-thiogalactosid mit fortgesetzter Fermentierung bei 25°C für bis zu 6 h induziert. Die Bakterien wurden anschließend durch Zentrifugation gewonnen, und die Zellpaste wurde gefroren bei –2°C bis zur Reinigung gelagert.

Beispiel 22: Reinigung von bakteriellen GST-MLK3KD

Teilweise gereinigtes GST-MLK3KD wurde durch Sonifizieren von 100 mg bakterieller Zellpaste in 100 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 5 mM Dithiothreitol (DTT), pH 7,5 (Puffer A) hergestellt. Die Lösung wurde auf 1% mit Triton X-100 eingestellt, anschließend auf Eis für 1 h gerührt. Eine Lösung des Überstandes wurde nach Zentrifugation für 45 min bei 20.000 × g für eine 1 h auf Eis mit 10 ml Glutathion Sepharose 4B Harz (Pharmacia), das in Puffer A äquilibriert worden war, gemischt. Das pelletierte Harz wurde zweimal mit 12,5 × Volumen Puffer A gewaschen, anschließend mit 20 ml 100 mM Tris-HCl, 150 mM NaCl, 5 mM DTT (Puffer B), enthaltend 20 mM Glutathion, pH 7,5 eluiert. Das Protein wurde über Nacht gegen Puffer B dialysiert und in Aliquots bei –80°C gelagert.

Beispiel 23: Baculovirale Expression von FLAG-MLK3 und GST-MLK3KD

Rekombinante Baculoviren, die das FLAG-MLK3 und GST-MLK3KD exprimieren, wurden aus ihren jeweiligen Transfervektoren, pFB-FLAG-MLK3 und pFB-GST-MLK3KD, unter Verwendung des BAC-TO-BAC Systems (Life Technologies) gemäß den Anweisungen des Handbuchs hergestellt. Suspensionskulturen von Sf21 Zellen (Vaughn, et al., In Vitro, 1977, 13, 213-217) wurden bei 27°C/120 rpm in ergänztem Grace Medium (Hink, Nature, 1970, 226, 466-467) mit 10% hitzeinaktiviertem fötalem Kälberserum (FBS) angezogen. Um rekombinantes FLAG-MLK3 herzustellen, wurden Sf21 Zellen bei einer Dichte von 1,5 × 106 Zellen/ml ergänztem Grace Medium enthaltend 5% FBS mit einer Multiplizität der Infektion (MOI) von 3,1 infiziert, und 39 h nach der Infektion geerntet. Um rekombinantes GST-MLK3KD herzustellen, wurden Sf21 Zellen bei einer Dichte von 1,5 × 106 Zellen/ml ergänztem Grace Medium enthaltend 5% FBS mit einer MOI von 2 infiziert und 41 h nach der Infektion geerntet. In beiden Fällen wurden pelletierte Zellen in Puffer enthaltend 10 mM HEPES, 50 mM NaCI, 0,5 mM Pefabloc SC, 5 &mgr;M Pepstatin, 10 &mgr;g/ml Aprotinin, 10 &mgr;g/ml Leupeptin, pH 7,4 resuspendiert. Die Lösung des Überstandes nach Zentrifugation für 1 h bei 147.000 xg wurde auf pH 7,4 mit 3 M Tris Base erneut eingestellt und anschließend bei –70°C vor der Reinigung gelagert.

Beispiel 24: Reinigung von baculoviralem GST-MLK3KD

Teilweise gereinigtes baculovirales GST-MLK3KD wurde durch Glutathion Affinitätschromatographie hergestellt. Für 10 ml Zellextrakt (26,6 mg Gesamtprotein) wurden 1 ml Glutathion Sepharose 4B Harz (Pharmacia), das in 10 mM HEPES, 150 mM NaCl, pH 7,4 (Puffer C) äquilibriert worden war, hinzugefügt, und das Protein wurde für 45 min bei 4°C gebunden war. Das Harz wurde anschließend in Säulenformat mit 30 Säulenvolumina an Puffer C gewaschen, anschließend mit 5 Säulenvolumina von Puffer C enthaltend 20 mM Glutathion eluiert. Das vereinigte Endprodukt wurde über Nacht gegenüber Puffer C dialysiert und in Aliquots bei – 70°C gelagert.

Beispiel 25: Reinigung von baculoviralem FLAG-MLK3

Teilweise gereinigtes baculovirales FLAG-MLK3 wurde durch Antikörper Affinitätschromatographie hergestellt. Protein von 15 ml Extrakt (19,5 mg Gesamtprotein) mit zusätzlich 0,1M NaCl wurde an eine 0,25 ml Säule des M2 monoklonalen FLAG Peptid Antikörpers gebunden, der an Agaroseharz (Sigma) durch erneute Beladung (dreimal insgesamt) gebunden war. Das Harz war mit einer 5 Säulenvolumenwaschung von 50 mM Tris-HCl, 150 mM NaCl, pH 7,4 (TBS), einer 3 Säulenvolumenwaschung von 0,1 M Glycin, pH 3,5, gefolgt von einer weiteren 5 Säulenvolumenwaschung mit TBS vor der Chromatographie äquilibriert worden. Rekombinantes Protein wurde primär durch 5 Säulenvolumina an 0,2 mM FLAG Peptid (N-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys-C) (SEQ ID NR:18) in TBS eluiert. Das Protein wurde in Aliquots bei –80°C vor dem Assay gelagert.

Beispiel 26: Dominant negative Mutante: eine dominant negative Mutante der MLK Familie blockiert den Tod in differenzierten PC12 Zellen, welcher dem Entzug des Nervenwachstumsfaktors folgt

Die PC-12 Zelllinie, die von einem Rattenpheochromzytomtumor abgeleitet ist, wurde intensiv als ein neuronales Zellmodell zum Untersuchen von molekularen Vorgängen, die zu neuronalem Tod führen, verwendet (für einen Überblick, siehe Troy, et al., Adv. Neurology, 1997, 103–111). Der Nervenwachstumsfaktor (NGF) induziert PC-12 Zellen in einen sympathischen neuronalen Phänotyp zum differenzieren (Greene, Cell Biol., 1978, 78, 747–755). NGF differenzierte PC-12 Zellen sind zum Überleben von NGF abhängig und durchlaufen einen morphologisch beschriebenen apoptotischen Tod nach dem Entfernen von NGF aus dem Kulturmedium. Es wurde ein Zellsystem entwickelt, um die Wirkung von Mitgliedern der Mixed Lineage Kinase Familie auf PC-12 Zelltod nach NGF Entzug zu bestimmen. PC-12 Zellen wurden mit cDNA transfiziert, die für eine dominant negative (DN) Mutante von MLK-3 kodiert, unter Verwendung des Pfx Lipid Transfersystems, wie durch den Hersteller (Invitrogen, Carlsbad, CA) empfohlen. Ein stabiler Pool von Transfektanten, die DN-MLK-3 exprimieren, wurde unter Verwendung von G418 Sulfat (Meidatech Inc., Herndon, VA) selektiert. Ungefähr 30% der Zellen dieser Pools exprimieren DN MLK3, wie durch Immunhistochemie bestimmt wurde. Pools von Zellen, welche die mutante Kinase stabil exprimieren, wurde auf Polyornithin/Laminin (10 &mgr;g/ml jeweils in Phosphat gepufferter Salzlösung) beschichteten Gewebekultur 96-Vertiefungsformatplatten in einer Dichte von 2 × 104 Zellen/Vertiefung ausplattiert und mit 100 ng/ml NGF für 7 Tage behandelt. Das Medium mit NGF wurde entfernt, der Zellmonolayer mit Phosphat gepufferter Salzlösung gewaschen, und das Medium mit neutralisierendem NGF Antikörper (Kat. #N6655; Sigma, St. Louis, MO) in einer Endverdünnung von 1:1000 wurde für 1–5 Tage ersetzt. Die Zelllebensfähigkeit wurde durch einen Zelllebensfähigkeitsassay unter Verwendung der Umsetzung des Tetrazoliumsalzes, MTS, in ein gefärbtes Formazan quantifiziert, das bei einer Absorption von 570 nm auf einem CytoFluor 2350 (Millipore, Bedford, MA) wie durch den Hersteller empfohlen (Promega, Madison, WI) ausgelesen wurde. Stabile Pools, die DN-MLK-3 exprimieren, wurden teilweise von dem Zelltod, der durch NGF Entzug verursacht wird, gerettet (10).

Beispiel 27: Assay für enzymatische Aktivität von rekombinantem MLK Protein

Um zu zeigen, dass das MLK Protein, das in entweder dem Baculovirus oder bakteriellen Expressionssystem exprimiert wird, enzymatisch aktiv ist, wurden einige Assayformate verwendet. Das MLK Protein kann ein Gesamtlängenkonstrukt oder eine Kinasedomäne sein, das/die entweder in einem Baculovirus oder bakteriellen Expressionssystem exprimiert wird. Der Assay kann Antikörper basiert sein, wie ein Enzym basierter Immunosorbent Assay (ELISA), Zeitauflösungsfluoreszenz (TRF) oder Fluoreszenzpolarisation (FP). Der Antikörper kann monoklonal oder polyklonal mit Reaktivität gegenüber Phosphoserin, Phosphothreonin oder phospho-spezifischem Substrat sein. Alternativ dazu kann ein nicht Antikörper basiertes Verfahren verwendet werden, wie ein radioaktiver Gel basierter Assay (siehe 11), Multiscreentrichloressigsäure (TCA) Präzipitationsassay ( 13), Szintillations Proximity Assay (SPA), Flashplate Verfahren oder Phosphocellulose Filter Assay Format (13). Der Assay kann ausgelegt sein, um die direkte Phosphorylierung eines Substrats zu überwachen, oder er kann ein Assaysystem sein, das die Downstreamkinasen in dem Signalweg verwendet. Das Substrat kann ein spezifisches Substrat, wie SEK-1 oder ein relativ unspezifisches Substrat, wie das Myelin basische Protein (MBP) sein.

Beispiel 28: Kinaseassays: (1) Radioaktiver Gel basierter Kinaseassay

Die Kinaseaktivität von MLK-3 wurde durch Überwachen des Einbaus von 32P aus [&ggr;-32P]-ATP in ein Substrat von MLK (z.B. Kinease-totes SEK-1; Myelin basisches Protein) getestet. Die 50 &mgr;l Assaymischung enthielt Puffer A (20 mM MOPS, pH 7,2, 25 mM &bgr;-Glycerolphosphat, 5 mM EGTA, 1 mM Natriumorthovanadat, 1 mM Dithiothreitol), 15 mM MgCl2, 100 &mgr;M ATP, 10 &mgr;Ci [&ggr;-32P]-ATP und 0,1 &mgr;g Kinasetotes SEK-1 Substrat (Stressgen, Inc.; gebundene Glutathion S-Transferase-SEK-1 (GST-SEK-1) wurde von den Glutathion-Agarosekügelchen mit 10 mM Glutathion, pH 8,0 freigesetzt) oder 25 &mgr;g MBP (Sigma Chemical Co.). Die Reaktion wurde durch Hinzufügen von MLK Protein (Kinasedomäne oder Präparation mit sowohl Gesamtlängen als auch Kinasedomäne) oder Kontrollprotein gestartet. Die Mischung wurde für 30 Minuten bei 30°C inkubiert. Am Ende der Reaktion wurde 2× reduzierender Probenpuffer hinzugefügt. Die Mischung wurde für 5 min aufgekocht, auf entweder ein 12% SDS-PAGE Gel (unter Verwendung von MBP als Substrat) oder ein 8% Gel (SEK-1 als Substrat) geladen. Nach der Elektrophorese wurde das Gel getrocknet. Die Quantifizierung des Phosphateinbaus in das Substrat SEK-1 wurde auf einem Molecular Dynamics Phosphoimager (Sunnyvale, CA) durchgeführt. Die Ergebnisse von Experimenten, die durchgeführt wurden, um die enzymatischen Aktivitäten von Baculovirus exprimierter MLK-3 (FLAGmarkiertes Gesamtlängen oder GST-markierte Kinasedomäne) unter Verwendung von Kinase-totem GST-SEK-1 oder MBP als Substrat zu zeigen, sind in den 11A und 11B gezeigt.

(2) Western Blot Analyse

Die Kinaseaktivität von Baculovirus exprimierter MLK-3 wurde durch Immunblot Analyse untersucht. Die 20 &mgr;l Assaymischung enthielt Puffer A, 15 mM MgCl2 , 100 &mgr;M ATP und 0,1 &mgr;g Kinase-totes SEK-1-Substrat. Die Reaktion wurde für 30 min bei 30°C fortgesetzt, anschließend mit 10 &mgr;l 4 × reduzierendem Probenpuffer gequenscht. Die Proteine wurden auf einem 8% Tris-Glycingel getrennt und elektrophoretisch auf eine Immobilon PVDF Membran transferiert. Die Membran wurde mit phospho-spezifischem SEK-1 (Thr223) Antikörper (New England Biolabs, Inc.), gefolgt von Meerrettichperoxidase markiertem Ziege Anti-Kaninchen IgG (Bio-Rad) inkubiert. Der Nachweis der immunreaktiven Banden wurde via enhanced Chemilumineszenz (Amersham) durchgeführt. Die Phosphorylierung von Kinase-totem GST-SEK-1 durch FLAG-MLK-3 Protein Baculoviruspräparation enthaltend sowohl Gesamtlängen als auch Kineasedomäne) ist in 12 dargestellt.

(3) Multiscreen Trichloressigsäure (TCA) Präzipitationsassay

Die Kinaseaktivität von bakteriell exprimierter GST-MLK-3 Kinasedomäne wurde unter Verwendung des Millipore Multiscreen Trichloressig (TCA) "in-plate" Assays der von Pitt, et al., J. Biomol. Screening, 1996, 1, 47–51 beschrieben wurde, untersucht. Die Assays wurden in 96 Vertiefungs Multiscreen Durapore Platten (Millipore) durchgeführt. Jede 50 &mgr;l Assaymischung enthielt 20 mM HEPES, pH 7,4, 20 mM MgCl2, 20 mM MnCl2, 2 mM DTT, 0,1 mM Na3VO4, 1 &mgr;Ci [&ggr;-P32] ATP und 39 &mgr;g MBP Substrat. Die Reaktion wurde durch Hinzufügen von MLK Protein gestartet und für 15 min bei 37°C fortgesetzt. Die Reaktion wurde mit 25 &mgr;l 50% TCA gestoppt. Die Platten wurden für 30 min bei 4°C äquilibriert, anschließend mit eiskaltem 25% TCA gewaschen. Der Szintillationscocktail wurde zu den Platten hinzugefügt, und die Radioaktivität wurde unter Verwendung eines Wallac MicroBeta 1450 PLUS Szintillationszählers bestimmt. Die Proteindosisantwort gegenüber der Bildung von 32P-markiertem MBP ist in 13 gezeigt.

(4) Phosphocellulose Filter Assay

Der Kinaseassay wurde in einer 50 &mgr;l Reaktionsmischung enthaltend 20 mM HEPES, pH 7,4, 20 mM MgCl2, 20 mM MnCl2, 2 mM DTT, 0,1 mM Na3VO4, 1 &mgr;Ci [&ggr;-P32] ATP und 30 &mgr;g MBP durchgeführt. Die Reaktion wurde durch Hinzufügen von MLK Protein gestartet und für 15 min bei 37°C fortgesetzt. Die Reaktion wurde mit 75 &mgr;l 75 mM Phosphorsäure gestoppt. Ein Aliquot der gequenschten Lösung wurde direkt auf die Phosphocellulosemembran (Pierce) geladen. Alternativ dazu kann eine 96 Vertiefungsphosphocellulose Multiscreen Platte (Millipore) verwendet werden. Die Membranen wurden mit 75 mM H3PO4 gewaschen. Das gebundene 32P-markierte phosphorylierte MBP wurde in Sammelröhrchen durch Hinzufügen von 1M Natriumhydroxid eluiert. Die Radioaktivität wurde durch Cerenkov Zählen in einem Beckman Szintillationszähler (Somerset, NJ) gezählt. Die Bildung von phosphoryliertem MBP mit steigenden Konzentrationen von bakteriell exprimierter GST-MLK-3 Kinasedomäne ist in 13 gezeigt.

Beispiel 29: Assay, um die Bindung von Verbindungen an die rekombinante MLK Familie zu bestimmen

K-252a (Verbindung III-3; siehe Tabelle 4), ein Indolocarbazolmetabolit von Nocardia Spezies bindet an eine Vielzahl von Serin/Threonin und Tyrosinkinasen (Angeles, et al., Anal. Biochem., 1996, 236, 49–55; Knight, et al., Anal. Biochem., 1997, 247, 376–381). Ein tritierter K-252a Ligand wurde verwendet, um die Bindung von humanem rekombinantem Gesamtlängen MLK-3 aus einer Rohpräparation von Baculovirus infizierten Zellen zu untersuchen. [3H]K-252a wurde spezifisch mit Tritium in den 3 und 9 Positionen durch einen Vertrag mit NEN Research Products (Billerica, MA) markiert und wies eine spezifische Aktivität von 40 Ci/mmol auf. Die Bindungsreaktionen wurden in 1 ml in einer 96 Vertiefungsplatte durchgeführt. Die Reaktionsmischung enthielt 50 mM MOPS Puffer, pH 7, 150 mM NaCl, 5 mM MnCl2, 1 mg/ml BSA, 1% DMSO und 0,25 nM [3H]K252a. Die Proben wurden dreifach mit einer Konzentration von 5 &mgr;g/ml von rohem Baculovirus abgeleiteter MLK-3 durchgeführt. Die nicht spezifische Bindung wurde definiert als Bindung in Anwesenheit von unmarkiertem 1,2 &mgr;M K252a und wurde von der Gesamtbindung abgezogen, um die spezifische Bindung zu erhalten. Bei dieser Verdünnung waren 12–15% der Gesamtzerfälle nicht spezifisch an Protein gebunden, und 75–85% dieser Zerfälle waren spezifisch an MLK-3 (14) gebunden. Alle Experimente wurden für 2 h bei 4°C durchgeführt. Die [3H]K252a/MLK-3 Komplexe wurden auf GF/C Wahtman Filtern unter Verwendung eines Brandel Harvesters gesammelt, mit kaltem MOPS/NaCl Puffer gewaschen und auf einem Wallac Micro Beta Zähler gezählt. Ein Sättigungsbindungsexperiment wurde durchgeführt, um einen Kd für K252a zu erhalten. Ein Beispiel der Ergebnisse aus einem dieser Experimente ist gezeigt (14). Ein Kd von 0,89 nM (Confidence Grenzen: 0,2 bis 1,5 nM) wurde erhalten.

Beispiel 30: Intakte Zellassays (A) Cos 7 Überexpressionssystem Materialien

K-252a und Derivate dieser Verbindung wurden durch Kyowa-Hakko Kogyo Co. Ltd. (Tokio, Japan) (Kaneko et al., 1997) bereitgestellt. Die Verbindungen wurden in Dimethylsulfoxid (DMSO) mit Zellkulturreinheitsgrad gelöst und im Dunkeln bei 4°C gelagert. Alle Verdünnungen der Verbindungen wurden in Dulbecco's modifiziertem Eagle's Medium (DMEM) enthaltend 1% Rinderserumalbumin hergestellt. Der Hämaglutinin (HA) Antikörper wurde von BAbCO (Richmond, CA) gekauft. Das AP-1 (c-jun) Substrat wurde von Promega (Madison, WI) gekauft. Das [&ggr;-32P]ATP (6000 Ci/mmol) wurde von Amersham (Arlington Heights, IL) gekauft.

Cos7 Zellkultur

Grüne Affennieren Cos7 Zellen wurden von ATCC, Rockville, Maryland (CRL 1651) erhalten und in DMEM enthaltend 10% Rinderserum, 2 mM Glutamin, 1 mM Pyruvat, 50 U/ml Penicillin/Streptomycin bei 37°C in 10% CO2, 90% Luftatmosphäre gehalten. Die Cos7 Zellen wurden zum Passagieren durch Hinzufügen von 0,25% Trypsin abgelöst.

(1) Überexpression von MLK Familienmitgliedern und JNK1 in Cos7 Zellen

Die Cos7 Zellen wurden bei 80% Konfluenz ausplattiert und mit jeweils 2 &mgr;g der cDNA Konstrukte unter Verwendung von Lipofectamin, wie durch den Hersteller empfohlen (Gibco BRL, Gaithersburg, MD) transfiziert. Eine Gesamtlängen cDNA von humaner MLK-3, MLK-2 oder Maus DLK oder eine teilweise humane MLK-1, wie oben beschrieben, und eine Gesamtlängen Hämaglutinin A-markierte humane JNK1, freundlicherweise von J. Silvio Gutkind (NIH, Bethesda, MD) zur Verfügung gestellt, wurden in den pcDNA3 Vektor (Invitrogen, San Diego, CA) subkloniert.

Nach einer 48 h Transfektion wurden die Zellen mit 0,025% DMSO oder 500 nM der angegebenen Verbindungen für 2 h behandelt, gefolgt durch Lyse in 0,4 ml Triton Puffer (1% Triton X-100, 50 mM Natriumchlorid, 10 mM Tris (pH 7,6), 0,1% Rinderserumalbumin, 30 &mgr;M Natriumpyrophosphat, 50 mM Natriumfluorid, 20 &mgr;g/ml Aprotinin, 1 mM Phenylmethylsulfonylfluorid, 1 mM Natriumvanadat). Die JNK Aktivität aus dem Lysat wurde durch einen Immunpräzipitation/Kinaseassay, wie unten beschrieben, untersucht.

(2) Immunpräzipitation und Kinaseassay von gesamten Zellen

Das Lysat von Cos7 Zellen wurde hinsichtlich Proteinkonzentration unter Verwendung des Micro BCA Kits von Pierce (Rockford, IL) untersucht, und gleiche Mengen an Protein wurden mit dem HA Antikörper für 1 h bei 4°C immunpräzipitiert. Die Immunpräzipitate wurden durch Zentrifugation in einer Mikrofugenzentrifuge für 20 sek. pelettiert, in Triton Puffer resuspendiert, durch Zentrifugation weitere 2 mal gewaschen, gefolgt von einer finalen Waschung im Kinasepuffer (20 mM Hepes pH 7,4, 20 mM MgCl2, 2 mM Dithiothreitol, 0,1 mM Natriumvanadat). Die Immunpräzipitate wurden in Kinasepuffer enthaltend 1 &mgr;M ATP und 5 &mgr;Ci [&ggr;-32P]ATP und Substrat (1 &mgr;g/Probe von AP-1) resuspendiert und für 15 min bei 30°C inkubiert. Die Kinasereaktion wurde durch Hinzufügen von reduzierendem Probenpuffer (Laemmli, Nature 1970:227, 680–685) gestoppt. Die Proben wurden auf 80°C für 5 min erhitzt und auf 10% SDS-Polyacrylamidgele geladen. Die Proteine wurden durch Elektrophorese getrennt. Das Gel wurde getrocknet, und die Quantifizierung der Radioaktivität in dem AP-1 Substrat wurde auf einem Molecular Dynamics Phosphorimager (Sunnyvale, CA) durchgeführt. Die Ergebnisse von Experimenten, in denen MLK-3, MLK-2 und DLK mit HA-JNK1 coexprimiert werden und in der Abwesenheit oder Anwesenheit von K-252a inkubiert werden, sind in den 15A und 15B gezeigt. Im Gegensatz dazu interferierte ein Derivat der parenteralen K-252a Verbindung, die als Verbindung III-3 (siehe Tabelle 4) bezeichnet wurde, die ein selektiverer Kinaseinhibitor ist, nicht mit dem JNK Weg, der durch eine andere MAPKKK oberhalb von JNK, MEKK1 (15C) aktiviert wurde.

(B) Gesamtzell Reporterassay für MLK aktivierte JNK

Versuche, Klone, welche die MLK Familie konstitutiv exprimieren, abzuleiten, waren nicht erfolgreich, was nahe legt, dass die Überexpression der MLK's das Zellüberleben beeinflussen kann (Bergeron, et al., Biochem. Biophys. Res. Commun., 1997, 231, 151–155; Nagata, et al., EMBO J., 1998, 17, 149–158). Deshalb kann in der Entwicklung eines Gesamtzellassays für das Verfolgen von MLK induzierten biochemischen Ereignissen eine Zelllinie mit einem genetisch veränderten induzierbaren Expressionssystem der interessierenden Kinase benötigt werden. Zum Beispiel eine PC-12 Zelllinie, die mit einem Tetracyclin kontrollierten Transaktivator transfiziert ist. Wenn die Zellen weiterhin mit einem interessierenden Gen transfiziert werden, das durch den induzierbaren Promotor tetO angetrieben wird, ist die Expression dieses Gens streng durch Tetracyclin in dem Medium kontrolliert (Shockett, et al., Proc. Natl. Acad. Sci USA, 1995, 92, 6522).

Um die Aktivierung von MLK zu quantifizieren kann man die Phosphorylierung von Downstream Substraten, wie MEK4, JNK oder c-jun in multiplen Assayformaten, wie oben beschrieben, messen. Ein anderer Ansatz, um die MLK Aktivierung in Gesamtzellen zu quantifizieren, ist es, eine Reporterenzymaktivität, wie das c-jun Luciferase Reportersystem, das kommerziell durch das PathDetectTM System (Stratagene, La Jolla, CA) erhältlich ist, zu verwenden. In diesem System wird die Tetracyclin induzierbare Zelllinie mit zwei Plasmiden transfiziert. Ein Plasmid exprimiert konstitutiv eine Fusion aus der cJun NH2-terminalen transaktivierenden Domäne mit der Hefe GAL4 DNA Bindungsdomäne (cJun-DBD Fusionsprotein). Das andere Plasmid trägt die kodierenden Sequenzen für Firefly Luciferase, angetrieben durch fünf Tandem Repititionen der GAL4 Bindungsstelle. Nach Aktivierung von MLK wird das Downstream Substrat von JNK, cJun-DBD Fusionsprotein, phosphoryliert, es bindet an die GAL4 Bindungsstellen und induziert die Luciferase Gentranskription. Die Luciferase wird einfach in Zelllysaten durch Addition ihres Substrats (Promega, Madison, WI) und Messung der Chemilumineszenz untersucht.

Beispiel 31: Assoziation von Inhibierung von MLK Familienmitgliedern mit motorischen Neuronen und kortikalem Überleben Überleben von Ratten Rückenmarkskulturen, die mit motorischen Neuronen angereichert sind

Rückenmark wurde von Spraque-Dawley Rattenföten (Charles River Laboratories, Wilmington, MA) des embryonalen Alters (E) von 14,5–15 herausgeschnitten. Nur Zellen von dem ventralen Abschnitt des Rückenmarks wurden dissoziiert und weiter hinsichtlich motorischer Neurone durch Zentrifugation auf einem 6,5% Schritt Metrizamidgradienten, wie zuvor beschrieben, angereichert (Henderson, et al., 1993), und sie wurden hinsichtlich Reinheit durch Färben mit niedrig affinem Neurotrophinrezeptor Antikörper (IgG-192, Boehringer-Mannheim) (Daten nicht gezeigt) gefärbt. Die Zellen wurden auf 96 Vertiefungsplatten, die zuvor mit poly-1-Ornithin und Laminin (jeweils 5 &mgr;g/ml) beschichtet worden waren, in einer Dichte von 6 × 104 Zellen/cm2 in chemisch definiertem serumfreien N2 Medium (Bottenstein, et al., 1979, supra) ausgesät. Um Anheftungs- von Überlebenseffekten zu trennen wurden die Verbindungen zu den Kulturen nach dem anfänglichen Anheftungszeitraum von 1–3 h hinzugefügt. Das neuronale Überleben wurde nach Tag 4 durch Calcein AM (Molecular Probes, Eugene, OR) in einem fluorometrischen Überlebensassay (Bozyczko-Coyne, et al., 1993, supra) bewertet. Die mikroskopischen Zählungen von Neuronen korrelierten direkt mit dem relativen Fluoreszenzwerten. Kurz gesagt wurde Kulturmedium in einer Reihe in DPBS (Dulbecco's Phosphat gepufferte Salzlösung) verdünnt, und eine Endkonzentration von 6 &mgr;M Calcein AM Stock wurde anschließend zu jeder der 96 Vertiefungen hinzugefügt. Die Platten wurden für 30 Minuten bei 37°C inkubiert, gefolgt von Waschungen der Verdünnungsreihe in DPBS. Das Fluoreszenzsignal wurde unter Verwendung eines Plattenlesefluorimeter von Millipore (Cytofluor 2350) bei einer Exzitation = 485 nm und eine Emission = 538 nm ausgelesen. Bei jeder Platte wurde der durchschnittliche Hintergrund, der von Zellen, die Calcein AM erhalten hatten, aber keine Zellen enthielten, erhalten wurde, von allen Werten abgezogen. Die Linearität des Fluoreszenzsignals wurde für die Konzentration und Inkubationszeit für den Bereich der Zelldichten in diesen Experimenten verifiziert. Ein Beispiel für das prozentuale Überleben über der Kontrolle von motorischen Neuronen in der Anwesenheit von Testverbindungen bei 250 nM ist in Tabelle 3 gezeigt.

Überleben von kortikalen Neuronen

Zerebrale Kortices wurden von Rattenföten am embryonalen Tag 18 herausgeschnitten und enzymatisch gespalten, um eine Einzelzellsuspension zu erhalten. Die Zellen wurden in einer Dichte von 1,56 × 105/cm2 auf poly-Ornithin/Laminin beschichteten 96 Vertiefungszellkulturplatten in serumfreiem neutralem basalem Medium enthaltend B27 Ergänzungen aufplattiert. Die Platten wurden mit einer Lösung aus poly-Ornithin/Laminin (jewils 8 &mgr;g/ml), die in PBS hergestellt wurde, für mindestens 2 h bei 37°C beschichtet. An den in vitro Tagen 5–7 wurden die kortikalen Neuronen gegenüber Ab25-35 (20 &mgr;M) entweder in der Anwesenheit oder Abwesenheit von Testverbindungen ausgesetzt. Es wurden Ab25-35 (Sigma, St. Louis, MO) Stocklösungen (1 mM) in deionisiertem destilliertem sterilem H2O hergestellt. Das relative neuronale Überleben wurde 48 h nach dem Hinzufügen von Peptid unter Verwendung der Lactatdehydrogenase (LDH) Freisetzung als einen Indikator von Plasmamembranintegrität/Zellüberleben bestimmt. Die LDH wurde unter Verwendung des Zytotoxizitäts Nachweiskits (Boehringer-Mannheim, Indianapolis, IN) in Übereinstimmung mit den Anweisungen des Herstellers gemessen. Die Daten sind als prozentuale Inhibition von LDH, das freigesetzt wurde relativ zu Kulturen, die mit Ab25-35 alleine behandelt wurden, ausgedrückt.

Tabelle 3 Verbindung weist die Formel III auf, wobei Z, Z, R und R H sind; X COCH ist; und R OH ist. Verbindung weist die Formel III auf, wobei Z und Z H sind; X COCH ist; R und R CHSCHCH sind; und R OH ist. Verbindung weist die Formel I auf, wobei A, A, R, R, R und R H sind; B und B zusammen O darstellen; R CHCHOAc ist; R CHCH(2-Pyridyl) ist; und H CH ist. Verbindung weist die Formel I auf, wobei A, A, R, R, R und R H sind; B und B zusammen O darstellen; R H ist; R CHCH(2-Pyrimidinyl) ist; und X CH ist.
Beispiel 32: Immunpräzipitation von endogener JNK Aktivität von Kulturen von motorischen Neuronen in der Abwesenheit und Anwesenheit von Indolocarbazolen oder fusionierten Pyrrolocarbazolen

Gereinigte motorische Neurone wurden in einer Dichte von 6 × 104 Zellen/cm2 in 16 mm Durchmesser Vertiefungen ausplattiert. Die Zellen hefteten sich 2 Stunden vor der Behandlung an. Die Zellen wurden mit entweder 0,0125% DMSO oder 500 nM Verbindung für 2 h in N2 definiertem Medium behandelt. Die Zellen wurden danach in eiskalter Phosphat gepufferter Salzlösung gespült, gefolgt durch Lyse in 0,4 ml Triton Puffer, wie oben in Beispiel 30 beschrieben. Das Lysat von

Kulturen aus motorischen Neuronen wurde hinsichtlich der Zellzahl normalisiert und mit einem JNK1 Antikörper (Kat. #sc-474), der von Santa Cruz Biotechnology (Santa Cruz, CA) gekauft wurde, immunpräzipitiert. Die JNK Aktivität von den Immunpräzipitaten wurde in der Anwesenheit von 32P-ATP und c-jun Substrat, wie oben beschrieben, untersucht. Das Profil der inhibitorischen Aktivität der vier Testverbindungen wurde in motorischen Neuronen und in Cos7 Zellen, die entweder DLK, MLK-1, MLK-2 oder MLK-3 (Tabelle 3) überexprimieren, verglichen.

Beispiel 33: Zusammenhang zwischen Inhibierung von MLK3 induzierter JNK Aktivität in Cos7 Zellen und Cholinacetyl Transferaseaktivität in primären embryonalen Kulturen

Um zu bestimmen, ob die Inhibierung des durch diese Kinasen regulierten JNK Weges mit neurotrophinen Verbindungen korrelierte, untersuchten wir die Wirkung von Verbindungen auf JNK Aktivität in Cos7 Zellen, die HA-JNK und MLK3 überexprimieren. Nach einem 48 h Transfektionszeitraum wurden die Zellen mit Verbindungen bei 500 nM für 2 h inkubiert, gefolgt durch zelluläre Lyse. Die Lysate wurden immunpräzipitiert, und die Kinaseaktivität wurde wie zuvor beschrieben gemessen. Die Ergebnisse sind als prozentuale Inhibition der Kontrollprobe angegeben, wobei die Kontrolle die JNK Aktivität in der Anwesenheit von DMSO ist. Wie aus Tabelle 4 entnommen werden kann, waren die meisten Verbindungen, die im Rückenmark und/oder der basalen Vorderhirn ChAT Aktivität aktiv waren, potente Inhibitoren der MLK-3 Aktivierung von JNK.

Tabelle 4 Wirkung von Indolo- und Indenocarbazolen auf die JNK Aktivität in Cos7 Zellen, die MLK3 überexprimieren Verbindung mit Formel III, wobei Z und Z H sind; X COCH ist; R NHCONHCH ist; R CHCH(2-Pyridyl) ist; und R OH ist. Verbindung mit Formel III, wobei Z und Z H sind; X COCH ist; R und R CHOCHOCHCH sind; und R OH ist. Verbindung mit Formel III, wobei Z und Z H sind; X COCH ist; R und R CHSCHCH sind; und R OH ist. Verbindung mit Formel I, wobei A, A, R, R und R H sind; B und B zusammen O darstellen; R CHCHOH ist; R und R OCH ist; und X CH ist.
Verbindung mit Formel I, wobei A, A, R, R, R und R H sind; B und B zusammen O darstellen; R CHCHOAc ist; R Br ist; und X CH ist. Verbindung mit Formel I, wobei A, A, R, R, R und R H sind; B und B zusammen O darstellen; R CHCHOAc ist; R CHCH(2-Pyridyl) ist; und X CH ist. Verbindung mit Formel I, wobei A, A, R, R, R, R und R H sind; B und B zusammen O darstellen; R CHCHOH ist; und X CH ist. Verbindung mit Formel I, wobei A, A, R, R, R, R und R H sind; B und B zusammen O darstellen; R CHCHCHOH ist; und X CH ist. Verbindung mit Formel I, wobei A, A, R, R, R, R, R und R H sind; B und B zusammen O darstellen; und X S ist. Verbindung mit Formel I, wobei A, A, R, R, R, R und R H sind; B und B zusammen O darstellen; R CHCHCHNHCO(4-(OH)Ph) ist; und X CH ist. Verbindung mit Formel III, wobei Z, Z, R und R H sind; X CO(CH)CH ist; und R OH ist. Verbindung mit Formel III, wobei Z, Z und R H sind; R CHOH ist; X COCH ist; und R OH ist. Verbindung mit Formel III, wobei Z und Z zusammen =O bilden; R und R Br sind; X COCH ist; und R OH ist. Verbindung mit Formel I, wobei A, A, R, R, R und R H sind; B und B zusammen O darstellen; R H ist; R CHCH(2-Pyrimidinyl) ist; und X CH ist. Verbindung mit Formel III, wobei Z und Z H sind; R Br ist; R I ist; X COCH ist; und R OH ist. Verbindung mit Formel III; wobei Z, Z, R und R H sind; X COCH ist; und R OH ist. Verbindung mit Formel III, wobei Z und Z H sind; R und R CHCHSCH sind; X COCH ist; und R OH ist. Verbindung mit Formel I, wobei A, A, R, R, R, R und R H sind; B und B zusammen O darstellen; R CHCH(2-Pyridazinyl) ist; und X CH ist. Verbindung mit Formel I, wobei A, A, R, R, R und R H sind; B und B zusammen O darstellen; R H ist; R CHCH(2-Pyridyl) ist; und X CH ist. Verbindung mit Formel III, wobei Z, Z, R und R H sind; X COCH ist; und R OCH ist. Verbindung mit Formel I, wobei A, A, R, R, R, R und R H sind; B und B zusammen O darstellen; R (CH)-NH-(C=O)-3,5-Dihydroxyphenyl ist; und X CH ist. Verbindung mit Formel I, wobei A, A, R, R, R, R und R H sind; B und B zusammen O darstellen; R Benzoyl ist; und X CH ist. Verbindung mit Formel I, wobei A, A, R, R, R, R und R H sind; B und B zusammen O darstellen; R CH=CH-C≡N ist; und X CH ist. Beispiel 34: Gel Shift Assay für MLK Aktivierung:

Die Aktivierung von MLKs kann zur c jun Transkription führen, was zu gesteigertem c-Jun Protein führt. Die gesteigerte Menge an c-Jun Protein kann durch einen Standardassay, der als ein Gel Shift Assay bezeichnet wird, gemessen werden Garnen, et al., Nucleic Acids Res., 1981, 9, 3047–3060, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist. Radioaktiv markierte doppelsträngige DNA Oligomere, die für eine c-Jun DNA Bindungsstelle kodieren, werden mit einem Zellkernextrakt inkubiert, gefolgt von Acrylamidgelelektrophorese und Quantifizierung der radioaktiv markierten DNA, die auf eine geringere Mobilität geshiftet wurde. Dies stellt den Anteil von DNA dar, der an das c-Jun Protein gebunden ist und ist direkt proportional zu der Menge des c-Jun Proteins in dem Extrakt.

Die Aktivierung von MLKs kann auch die c-Jun Phosphorylierung induzieren. Dies kann unter Verwendung von Antikörpern nachgewiesen werden, die spezifisch die phosphorylierte Form des Proteins in Nachweissystemen, wie zum Beispiel Western Blots oder ELISAs erkennen.

Beispiel 35: Überleben embryonaler Neurone des Huhns Materialien

Leibovitz's L15 Medium, Glucose, Natriumbicarbonat, Trypsin und Antikörper stammten von Gibco. Der Muskelextrakt wurde hergestellt, wie beschrieben (Henderson, et al., Nature, 1983, 302, 609–611, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist). Alle anderen Reagenzien stammten von Sigma, außer es ist anders angegeben.

Zellkultur

Motorische Neurone (embryonaler Tag 5,5) wurden mit einem immunologischen Verfahren gemäß dem Verfahren, das in Bloch-Gallego, et al., Development, 1991, 111, 221–232, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist, isoliert, mit Modifikationen, wie beschrieben in Weng, et al., Neuro-Report, 1996, 7, 1077–1081, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist). Die gereinigten motorischen Neurone wurden auf 35 mm Zellkulturschalen (Nunc) ausgesät, die mit poly-DL-Ornithin und Laminin (1 &mgr;g/ml, Upstate Biotech) vorbeschichtet worden waren. Das Kulturmedium war L15 mit Natriumbicarbonat (22,5 mM), Glucose (20 mM), Progesteron (2 × 10–8 M), Natriumselenit (3 × 10–8 M), Conalbumin (0,1 mg/ml), Insulin (5 &mgr;g/ml), Penicillin-Streptomycin und 10% hitzeinaktiviertem Pferdeserum. Die Verbindung III-3 wurde als eine 4 mM Stocklösung in DMSO hergestellt und lichtgeschützt bei 4°C gelagert. Die Endkonzentration von DMSO in behandelten und Kontrollkulturen betrug 0,125%.

Paravertebrale sympathische Ganglien (SG; embryonaler Tag 12(E12)), dorsale Wurzelganglien (DRG; E9) und Ziliarganglien (CG; E8) wurden aus Hühnerembryos am angegebenen embryonalen Tag herausgeschnitten, wie in Lindsay, et al., Dev. Biol., 1985, 112, 319–328, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist, beschrieben. Nach Trypsinierung und Dissoziation wurden die Nervenzellsuspensionen auf Polyornithin-Laminin-beschichtete Kulturschalen in Ham's F14 Kulturmedium, ergänzt mit 10% Pferdeserum, ausplattiert. Unmittelbar nach dem Ausplattieren wurde Überlebensfaktoren in den folgenden Konzentrationen hinzugefügt: Nervenwachstumsfaktor (NGF), 20 ng/ml; ziliarer neurotropher Faktor (CNTF), 10 ng/ml. Die Kulturen wurden bei 37°C und 5% CO2 in einer feuchten Umgebung gehalten.

Zellzählung

Die Neuronen wurden in 35 mm Kulturschalen mit Gittern (Nunc) ausplattiert. Ausgewählte Bereiche jeder Schale, die zusammen ungefähr 10% der Oberfläche umfassen, wurden hinsichtlich der Anwesenheit von Phasen hellen Zellen unmittelbar nach dem Ausplattieren und erneut nach 48 h gescannt, um den Überlebensprozentsatz zu bestimmen. Das Zellüberleben wurde durch Vitalfärbung mit Trypan Blau (nicht gezeigt) bestätigt.

Intaktes DRG

Die Ganglien wurde in 96 Vertiefungsplatten gegeben, die zuvor mit poly-1-Ornithin und Laminin (5 &mgr;g pro/ml Phosphat gepufferter Salzlösung) in serumfreiem N2 Medium beschichtet worden waren, (Bottenstein, et al., Proc. Natl. Acad. Sci. USA, 1979, 76, 514,517, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist), das 0,05% Rinderserumalbumin (BSA) enthielt, und sie wurden für 48 h bei 37°C und 5% CO2 in einer feuchten Umgebung gehalten. Die behandelten Ganglien erhielten entweder 250 nM Verbindung III-3 oder 20 ng/ml NGF 2 h nach dem Ausplattieren.

Verbindung III-3 unterstützt das Überleben von embryonalen peripheren Neuronen aus dem Huhn in einer konzentrationsabhängigen Weise

Der Entzug von NGF aus dissoziierten Kulturen von E9 dorsalem Wurzelganglion sensorischen Neuronen (DRG) und E12 sympathischen Ganglionneuronen (SG) bewirken, dass sie eine PCD innerhalb von 48 h durchlaufen. Diese wurde verhindert durch Hinzufügen von Verbindung III-3 zu dem Kulturmedium zum Zeitpunkt des NGF Entzugs. Bei 1 &mgr;M hielt Verbindung III-3 94% der SG Neurone und 890 % der DRG Neurone nach 48 h am Leben (NGF behandelte Kontrolle: SG 65%, DRG 66%). In ähnlicher Weise förderte Verbindung III-3 das Überleben von 76% der CNTF abhängigen Ziliarganglion (CG) Neuronen nach 24 h (CNTF behandelte Kontrolle 67%). In der Anwesenheit von 10% Serum waren die Überlebenswirkungen von Verbindung III-3 konzentrationsabhängig, wobei ein Plateau bei ungefähr 1 &mgr;M für alle drei neuronalen Populationen (16A–C) erreicht wurde. Die überlebenden Neurone zeigten starkes neuritisches Herauswachsen mit dickeren und mehr gebogenen Neuriten, im Vergleich zu den Kontollkulturen (17E–H). Nach vier Tagen war die überlebensfördernde Aktivität immer noch intakt: DRG: Verbindung III-3 52%, Wachstumsfaktor behandelte Kontrolle: 41%; SG: Verbindung III-3 83%, NGF behandelte Kontrolle: 55%; CG: Verbindung III.3 58%, CNTF behandelte Kontrolle: 50%. Unter optimalen Bedingungen könnten die Kulturen mit Verbindung III-3 für eine Woche oder länger (nicht gezeigt) erhalten werden.

Verbindung III-3 unterstützt das Überleben von embryonalen motorischen Neuronen aus dem Huhn in einer konzentrationsabhängigen Weise

Kultivierte motorische Neurone des Huhns können überleben und Vorgänge in der Anwesenheit von Muskelextrakt ausweiten, wohingegen sie schnell in seiner Abwesenheit sterben. In unseren Experimenten überlebten nach 48 h 65% der motorischen Neurone in der Anwesenheit von Muskelextrakt, im Vergleich zu 14% der unbehandelten Kontrollen. In serumfreien Bedingungen war die Überlebenswirkung von Verbindung III-3 maximal bei 300 nM, und sie war sogar etwas höher (79%) als jene, die durch Muskelextrakt induziert wurde. Die Konzentrationsabhängigkeit der Überlebenswirkung von Verbindung III-3 in diesem System ist unterschiedlich zu jener in peripheren Neuronen, weil Verbindung III-3 Konzentrationen über 300 nM eine fortschreitende verringerte Wirkung (16A) zeigten. Dies könnte eine bestimmte Sensitivität von motorischen Neuronen gegenüber einigen Aspekten der Verbindung III-3 Aktivität anzeigen. Morphologisch betrachtet zeigen motorische Neurone, die mit Verbindung III-3 gerettet wurden, Phasen helle Zellkörper, und sie waren in der Lage lange Neurite auszustrecken, die geringfügig dicker erschienen, als jene, die durch Muskelextrakt induziert wurden (17). Nach vier Tagen in Kultur waren 56% der motorischen Neurone mit Verbindung III am Leben, im Vergleich zu 42% mit Muskelextrakt. Bei 300 nM überlebten Verbindung III behandelte Neurone in vitro für mindestens eine Woche (nicht gezeigt).

Verbindung III-3 fördert das Auswachsen von Neuriten von intakten dorsalen Wurzelganglien

Die Ergebnisse der obigen Experimente zeigen, dass Verbindung III-3 nicht nur das Überleben von embryonalen Neuronen aus den peripheren und zentralen Nervensystemen fördert, sondern auch zu einem robusten Auswachsen von Neuriten führt. Viele dieser Verlängerungen erschienen dicker, als jene, die sich in Anwesenheit von Wachstumsfaktoren zeigen (vergleiche 17A–D gegenüber 17E–H). Diese Wirkung wird auch in dem neuritischen Auswachsen beobachtet, das sich von intakten embryonalen dorsalen Wurzelganglien, die in der Anwesenheit von 250 nM Verbindung III-3 (18C) zeigte. Die Neurite wuchsen als Antwort gegenüber sowohl NGF (18B) als auch Verbindung III-3; jene die sich bei NGF zeigten, waren sehr viel feiner und weiter verzweigt, als jene, die in der Anwesenheit von Verbindung III-3 wuchsen, die dicker und möglicherweise faszikuliert erschienen.

Beispiel 36: In vivo Behandlung Entwicklungsregulierter motorischer neuronaler Tod im Hühnerembryo

Das vorliegende, Beispiel ist im Detail beschrieben in Glicksman, et al., J. Neurobiol., 1998, 35, 361–370, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist. Bei E6 wurde ein Fenster in die Schale von Hühnereiern (Spafas, Preston, CT) eingefügt und entweder Vehikel (5% SolutolTM HS 15, Polyethylenglykol 660 Hydroxystearat; BASF Aktiengesellschaft, Ludwigshafen, Deutschland (in Phosphat gepufferter Salzlösung, pH 7,2)) oder die spezifizierte Dosis von Verbindung III-3 in dem Vehikel wurde direkt auf die vaskularisierte Chorioallantoe Membran einmal täglich von E6 bis E9 aufgebracht, wie in Oppenheim, et al., Science, 1991, 251, 1616–1617, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist, beschrieben ist. Die Embryos wurden an E10 geopfert und ihr Rückenmark wurde entfernt, in Carnoy's Lösung fixiert (10% Eisessigsäure, 60% reines Ethanol, 30% Chloroform), für Reihenparaffinschnitte verarbeitet und mit Thionin gefärbt, Jeder 20. Schnitt des lumbaren Segment 1–8 wurde gemäß den zuvor beschriebenen Kriterien gezählt (Clarke, et al., Methods In Cell Biology: Cell Death, 1995, Schwart & Osborne, Hrsg., Academic Press, New York, S. 277–321, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist).

Entwicklungsregulierter motorischer neuronaler Tod in der neonatalen Ratte

Zeitlich nicht festgelegte schwangere Spraque-Dawley Ratten wurden von Harlan Laboratories (Indianapolis, IN) erhalten. Die weiblichen Rattenküken wurden täglich direkt subkutan (SC) über die zielperinealen Muskeln mit Verbindung III-3 in 5 % SolutolTM HS 15 oder Vehikel injiziert, gestartet am Tag der Geburt (P1) und fortgesetzt für 5 Tage (P5). A P10 oder P60 wurden die Küken enthauptet, das Blut wurde in heparinisierten kapillaren Röhrchen gesammelt, und die Region des Rückenmarks mit dem sexuell dimorphen Rückenmarkskern des Bulbocavernosus (SNB) und der perineale Bereich mit den Bulbocavernosus (BC) und Levator ani (LA) Muskeln wurden nach Perfusion der Tiere mit Salzlösung/Formalin herausgeschnitten. Die Region des Rückenmarks mit dem SNB wurde postfixiert, in Paraplast eingebettet, mit 10 &mgr;m geschnitten und mit Cresylecht Violett (Nordeen, et al., Science, 1985, 229, 671–673, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist) gefärbt. Die motorischen Neurone wurden bei X500 in Reihenschnitten vom Lumbar 5 bis zur Sakral 1 Region des Rückenmarks, wie zuvor beschrieben (Nordeen, et al., supra) gezählt. Die mikroskopische Zählung wurde an markierten Schnitten durch einen Beobachter durchgeführt, der die Behandlungsgruppen nicht kannte. Die Zählungen der motorischen Neurone wurden für die Zellgröße und Schnittdicke gesammelt (Konisgsmark, Contemporary Research Methods in Neuroanatomy, Nauta & Ebbesson, Hrsg., 1970, Springer-Verlag, New York, S. 315–340, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist), und die statische Analyse wurde durch die Analysen der Varianz (ANOVA) durchgeführt. Die perineale Muskulatur wurde postfixiert, dekalzifiziert, in Paraplast eingebettet, bei 10 &mgr;m geschnitten und Milligan's Trichrom gefärbt. Unter Verwendung von Hellfeldmikroskopie (X250) wurden BC und LA Muskeln in normalen Weibchen und Verbindung III-3 behandelten Weibchen (405 Tiere/Gruppe) als positiv sowohl hinsichtlich ihrer Lage als auch der Anwesenheit von striatischen Fasern identifiziert. Das Äußere des Muskelgewebes wurde aus alternativen Schnitten unter Verwendung eines Projektionsmikroskops (62,5) verfolgt, und der Querschnittsbereich wurde unter Verwendung eines digitalisierten Pads und einem computerbasierten morphometrischen System (Sigmascan, Jandel Scientific) gemessen. Das Muskelvolumen wurde berechnet durch Verwenden des Gesamtquerschnittsbereichs und sein Multiplizieren mit der Schnittdicke, und es wurde hinsichtlich des Prozentsatzes der bewerteten Struktur korrigiert.

Das gesammelte Blut wurde für 5 min bei Raumtemperatur zentrifugiert; anschließend wurde Plasma entfernt und bei –20°C gefroren. Die Serum Testosteronmengen (6–7 Tiere/Gruppe) wurden Radioimmunoassay nach den Verfahren, die bei Wingfield, et al., Steroids, 1975, 26, 311–327, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist, beschrieben sind, gemessen.

Axotomie induzierte motorische neuronale Dedifferenzierung in der adulten Ratte

Der linke hypoglosale Nerv wurde im Nacken von adulten weiblichen Spraque-Dawley Ratten (120–180 g) unter Neumbutol Betäubung freigelegt, und 50 &mgr;l Verbindung III-3 oder sein Vehikel (5% SolutolTM HS 15) wurden zu einem Stück GelfoamTM (AJ Buck, Owings Mills, MD) aufgebracht, anschließend um das proximale Ende des freigelegten Nervs gewickelt. Nach 7 Tagen wurden die Tiere betäubt und mit 4% Paraformaldehyd in Sorenson's Puffer, 0,07 M Phosphat, pH 7,2 perfundiert. Der Gehirnstamm wurde entfernt und 40 um dicke Reihen koronale Schnitte wurden auf einem Cryostat geschnitten (Chiu, et al., NeuroReport, 1994, 5, 693-696, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist). Jeder fünfte Schnitt wurde hinsichtlich ChAT Immunhistochemie, wie zuvor beschrieben (Chiu, et al., J. Comp. Neurol., 1993, 328, 351–363, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist) unter Verwendung einer 1:350 Verdünnung eines anti-ChAT monoklonalen Antikörpers, der von Chemicon erhalten wurde, verarbeitet. Die Zellen, die eindeutig über dem Hintergrund gefärbt waren, wurden in den gefärbten Schnitten gezählt, die Zahl der gezählten Zellen wurde als das Verhältnis der Zahl von ChAT immunreaktiven Zellen auf der axotomisierten Seite des hypoglossalen Kerns gegenüber der Zahl der immunreaktiven Zellen auf der Kontroll (nicht verletzte) Seite ausgedrückt.

Verbindung III-3 rettete Ratten embryonale motorische Neurone vor apoptotischem Tod in vitro und inhibierte einen Signalweg, der zu JNK1 Aktivierung in diesen Zellen führt (Maroney, et al., J. Neurosci., 1998, 18, 104–111, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist). Um die potenzielle Aktivität in vivo zu bestimmen, wurde Verbindung III-3 in zwei Modellen von entwicklungsreguliertem programmiertem motorischem neuronalem Zelltod und in einem Modell von Axotomie induzierter Dedifferenzierung in adulten motorischen Neuronen untersucht. In Hühnern durchlaufen ungefähr 50% der Rückenmarks motorischen Neurone PCD während E5-10 (Hamburger et al., J. Neurosci., 1982, 1, 38–55; Purves, et al., Body and Brain: A Trophic Theory of Neural Connections, 1988, Harvard University Press, Cambridge, MA, von denen hier beide durch Bezugnahme in ihrer Gesamtheit eingeschlossen sind). Die Anwendung von Verbindung III-3 auf Chorioallantoe Membran während dieses Zeitraums verhinderte den motorischen neuronalen Zelltod in einer Dosis abhängigen Weise (19). Vierzig Prozent der motorischen Neurone, die normalerweise sterben würden, wurden bei den zwei höchsten getesteten Dosen gerettet (2,3 und 7 &mgr;g/Tag), während 25% der motorischen Neurone bei niedrigeren Dosen gerettet wurden (1,2 und 1,8 &mgr;g/Tag) (19).

Während des frühen perinatalen Lebens von weiblichen Ratten (späte embryonale Stufe bis postnataler Tag (PN) 4) werden mehr als 50% der motorischen Neurone in dem SNB über PCD (Breedlove, J. Neurobiol., 1986, 17, 157–176, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist) eliminiert. In Männchen innervieren die motorischen Neurone in diesem Kern die querstreiften Penismuskeln, die in Paarungsreflexe involviert sind. Die Hodensekretion von androgenen Steroiden reduziert den SNB motorischen neuronalen Tod in Männchen und verhindert viel von der Atrophie der BG und LA Muskeln, die durch die Neurone innerviert werden. Die Verabreichung von Testosteron an weibliche Küken führte zu einer vollständigen maskulinen Zahl von SNB motorischen Neuronen (Nordeen, et al., supra) und verhinderte die BC und LA Muskelatrophie (Waiman, et al., Endocrinology, 1941, 29, 955–978, das hier durch Bezugnahme in seiner Gesamtheit eingeschlossen ist). Die tägliche subkutane Verabreichung von Verbindung III-3 (PN 1-5) an weibliche Ratten attenuierte signifikant den motorischen neuronalen Tod (20A). Das Retten vor dem SNB motorischen neuronalen Tod durch Verbindung III-3 trat bei zwei Dosen auf (0,5 und 1 mg/kg pro Tag). Bei der maximal wirksamen Dosis von 0,5 und 1 mg/kg pro Tag führte die Verabreichung von Verbindung III-3 zu einer 70% Verstärkung im motorischen neuronalen Überleben, was der Wirkung von Testosteron entspricht (20A). Die Verbindung III–3 änderte die Plasmatestosteronmengen von behandelten Weibchen nicht. Die Radioimmunmessung von Plasmatestosteronmengen in der 1 mg/kg Gruppe führte zu keinem signifikanten Unterschied im Vergleich zu der Vehikelkontrollgruppe (jeweils 0,016 ± 0,008 ng/ml und 0,029 ± 0,015 ng/ml Standardabweichung des Mittelwertes (S.E.M.)).

Um zu bestimmen, ob die Verbindung III-3 Behandlung wirksam war in der langfristigen Aufrechterhaltung von motorischem neuronalem Überleben, wurden Weibchen mit Verbindung III-3 (0,5 und 1 mg/kg pro Tag) für denselben Zeitraum PN (1–5) behandelt. Die Hälfte der Tiere in der Vehikel und in beiden Behandlungsgruppen wurden an PN10 geopfert. Die verbleibenden Tiere wurden anschließend ohne zusätzliche Verbindung III-3 Behandlung bis zur Opferung bei PN60 gehalten. Wie zuvor beobachtet wurde (20A) führt die Verbindung III-3 Behandlung zu einer 70% Verstärkung im motorischen neuronalen Überleben (20B). Darüber hinaus waren 100% dieser geretteten motorischen Neurone morphologisch 55 Tage nach der letzten Behandlung mit Verbindung III-3 (20B) identifizierbar. Die Verbindung III-3 Inhibierung von motorischem neuronalem Tod während des neonatalen Zeitraums erlaubte das motorische neuronale Überleben während des Erwachsenseins.

Trotz der eindeutigen Demonstration und der verheerenden Wirkungen von motorischem neuronalem Verlust in adulten menschlichen Erkrankungen, wie amyotrophe laterale Sklerose, sind die adulten motorischen Neurone in den meisten Tiermodellen von motorischer neuronaler Verletzung resistent gegenüber Tod. Jedoch führt eine axionale Verletzung zu morphologischen (Oppenheim, et al., supra) ebenso wie zu biochemischen Änderungen (Oppenheim, et al., supra; Rende, et al., J. Comp. Neurol., 1992, 319, 285–298, das hier durch Bezugnahme in ihrer Gesamtheit eingeschlossen ist; Chiu, et al., J. Comp. Neurol., 1993, 328, 351–363, das hier durch Bezugnahme in ihrer Gesamtheit eingeschlossen ist) in adulten motorischen Neuronen, was die degenerative Änderung nachahmen kann, die dem Tod in erkrankten degenerierten motorischen Neuronen vorausgeht. Bei Beispiel dieses Typs von Veränderung stammt von der Axotomie des hypoglossalen Nervs, der die Zunge innerviert. Ein unilateraler Schnitt durch diesen Nerv in der erwachsenen Ratte führte zu dem Verlust von 95% der ChAT immunreaktiven hypoglossalen motorischen Neurone in dem ipsilateralen Kern nach 7 Tagen (Chiu, et al., NeuroReport, 1994, 5, 693–696, das hier durch Bezugnahme in ihrer Gesamtheit eingeschlossen ist). Der Verlust in der ChAT Immunreaktivität war nicht dauerhaft. Vier Wochen nach der Axotomie hatten 100% der motorischen Neurone die Kontrollmengen der ChAT Immunreaktivität wiedergewonnen (Borke, et al., J. Neurocytol., 1993, 22, 141–153, die hier durch Bezugnahme in ihrer Gesamtheit eingeschlossen ist). Die ChAT Immunreaktivität in den kontralateralen hypoglossalen motorischen Neuronen war nicht beeinflusst (Chui, et al., supra) (21 und Tabelle 5).

Wenn sie in GelfoamTM auf das proximale Ende des hypoglossalen Nervs aufgetragen wurde, attenuierte die Verbindung III-3 dosisabhängig die Verringerung in der ChAT Immunreaktivität in ipsilateralen hypoglossalen motorischen Neuronen, die 7 Tage Postaxotomie untersucht wurden. Die maximal wirksame Dosis (50 &mgr;g) führte in 40% mehr ChAT immunreaktiven motorischen Neuronen im Vergleich zu der axotomisierten, unbehandelten Kontrolle (21B und Tabelle 5). Es gab eine glockenförmige Dosisabhängigkeit bei sowohl den niedrigeren als auch den höheren Dosen, was zu einem Überleben größer als bei der unbehandelten Kontrolle führte, aber weniger als jenes, das bei 50 &mgr;g erreicht wurde. Ebenso wie in dem SNB Modell gab es keinen assoziierten Gewichtsverlust, Sterblichkeit oder groben Gewebeschaden in diesen Tieren bei den getesteten Dosen.

In drei getrennten Modellen der motorischen Neurondegeneration in vivo zeigte Verbindung III-3 eine neuroprotektive Aktivität: entwicklungsreguliertes PCD von motorischen Neuronen des lumbaren Rückenmarks in Embryos (19), Androgen sensitiver Tod von postnatalen SNB motorischen Neuronen (20) und Axotomie induzierter Verlust eines funktionellen Markers, ChAT, in adulten hypoglossalen motorischen Neuronen (21 und Tabelle 5). Die Verbindung III-3 war wirksam, wenn sie peripher durch subkutane Injektion verabreicht wurde, lokal auf die geschnittenen Enden eines Nervs oder direkt auf die embryonale Chorionallantoe Membran von Hühnern aufgetragen wurde. Im Gegensatz zu dem Ursprungsmolekül K-252a war die Verbindung III-3 ungefähr fünffach potenter in der Vermittlung des Überlebens in Kulturen mit angereicherten motorischen Neuronen (Daten nicht gezeigt) und zeigte keine inhibitorische Aktivität gegenüber trkA Tyrosinkinase und einigen Serinthreoninkinasen (Maroney et al., supra; Kaneko, et al., J. Med. Chem., 1997, 40, 1863–1869, die hier durch Bezugnahme in ihrer Gesamtheit eingeschlossen ist).

Tabelle 5 Wirkung von Verbindung III-3 auf Cholin Acetyltransferase Immunreaktivität in axotomisierten hypoglossalen motorischen Neuronen

Die Verbindung III-3 oder Vehikel wurden in Gelschaum zu dem proximalen Ende des hypoglossalen Nervs unmittelbar nach seiner Durchtrennung hinzugefügt. Nach 7 Tagen wurden die Tiere geopfert und in Reihe durch den hypoglossalen Kern geschnitten, und jeder fünfte Schnitt wurde mit anti-ChAT Antikörpern immungefärbt. Zählungen von ChAT positiven Neuronen wurden in der ipsilateralen (experimentellen) und kontralateralen (Kontroll) Seiten des Kerns durchgeführt *p < 0,05, statistisch signifikant im Vergleich zu Kontrollvehikel behandelten Tieren.

Ein Inhibitor des MLK-3 Weges zeigt in vivo Wirksamkeit und blockiert die Phosphorylierungsereignisse downstream von MLK-3 in dem MPTP Modell

MPTP wurde in einer Dosis (40 mg/kg), welche den Verlust der striatalen dopaminergen Enden und Zellkörper in der Substantia nigra produziert, verabreicht. Tyrosinhydroxylase wurde als ein Marker für dopaminerge Nervenenden in der Substantia nigra verwendet. Systemisch verabreichte Verbindung III-3 attenuierte den Verlust der Substantia nigra Tyrosinhydroxylase immunreaktiven Neurone nach MPTP Läsion (22a; Saporita et al., 1999). Weil Verbindung III-3 ein bekannter Inhibitor von MLK3 ist, wurde die Aktivierung eines Downstream Substrats von MLK3 in MPTP behandelten Mäusen gemessen. Die Mengen an phosphorylierter MKK4 wurden unter Verwendung eines Phospho-MMK4 spezifischen Antikörpers (New England Biolabs, Beverly, MA), der die monophosphorylierte Form von MKK4 erkennt, durch entweder Immunoblot (22b) oder ELISA (22c) gemessen. Die MPTP Verabreichung erhöhte die Mengen an phosphorylierter MKK4 in der Substantia nirga auf bis 5-fach übenden Kontrollmengen (22b). Die Spitzenerhöhung trat 4 h nach Verabreichung von MPTP und gleichzeitig mit den Spitzen CNS Mengen an MPP+ auf. Die MPTP vermittelte MKK4 Phosphorylierung wurde durch Vorbehandlung mit 1-Deprenyl attenuiert, was zeigt, dass diese Phosphorylierungsereignisse durch MPP+ vermittelt werden (22c). Darüber hinaus war die MKK4 Phosphorylierung teilweise durch Verbindung III-3 Vorbehandlung bei einer Dosis (1 mg/kg) inhibiert, die Schutz gegen MPTP induzierten nigrostriatalen dopaminergen Verlust liefert (22c). Diese Daten zeigen, dass MPTP (MPP+) MKK4, ein Downstream Substrat von MLK3 aktiviert. Darüber hinaus zeigen diese Daten, dass ein bekannter Inhibitor von MLK3 die Aktivierung dieses Kinaseweges in vivo inhibiert.

Beispiel 37: Entzündung The Induktion von IL-1 and TNF-&agr; durch LPS in THP-1 Zellen und die Wirkung von Indolocarbazolen und Pyrrolocarbazolen auf ihre Induktion

Es wurden Zellen des Immunsystems ausgewählt, weil viele Kinasen in die Regulation von zahlreichen immunologischen Funktionen, z.B. die Induktion der Synthese von Cytokinen und die Induktion von biologischen Antworten auf Cytokine, involviert sind. Ein kürzlicher Bericht (Hambleton, et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 2774–2778, das hier durch Bezugnahme in ihrer Gesamtheit eingeschlossen ist) zeigte, dass die Behandlung von Zelllinien, die von Monozyten abgeleitet sind, mit LPS eine schnelle Aktivierung der JNK Aktivität verursachte.

Wenn Monozyten mit bakteriellen Endotoxinen, wie Lipopolysaccharid (LPS) in Kontakt kommen, bilden sie inflammatorische Cytokine, IL-1 und TNF-&agr;. Die Inhibierung der Produktion dieser zwei Cytokine kann eine wirksame Behandlung von gewissen entzündlichen Erkrankungen des Immunsystems sein. Diese Cytokine können einfach durch kommerzielle ELISA Kits gemessen werden. Wir haben Experimente entworfen, um zu bestimmen (1) ob Indolo- und fusionierte Pyrrolocarbazole die Synthese von IL-1 und TNF-&agr; in unserer Monozytenzelllinie THP-1 inhibieren können, (2) ob JNK durch LPS in THP-1 Zellen aktiviert wird, und (3) ob die Aktivierung von JNK durch LPS durch Indolo- und fusionierte Pyrrolocarbazole inhibiert werden kann.

Experimentelle Verfahren

Die THP-1 Zellen wurden in RPMI 1640 Medium angezogen, das mit 10% fötalem Rinderserum ergänzt war. Das LPS (E. coli Serotyp 0111.B4, TCA extrahiert) wurde von Sigma gekauft und in PBS gelöst. Die ELISA Kits zum Testen von IL-1 und TNF-&agr; wurden von Boehringer-Mannheim gekauft, und die Assays auf THP-1 Kulturmedium wurden durchgeführt, wie vom Hersteller angegeben. Es wurden Standardkurven gemäß den Richtungen für jeden Assay erhalten.

Die Experimente wurden in 12 Vertiefungskulturplatten mit entweder 1 oder 2 ml THP-1 Zellen bei 4 × 105 Zellen/ml durchgeführt. IL-1 und TNF-&agr; wurden durch das Hinzufügen von LPS zu dem Kulturmedium induziert, und das Medium wurde zu verschiedenen Zeiten danach für den Cytokinassay gesammelt. Die Zellen wurden durch Zentrifugation entfernt, und die Überstände wurden bei –70°C bis zum Assay eingefroren. Um die Kosten zu minimieren, wurden die Experimente in doppelten Kulturen durchgeführt und die doppelten Überstände wurden nach der Zentrifugation vereinigt. Jeder vereinigte Überstand wurde doppelt getestet. Die Stopplösungen von Indolo- und fusionierten Pyrrolocarbazolen in 100% DMSO wurden auf die gewünschten Konzentrationen in entweder Medium mit 10% fötalem Rinderserum oder in Medium mit 0,5 mg/ml BSA verdünnt. Außer es ist anders angegeben, wurden die Verbindungen zu den THP-1 Zellen 1 h vor dem Hinzufügen von LPS hinzugefügt.

Die Assays für die JNK Aktivität wurden nach Immunopräzipitation des JNK Proteins aus einem Extrakt von lysierten THP-1 Zellen durchgeführt. Die pelletierten THP-1 Zellen wurden auf Eis für 15 min in 500 &mgr;l Frac Puffer (10 mM Tris-HCl, pH 7,5, 50 mM NaCl, 30 &mgr;M Natriumpyrophosphat, 1 mg/ml BSA, 1% Triton-X-100) lysiert. Der Extrakt wurde für 10 min bei 14 K zentrifugiert, und 5 &mgr;l JNK Antikörper (Santa Cruz) wurden zu dem Überstand hinzugefügt. Der Extrakt wurde für 60 min bei 4°C geschwenkt, 75 &mgr;l gewaschene Protein A Sepharose (20% w/v in Frac) wurde hinzugefügt, und der Extrakt wurde für weitere 30 min geschwenkt, um den Antikörperkomplex an die Protein A Sepharose zu binden. Die Protein A Sepharose wurde zweimal mit Frac Puffer, einmal mit 20 mM Hepes, pH 7,6, 20 mM MgCl2, 2 mM DTT gewaschen, anschließend für 15 min bei 30°C in 30 &mgr;l Kinasepuffer (20 mM Hepes, 20 mM MgCl2, 2 mM DTT, 1 &mgr;g rekombinantem c-jun und 2 &mgr;M ATP-&ggr;-32P, 2 &mgr;Ci) inkubiert. Die Reaktion wurde durch das Hinzufügen von 10 &mgr;l 4 × SDS Gel Auftragspuffer beendet, für 3 min auf 80°C erhitzt, und die Proteine wurden auf einem 10% SDS Gel analysiert. Das Gel wurde getrocknet, gegenüber einer Phosphorimager Platte exponiert, und die radioaktiven Banden wurden auf einem Phosphorimager analysiert.

Die Ergebnisse der anfänglichen Experimente zeigten, dass LPS bei 2 &mgr;g/ml die maximale Ausbeute an IL-1 ergab, und diese Konzentration von LPS wurde in allen Experimenten danach verwendet. Die minimale Zeit nach dem Hinzufügen von LPS für die maximale Ausbeute der Cytokine wurde durch das Entnehmen von Aliquots aus dem Medium zum Testen bei verschiedenen Zeiten nach dem Hinzufügen von LPS bestimmt. Das erste Experiment zeigte, dass sowohl IL-1 als auch TNF-&agr; die maximale Ausbeute nach weniger als 5 Stunden nach dem Hinzufügen von LPS erreichten. Weil die früheste Sammelzeit 2,4 h in dem ersten Experiment betrug, wurde ein zweites Experiment durchgeführt, in welchem das Sammeln von Medium 15 min nach dem Hinzufügen von LPS begann. Die Ergebnisse dieses Experiments, in dem nur TNF-&agr; getestet wurde, zeigten, dass es eine maximale Ausbeute nach 3 h nach dem Hinzufügen von LPS erreichte. Es wurde kein signifikantes TNF-&agr; in dem Medium bis 90 min nach Hinzufügen von LPS gefunden.

Das schnelle Erreichen der maximalen Ausbeute zeigte eine sehr strikte Regulation der Synthese der zwei Cytokine – schnelle Synthese und schnelle Herunterregulation. Die Kulturen der Zellen wurden für 30 min vor dem Hinzufügen von LPS mit entweder Actinomycin D, einem RNA Syntheseinhibitor, oder Cycloheximid, einem Proteinsyntheseinhibitor behandelt. Das Medium wurde 3 h nach dem Hinzufügen von LPS gesammelt, und TNF-&agr; wurde untersucht. Sowohl neue RNAals auch neue Proteinsynthese wird für die TNF-&agr; Induktion benötigt, weil kein TNF-&agr; in dem Medium von Zellen gefunden wurde, die mit irgendeinem der Inhibitoren behandelt wurden. Die nächsten Experimente wurden durchgeführt, um zu bestimmen, ob Verbindung III-3 die Induktion von IL-1 und TNF-&agr; inhibieren würde. Verbindung III-3 inhibierte die Induktion von sowohl IL-1 als auch TNF-&agr; mit IC50 Werten von jeweils 267 nM und 139 nM. Die Ergebnisse dieser Experimente wurden mit Zellen in Medium mit 10% fötalem Rinderserum erhalten. Weil die Tests mit Rückenmarksgewebe und basalem Vorderhirngewebe für die neurotrophe Aktivität der Verbindungen in serumfreiem Medium (500 &mgr;g/ml BSA) durchgeführt werden, ist es interessant, die IC50 Werte für die Inhibierug von IL-1 und TNF-&agr; in serumfreiem Medium zu bestimmen. Wenn THP-1 Zellen mit Verbindung III-3 in serumfreiem Medium (500 &mgr;g/ml BSA) behandelt wurden, war der IC50 10-fach von 269 nM auf 23 nM reduziert. Außer es ist anders angegeben, wurden alle Experimente danach in serumfreiem Medium durchgeführt. Die Inhibierung durch Verbindung III-3 der Induktion von IL-1 und TNF-&agr; in THP-1 Zellen schlägt vor, dass Verbindung III-3 als ein Therapeutikum in der Behandlung pathologischer Zustände, die durch die Herstellung der obigen normalen Quantitäten dieser Cytokine verwendet werden kann. Septischer Schock ist ein solcher Zustand. Der septische Schock wird durch das Wachstum von gram negativen Bakterien im Kreislauf verursacht, die wiederum große Mengen an Endotoxin, LPS, freisetzen. Das LPS stimuliert anschließend primär die Monozyten und Makrophagen, große Mengen an IL-1 und TNF-&agr; zu bilden, die wiederum massiven Gewebeschaden und in vielen Fällen den Tod verursachen.

Verschiedene Verbindungen wurden hinsichtlich ihrer Fähigkeit, TNF-&agr; zu inhibieren, getestet und mit der Fähigkeit, JNK zu inhibieren verglichen. Die Ergebnisse sind in Tabelle 6 gezeigt.

Tabelle 6
Wirkung von Verbindung III-3 auf die Induktion von IL-2 in Jurkat Zellen

Es wurden Experimente durchgeführt, um zu bestimmen, ob Verbindung III-3 die Induktion von IL-2 in Jurkat Zellen inhibierte.

Experimentelle Verfahren

Jurkat Zellen wurden in RPMI 1640 Medium angezogen, das mit 10% fötalem Rinderserum ergänzt war. TNF-&agr; stammte von Promega und anti CD3 und anti CD28 Antikörper stammten von Pharmigen. Die Jurkat Experimente wurden in 200 &mgr;l in einer 96 Vertiefungsplatte durchgeführt. IL-2 wurde mit einem ELISA Kit, der von Boehringer-Mannheim gekauft wurde, gemessen. Die Antikörper gegen CD3 und CD28 banden vor dem Hinzufügen der Jurkat Zellen an das Plastik der 96 Vertiefungsplatte (18 h in PBS). Die Zellen wurden mit den Verbindungen 1 h vor dem Hinzufügen zu der Antikörper beschichteten Platte behandelt. Die Antikörper gegen CD3 und CD28 wurden verwendet, um den T Zell Rezeptor zu aktivieren und IL-2 zu induzieren. IL-2 wurde aus den Jurkat Zellen zwischen 6 h und 24 h nach Initiation der Induktion (23A) freigesetzt. Es wurde kein IL-2 konstitutiv hergestellt (23A CNT). Die Wirkung von Verbindung III-3 (1 h Behandlung mit Verbindung III-3 vor der Induktion) auf die IL-2 Induktion wurde als nächstes untersucht (23B). Eine Verbindung III-3 Konzentration von 500 nM inhibierte die IL-2 Induktion um mehr als 80% (23B). Ein intensiveres großes Antwortexperiment wurde mit Verbindung III-3 und mit Verbindung 1–4 durchgeführt, was zu IC50 Werten von 139 nM für Verbindung III-3 und 207 nM für Verbindung 1–4 führte (23C).

SEQUENZPROTOKOLL

Anspruch[de]
  1. Verfahren zum Identifizieren einer Verbindung, welche die Aktivität eines Multiple Lineage Kinase-Proteins moduliert und das Zellüberleben oder den Zelltod fördert, umfassend die Schritte

    (a) des Inkontaktbringens der das Multiple Lineage Kinase-Protein enthaltenden Zelle mit der Verbindung in vitro,

    (b) des Bestimmens, ob die Verbindung die Aktivität des Multiple Lineage Kinase-Proteins erhöht oder vermindert und

    (c) des Bestimmens, ob die Verbindung das Zellüberleben oder den Zelltod fördert.
  2. Verfahren nach Anspruch 1 zum Identifizieren einer Verbindung, die das Zellüberleben fördert, umfassend den Schritt des Bestimmens, ob die Verbindung die Aktivität des Multiple Lineage Kinase-Proteins vermindert.
  3. Verfahren nach Anspruch 1 zum Identifizieren einer Verbindung, die den Zelltod fördert, umfassend den Schritt des Bestimmens, ob die Verbindung die Aktivität des Multiple Lineage Kinase-Proteins erhöht.
  4. Verfahren nach Anspruch 2, wobei die Verbindung in der Behandlung einer neurodegenerativen Störung oder Entzündung verwendbar sein kann.
  5. Verfahren nach Anspruch 2 oder Anspruch 4, wobei das Protein aus der Gruppe, bestehend aus Multiple Lineage Kinase 1, Multiple Lineage Kinase 2, Multiple Lineage Kinase 3, Leucin-Zipper aufweisende Kinase, zweifachen Leucin-Zippen aufweisende Kinase und Multiple Lineage Kinase 6, ausgewählt ist.
  6. Verfahren nach Anspruch 3, wobei das Protein aus der Gruppe, bestehend aus Multiple Lineage Kinase 1, Multiple Lineage Kinase 2, Multiple Lineage Kinase 3, Leucin-Zipper aufweisende Kinase, zweifach Leucin-Zippen aufweisende Kinase und Multiple Lineage Kinase 6, ausgewählt ist.
  7. Verfahren nach Anspruch 5 oder Anspruch 6, wobei die Proteinaktivität durch einen in vitro Kinase-Assay oder Bindungs-Assay bestimmt wird.
  8. Verfahren nach Anspruch 5 oder Anspruch 6, wobei die Zelle eine neuronale Zelle ist.
  9. Verfahren nach Anspruch 5, wobei die Proteinaktivität durch das Messen der Aktivität oder des Phosphorylierungszustands eines Substrats des Proteins bestimmt wird.
  10. Verfahren nach Anspruch 6, wobei die Proteinaktivität durch das Messen der Aktivität eines Substrats des Proteins bestimmt wird.
  11. Verfahren nach den Ansprüchen 9 oder 10, wobei das Substrat aus der Gruppe, bestehend aus JNK1, JNK2, JNK3, ERK1, ERK2, p38&agr;, p38&bgr;, p38&ggr;, p38&dgr;, MEK1, MEK2, MKK3, MKK4 (SEK1), MEK5, MKK6, MKK7, jun, ATF2, ELK1 und das Säuger-Homolog von AEX-3, ausgewählt aus.
  12. Verfahren nach Anspruch 5, wobei die Proteinaktivität durch das Messen der Aktivität eines Substrats des Proteins, der Menge eines Substrats des Proteins oder der das Substrat des Proteins kodierenden mRNA bestimmt wird.
  13. Verfahren nach Anspruch 6, wobei die Proteinaktivität durch das Messen der Aktivität eines Substrats des Proteins, der Menge des Proteins oder der das Protein kodierenden mRNA bestimmt wird.
  14. Verfahren nach Anspruch 5 oder Anspruch 6, wobei das Fördern des Zellüberlebens durch das Verwenden von Zellen, die ein Risiko haben zu sterben, und durch das Vergleichen der Menge der lebenden Zellen, die in Kontakt mit der Verbindung gebracht wurden, mit der Menge der lebenden Zellen, die nicht in Kontakt mit der Verbindung gebracht wurden, bestimmt wird.
  15. Verfahren nach Anspruch 5 oder 14, wobei die Zellen primäre embryonale motorische Nervenzellen sind.
  16. Verfahren nach Anspruch 5 oder 14, wobei die Zellen das Multiple Lineage Kinase-Protein überexprimieren.
  17. Verfahren nach Anspruch 5, wobei das Fördern des Zellüberlebens durch das Beobachten eines Abnehmens der Apoptose bestimmt wird.
  18. Verfahren nach Anspruch 6, wobei das Fördern des Zelltods durch das Beobachten eines Zunehmens der Apoptose bestimmt wird.
  19. Verfahren nach einem der Ansprüche 5 oder 6, wobei die Zelle in eine neurodegenerative Krankheit involviert ist.
  20. Verfahren nach Anspruch 2, wobei die Zelle in eine Entzündung involviert ist.
  21. Verwendung einer Verbindung der Formel
    die das Multiple Lineage Kinase-Protein inhibiert, in der Herstellung eines Medikaments zur Verwendung in der Behandlung einer neurodegenerativen Störung oder Entzündung, wobei

    der Ring B und der Ring F unabhängig voneinander jeweils zusammen mit den Kohlenstoffatomen, an die sie gebunden sind, entweder

    einen ungesättigten 6-gliedrigen carbocyclischen aromatischen Ring, in dem ein bis drei Kohlenstoffatom(e) durch Stickstoffatome) ersetzt sein können, oder

    einen ungesättigten 5-gliedrigen carbocyclischen aromatischen Ring, in dem entweder ein Kohlenstoffatom durch ein Sauerstoff-, Stickstoff- oder Schwefelatom ersetzt ist oder zwei Kohlenstoffatome durch ein Schwefel- und ein Stickstoffatom oder ein Sauerstoff- und ein Stickstoffatom ersetzt sind, bilden

    A1 und A2 zusammen O darstellen und B1 und B2 zusammen O darstellen;

    R1 H, Alkyl mit 1–4 Kohlenstoffen (einschließlich), Aryl, Arylalkyl, Heteroaryl und Heteroarylalkyl, COR9, wobei R9 Alkyl mit 1–4 Kohlenstoffen (einschließlich) oder Aryl, vorzugsweise Phenyl oder Naphthyl, -OR10, wobei R10 H oder Alkyl mit 1–4 Kohlenstoffen (einschließlich) ist, -CONH2, -NR7R8, -(CH2)nNR7R8, wobei n eine ganze Zahl von 1–4 (einschließlich) ist, oder -O(CH2)nNR7R8 ist und entweder

    R7 und R8 unabhängig voneinander H oder Alkyl mit 1–4 Kohlenstoffen (einschließlich) sind oder

    R7 und R8 miteinander verbunden sind, um eine Verbindungsgruppe der allgemeinen Formel -(CH2)2-X1-(CH2)2- bilden, wobei X1 O, S oder CH2 ist,

    R2 H, -SO2R9, -CO2R9, -COR9, Alkyl mit 1–8 Kohlenstoffen (einschließlich), vorzugsweise Alkyl mit 1–4 Kohlenstoffen (einschließlich), Alkenyl mit 1–8 Kohlenstoffen (einschließlich), vorzugsweise Alkenyl mit 1–4 Kohlenstoffen (einschließlich) oder Alkinyl mit 1–8 Kohlenstoffen (einschließlich), vorzugsweise Alkinyl mit 1–4 Kohlenstoffen (einschließlich) oder ein Monosaccharid von 5–7 Kohlenstoffen (einschließlich) ist, wobei jede Hydroxylgruppe des Monosaccharids unabhängig voneinander entweder nicht substituiert ist oder durch H, Alkyl mit 1–4 Kohlenstoffen (einschließlich), Alkylcarbonyloxy von 2–5 Kohlenstoffen (einschließlich) oder Alkoxy von 1–4 Kohlenstoffen (einschließlich) ersetzt ist und entweder

    jedes Alkyl mit 1–8 Kohlenstoffen (einschließlich), Alkenyl mit 1–8 Kohlenstoffen (einschließlich) oder Alkinyl mit 1–8 Kohlenstoffen (einschließlich) nicht substituiert ist oder

    jedes Alkyl mit 1–8 Kohlenstoffen (einschließlich), Alkenyl mit 1–8 Kohlenstoffen (einschließlich) oder Alkinyl mit 1–8 Kohlenstoffen (einschließlich) unabhängig voneinander substituiert ist mit 1–3 Arylgruppen mit 6–10 Kohlenstoffen (einschließlich), vorzugsweise Phenyl oder Naphthyl, Heteroaryl, F, Cl, Br, I, -CN, -NO2, OH, -OR9, -O(CH2)nNR7R8, -OCOR9, -OCONHR9, O-Tetrahydropyranyl, NH2, -NR7R8, -NR10COR9, -NR10CO2R9, -NR10CONR7R8, -NHC(=NH)NH2, -NR10SO2R9, -S(O)yR11, wobei R11 H oder Alkyl mit 1–4 Kohlenstoffen, Aryl mit 6 – 10 Kohlenstoffen, vorzugsweise Phenyl oder Naphthyl, oder Heteroaryl ist und y 1 oder 2 ist, -SR11, -CO2R9, -CONR7R8 , -CHO, COR9, -CH2OR7, -CH=NNR11R12, -CH=NOR11, -CH=NR9, -CH=NNHCH(N=NH)NH2, -SO2NR12R13, -PO(OR11)2 oder OR14 ist, wobei R14 der Rest einer Aminosäure ist, nachdem die Hydroxylgruppe der Carboxylgruppe entfernt ist,

    und entweder R12 und R13 unabhängig voneinander H, Alkyl mit 1–4 Kohlenstoffen (einschließlich), Aryl mit 6–10 Kohlenstoffen, vorzugsweise Phenyl oder Naphthyl, oder ein Heteroaryl sind oder

    R12 und R13 miteinander verbunden sind, um eine Verbindungsgruppe, vorzugsweise -(CH2)2-X1-(CH2)2, zu bilden,

    jedes R3, R4, R5 und R6 unabhängig voneinander H, ein Aryl, vorzugsweise Aryl mit 6–10 Kohlenstoffen (einschließlich), bevorzugter Phenyl oder Naphthyl, Heteroaryl, F, Cl, Br, I, -CN, CF3, -NO2, OH, -OR9, -O(CH2)nNR7R8, -OCOR9, -OCONHR9, NH2, -CH2OH, -CH2OR14, -NR7R8, -NR10COR9, -NR10CONR7R8, -SR11, -S(O)yR11, wobei y 1 oder 2 ist, -CO2R9, -COR9, -CONR7R8, -CHO, -CH=NOR11, -CH=NR9, -CH=NNR11R12, -(CH2)nSR9, wobei n eine ganze Zahl von 1–4 (einschließlich), -(CH2)nS(O)yR9, -CH2SR15, wobei R15 Alkyl mit 1–4 Kohlenstoffen (einschließlich), -CH2S(O)yR14, -(CH2)nNR7R8, -(CH2)nNHR14, Alkyl mit 1–8 Kohlenstoffen (einschließlich), vorzugsweise Alkyl mit 1–4 Kohlenstoffen (einschließlich), Alkenyl mit 1–8 Kohlenstoffen (einschließlich), vorzugsweise Alkenyl mit 1–4 Kohlenstoffen (einschließlich), Alkinyl mit 1–8 Kohlenstoffen (einschließlich), vorzugsweise Alkinyl mit 1–4 Kohlenstoffen (einschließlich) ist und entweder

    jedes Alkyl mit 1–8 Kohlenstoffen (einschließlich), Alkenyl mit 1–8 Kohlenstoffen (einschließlich) oder Alkinyl mit 1–8 Kohlenstoffen (einschließlich) nicht substituiert ist oder

    jedes Alkyl mit 1–8 Kohlenstoffen (einschließlich), Alkenyl mit 1–8 Kohlenstoffen (einschließlich) oder Alkinyl mit 1–8 Kohlenstoffen (einschließlich), wie in (d) (2) von Anspruch 58 beschrieben, substituiert ist,

    X entweder

    nicht substituiertes Alkylen mit 1–3 Kohlenstoffen (einschließlich) ist oder

    X Alkylen mit 1–3 Kohlenstoffen (einschließlich) ist, welches mit einer R2-Gruppe, vorzugsweise OR10, -SR10, R15, wobei R15 Alkyl mit 1–4 Kohlenstoffen (einschließlich) ist, Phenyl, Naphthyl, Arylalkyl mit 7–14 Kohlenstoffen (einschließlich), vorzugsweise Benzyl, substituiert ist, oder

    X -CH=CH-, -CH(OH)-CH(OH)-, -O-, -S- -S(=O)-, -S(=O)2-, -C(R10)2-, -C(=O)-, -C(=NOR11)-, -C(OR11)(R11)-, -C(=O)CHR15-, -CHR15C(=O)-, -C(=NOR11)CHR15-, -CHR15C(=NOR11)-, -CH2Z-, -Z-CH2-, -CH2ZCH2- ist, wobei Z C(OR11)(R11), O, S, C(=O), C(=NOR11) oder NR11 ist

    oder

    A1 und A2 zusammen jeweils unabhängig voneinander H, H; H, -OR11; H, -SR11; H, -NR11R12 sind oder zusammen =S oder =NR11 darstellen, B1 und B2 zusammen O darstellen und jedes R1, R2, R3, R4, R5, R6 und X, wie in (c), (d), (e) und (f) von Anspruch 58 definiert, sind

    oder

    A1 und A2 zusammen O darstellen und B1 und B2 jeweils unabhängig voneinander H, H; H, -OR11, H, -SR11, H, -NR11R12 sind oder zusammen =S oder =NR11 darstellen und jedes R1, R2, R3, R4, R5, R6 und X, wie in (c), (d), (e) und (f) von Anspruch 58 definiert, sind.
  22. Verwendung nach Anspruch 21, wobei A1, A2, R1, R3 und R4 H sind, B1 und B2 zusammen O darstellen, R2 CH2CH2OH ist, R5 und R6 OCH3 sind und X CH2 ist.
  23. Verwendung nach Anspruch 21, wobei A1, A2, R1, R3, R5 und R6 H sind, B1 und B2 zusammen O darstellen, R2 CH2CH2OAc ist, R4 Br ist und X CH2 ist.
  24. Verwendung nach Anspruch 21, wobei A1, A2, R1, R3, R5 und R6 H sind, B1 und B2 zusamamen O darstellen, R2, CH2CH2OAc ist, R4 CH2CH2(2-Pyr) ist und X CH2 ist.
  25. Verwendung nach Anspruch 21, wobei A1, A2, R1, R3, R5 und R6 H sind, B1 und B2 zusammen O darstellen, R2 H ist, R4 CH2CH2(2-Pyrimidinyl) ist und X CH2 ist.
  26. Verwendung nach Anspruch 21, wobei A1, A2, R1, R3, R5 und R6 H sind, B1 und B2 zusammen O darstellen, R2 H ist, R4 CH2CH2(2-Pyr) ist und X CH2 ist.
  27. Verwendung nach Anspruch 21, wobei A1, A2, R1, R2, R3, R5 und R6 H sind, B1 und B2 zusammen O darstellen, R4 CH2CH2(2-Pyridazinyl) ist und X CH2 ist.
  28. Verwendung nach Anspruch 21, wobei A1, A2, R1, R3, R4, R5 und R6 H sind, B1 und B2 zusammen O darstellen, R2 CH2CH2OH ist und X CH2 ist.
  29. Verwendung nach Anspruch 21, wobei A1, A2, R1, R3, R4, R5 und R6 H sind, B1 und B2 zusammen O darstellen, R2 CH2CH2CH2OH ist und X CH2 ist.
  30. Verwendung nach Anspruch 21, wobei A1, A2, R1, R2, R3, R4, R5 und R6 H sind, B1 und B2 zusammen O darstellen und X S ist.
  31. Verwendung nach Anspruch 21, wobei A1, A2, R1, R3, R4, R5 und R6 H sind, B1 und B2 zusammen O darstellen, R2 CH2CH2CH2NHCO(4-(OH)Ph) ist und X CH2 ist.
  32. Verwendung nach Anspruch 21, wobei A1, A2, R1, R3, R4, R5 und R6 H sind, B1 und B2 zusammen O darstellen, R2 CH2CH2OH ist und X CH2 ist.
  33. Verwendung einer Verbindung mit der Formel
    die ein Multiple Lineage Kinase-Protein inhibiert, in der Herstellung eines Medikaments zur Verwendung in der Behandlung einer neurodegenerativen Störung oder Entzündung, wobei

    Ring B und Ring F unabhängig voneinander und jeder zusammen mit den Kohlenstoffatomen, an die sie gebunden sind, aus der Gruppe, bestehend aus

    (a) einem ungesättigten 6-gliedrigen carbocyclischen aromatischen Ring, in dem 1 bis 3 Kohlenstoffatome durch Stickstoffatome ersetzt sein können,

    (b) einem ungesättigten 5-gliedrigen carbocyclischen aromatischen Ring und

    (c) einem ungesättigten 5-gliedrigen carbocyclischen aromatischen Ring, in dem entweder

    (1) ein Kohlenstoffatom durch ein Sauerstoff-, Stickstoff- oder Schwefelatom ersetzt ist,

    (2) zwei Kohlenstoffatome durch ein Schwefel- und ein Stickstoffatom, ein Sauerstoff- und ein Stickstoffatom oder zwei Stickstoffatome ersetzt sind, oder

    (3) drei Kohlenstoffatome durch drei Stickstoffatome ersetzt sind,

    ausgewählt sind,

    R1 aus der Gruppe, bestehend aus

    (a) H, substituiertem oder nicht substituiertem Alkyl mit 1 bis 4 Kohlenstoffen, substituiertem oder nicht substituiertem Aryl, substituiertem oder nicht substituiertem Arylalkyl, substituiertem oder nicht substituiertem Heteroaryl oder substituiertem oder nicht substituiertem Heteroarylalkyl,

    (b) -C(=O)R9, wobei R9 ausgewählt ist aus der Gruppe, bestehend aus Alkyl, Aryl und Heteroaryl,

    (c) -OR10, wobei R10 ausgewählt ist aus der Gruppe, bestehend aus H und Alkyl mit 1 bis 4 Kohlenstoffen,

    (d) -C(=O)NH2, -NR11R12, -(CH2)pNR11R12, -(CH2)pOR10, -O(CH2)pOR10 und -O(CH2)pNR11R12, wobei p 1 bis 4 ist und wobei entweder

    (1) R11 und R12 jeweils unabhängig voneinander ausgewählt sind aus der Gruppe, bestehend aus H und Alkyl mit 1 bis 4 Kohlenstoffen, oder

    (2) R11 und R12 zusammen eine Verbindungsgruppe der Formel -(CH2)2-X1-(CH2)2- bilden, wobei X1 ausgewählt ist aus der Gruppe, bestehend aus -O-, -S-, -CH2-,

    ausgewählt ist,

    R2 aus der Gruppe, bestehend aus H, Alkyl mit 1 bis 4 Kohlenstoffen, -OH, Alkoxy mit 1 bis 4 Kohlenstoffen, -OC(=O)R9, -OC(=O)NR11R12, -O(CH2)pNR11R12, -O(CH2)pOR10, substituiertem oder nicht substituiertem Arylalkyl mit 6 bis 10 Kohlenstoffen und substituiertem oder nicht substituiertem Heteroarylalkyl, ausgewählt ist,

    R3, R4, R5 und R6 jeweils unabhängig voneinander aus der Gruppe, bestehend aus

    (a) H, Aryl, Heteroaryl, F, Cl, Br, I, -CN, CF3, -NO2, -OH, -OR9, -O(CH2)pNR11R12, -OC(=O)R9, -OC(=O)NR2R7, -OC(=O)NR11R12, -O(CH2)pOR10, -CH2OR10, -NR11R12, -NR10S(=O)2R9, -NR10C(=O)R9,

    (b) -CH2OR14, wobei R14 der Rest einer Aminosäure ist, nachdem die Hydroxylgruppe der Carboxylgruppe entfernt ist,

    (c) -NR10C(=O)NR11R12, -CO2R2, -C(=O)R2, -C(=O)NR11R12, -CH=NOR2, -CH=NR9, -(CH2)pNR11R12, -(CH2)pNHR14 oder -CH=NNR2R2A, wobei R2A das Gleiche ist wie R2,

    (d) -S(O)yR2, -(CH2)pS(O)yR9, -CH2S(O)yR14, wobei y 0, 1 oder 2 ist,

    (e) Alkyl mit 1 bis 8 Kohlenstoffen, Alkenyl mit 2 bis 8 Kohlenstoffen und Alkinyl mit 2 bis 8 Kohlenstoffen, wobei

    (1) jede Alkyl-, Alkenyl- oder Alkinylgruppe nicht substituiert ist oder

    (2) jede Alkyl-, Alkenyl- oder Alkinylgruppe mit 1 bis 3 Gruppen, ausgewählt aus der Gruppe, bestehend aus Aryl mit 6 bis 10 Kohlenstoffen, Heteroaryl, Arylalkoxy, Heterocycloalkoxy, Hydroxyalkoxy, Alkyloxy-Alkoxy, Hydroxyalkylthio, Alkoxy-Alkylthio, F, Cl, Br, I, -CN, -NO2, -OH, -OR9, -X2(CH)pNR11R12, -X2(CH2)pC(=O)NR11R12, -X2(CH2)pOC(=O)NR11R12, -X2(CH2)pCO2R9, -X2(CH2)pS(O)yR9, -X2(CH2)pNR10C(=O)NR11R12, -OC(=O)R9, -OCONHR2, -O-Tetrahydropyranyl, -NR11R12, -NR10C(=O)R9, -NR10CO2R9, -NR10C(=O)NR11R12, -NHC(=NH)NH2, NR10S(O)2R9, -S(O)yR9, -CO2R2, -C(=O)NR11R12, -C(=O)R2, -CH2OR10, -CH=NNR2R2A, -CH=NOR2, -CH=NR9, -CH=NNHCH(N=NH)NH2, -S(=O)2NR2R2A, -P(=O)(OR10)2, -OR14 und einem Monosaccharid mit 5 bis 7 Kohlenstoffen, wobei jede Hydroxylgruppe des Monosaccharids unabhängig voneinander entweder nicht substituiert oder durch H, Alkyl mit 1 bis 4 Kohlenstoffen, Alkylcarbonyloxy mit 2 bis 5 Kohlenstoffen oder Alkoxy mit 1 bis 4 Kohlenstoffen ersetzt ist, substituiert ist,

    ausgewählt sind,

    X2 O, S oder NR10 ist,

    R7 und R8 jeweils unabhängig voneinander ausgewählt sind aus der Gruppe, bestehend aus H, Alkyl mit 1 bis 4 Kohlenstoffen, Alkoxy mit 1 bis 4 Kohlenstoffen, substituiertem oder nicht substituiertem Arylalkyl mit 6 bis 10 Kohlenstoffen, substituiertem oder nicht substituiertem Heteroarylalkyl, -(CH2)pOR10, -(CH2)pOC(=O)NR11R12 und -(CH2)pNR11R12, oder R7 und R8 zusammen eine Verbindungsgruppe mit der Formel -CH2-X3-CH2- bilden, wobei X3 X2 oder eine Bindung ist,

    m und n jeweils unabhängig voneinander 0, 1 oder 2 sind,

    Y aus der Gruppe, bestehend aus -O-, -S-, -N(R10)-, -N+(O)(R10)-, -N(OR10)und -CH2- ausgewählt ist,

    Z aus der Gruppe, bestehend aus einer Bindung, -O-, -CH=CH-, -S-, -C(=O)-, -CH(OR10)-, -N(R10)-, -N(OR10)-, -CH(NR11R12)-, -C(=O)N(R17)-, -N(R17)C(=O)-, -N(S(O)yR9)-, -N(S(O)yNR11R12)-, -N(C(=O)R17)-, -C(R15R16)-, -N+(O)(R10)-, -CH(OH)-CH(OH)- und -CH(O(C=O)R9)CH(OC(=O)R9A)-, ausgewählt ist, wobei R9A das Gleiche wie R9 ist,

    R15 und R16 unabhängig voneinander aus der Gruppe, bestehend aus H, -OH, -C(=O)R10, -O(C=O)R9, Hydroxyalkyl und -CO2R10, ausgewählt sind,

    R17 aus der Gruppe, bestehend aus H, Alkyl, Aryl und Heteroaryl, ausgewählt ist,

    A1 und A2 aus der Gruppe, bestehend aus H, H; H, OR2; H, -SR2; H, -N(R2)2 und einer Gruppe, in der A1 und A2 zusammen eine Einheit, ausgewählt aus der Gruppe, bestehend aus =O, =S und =NR2 bilden, ausgewählt sind,

    B1 und B2 aus der Gruppe, bestehend aus H, H; H, -OR2; H, -SR2; H, -N(R2)2 und einer Gruppe, in der B1 und B2 zusammen eine Einheit, ausgewählt aus der Gruppe, bestehend aus =O, =S und =NR2 bilden, ausgewählt sind,

    mit der Maßgabe, daß mindestens eines der Paare A1 und A2 oder B1 und B2 =O bilden.
  34. Verwendung einer Verbindung mit der Formel
    die ein Multiple Lineage Kinase-Protein inhibiert, in der Herstellung eines Medikaments zur Verwendung in der Behandlung einer neurodegenerativen Störung oder Entzündung, wobei

    Z1 H ist und Z2 H ist oder Z1 und Z2 zusammen =O bilden,

    R1 H oder Br ist,

    R2 H ist,

    R3 H, CH2CH=CH2, CH2CH2CH2OH oder
    ist und

    R4 H, CH2CH=CH2 oder CH2CH2CH2OH ist.
  35. Verwendung nach Anspruch 34, wobei R1, R2, R4, Z1 und Z2 H sind und R3 CH2CH=CH2 ist.
  36. Verwendung nach Anspruch 34, wobei R1 Br ist und R2, R3, R4, Z1 und Z2 H sind.
  37. Verwendung nach Anspruch 34, wobei R1, R2, Z1 und Z2 H sind und R3 und R4 CH2CH=CH2 sind.
  38. Verwendung nach Anspruch 34, wobei R1, R2, R3, Z1 und Z2 H sind und R4 CH2CH=CH2 ist.
  39. Verwendung nach Anspruch 34, wobei R1, R2, Z1 und Z2 H sind und R3 und R4 CH2CH=CH2 sind oder R1, R2, R4 , Z1 und Z2 H sind und R3
    ist.
  40. Verwendung einer Verbindung mit der Formel
    die ein Multiple Lineage Kinase-Protein inhibiert, in der Herstellung eines Medikaments zur Verwendung in der Behandlung einer neurodegenerativen Störung oder Entzündung, wobei

    Z1 H ist und Z2 H ist oder Z1 und Z2 zusammen =O bilden,

    R1 aus der Gruppe, bestehend aus H, Cl, CH2SO2C2H5, Br, CH2S(CH2)2NH2, CH2S(CH2)2N(CH3)2, CH2S(CH2)2NH2, n-C4H9, NHCONHC6H5, NHCONHC2H5, CH2SC2H5, CH2SC6H5, N(CH3)2, CH3, CH2OCONHC2H5, NHCO2CH3, CH2OC2H5, CH2N(CH3)2, OH, O-n-Propyl, CH=NNH-C(=NH)NH2, CH=N-N(CH3)2, CH2S(CH2)2NH-n-C4H9, CH2OCH2OCH2CH3, CH2S[3-(1,2,4-Triazin)], CH2CH2SCH3 und
    ausgewählt ist,

    R2 aus der Gruppe, bestehend aus H, Br, Cl, I, CH2S(CH2)2N(CH3)2, NHCONHC2H5, CH2SC2H5, CH2OCH2OCH2CH3, CH2S(3-(1,2,4-Triazin)), CH2CH2SCH3 und CH2OH, ausgewählt ist,

    X aus der Gruppe, bestehend aus H, CH2OH, CH2NH-SerinH, CO2CH3, CONHC6H5, CH2NHCO2C6H5, CH2NHCO2CH3, CH2N3, CONHC2H5, CH2NH-Glycin, CON(CH3)2, -CH2NHCO2-, CONH2, CONHC3H7, CH2NH-Serin, CH2SOCH3, CH=NOH, CH2NH-Prolin, CH2CH2(2-Pyridyl), CH=NNHC(=NH)NH2, CONH(CH2)2OH, CH=NNHCONH2, CH2OCOCH3, -CH2OC(CH3)2O-, CH2SC6H5, CH2SOC6H5, CO2n-Hexyl, CONHCH3, CO2(CH2)4CH3,
    ausgewählt ist und

    R aus der Gruppe, bestehend aus OH und OCH3, ausgewählt ist.
  41. Verwendung nach Anspruch 40, wobei Z1 und Z2 H sind, X CO2CH3 ist, R1 NHCONHC2H5 ist, R2 CH2CH2(2-Pyridyt) ist und R OH ist.
  42. Verwendung nach Anspruch 40, wobei Z1 und Z2 H sind, X CO2CH3 ist, R1 und R2 CH2OCH2OCH2CH3 sind und R OH ist.
  43. Verwendung nach Anspruch 40, wobei Z1 und Z2 H sind, X CO2CH3 ist, R1 und R2 CH2SCH2CH3 sind und R OH ist.
  44. Verwendung nach Anspruch 40, wobei Z1, Z2, R1 und R2 H sind, X CO2CH3 ist und R OH ist.
  45. Verwendung nach Anspruch 40, wobei Z1, Z2, R1 und R2 H sind, X CO2(CH2)4CH3 ist und R OH ist.
  46. Verwendung nach Anspruch 40, wobei Z1, Z2 und R1 H sind, R2 CH2OH ist, X CO2CH3 ist und R OH ist.
  47. Verwendung nach Anspruch 40, wobei Z1 und Z2 H sind, R1 und R2 H2S(3-(1,2,4-Triazin)) sind, X CO2CH3 ist und R OH ist.
  48. Verwendung nach Anspruch 40, wobei Z1 und Z2 H sind, R1 Br ist, R2 I ist, X CO2CH3 ist und R OH ist.
  49. Verwendung nach Anspruch 40, wobei Z1 und Z2 H sind, R1 und R2 CH2CH2SCH3 sind, X CO2CH3 ist und R OH ist.
  50. Verwendung nach Anspruch 40, wobei Z1, Z2, R1 und R2 H sind, X CO2CH3 ist und R OCH3 ist.
  51. Verwendung nach Anspruch 40, wobei Z1 und Z2 zusammen =O bilden, R1 und R2 Br sind, X CO2CH3 ist und R OH ist.
  52. Verfahren zum Modulieren der Aktivität eines Multiple Lineage Kinase-Proteins, umfassend das Inkontaktbringen des Proteins oder einer Zelle, die das Protein enthält, mit einer Verbindung mit der Formel
    wobei

    Z1 H ist und Z2 H ist oder Z1 und Z2 zusammen =O bilden,

    R1 H oder Br ist,

    R2 H ist,

    R3 H, CH2CH=CH2, CH2CH2CH2OH oder
    ist und

    R4 H, CH2CH=CH2 oder CH2CH2CH2OH ist.
  53. Verfahren nach Anspruch 52, wobei R1, R2, R4, Z1 und Z2 H sind und R3 CH2CH=CH2 ist.
  54. Verfahren nach Anspruch 52, wobei R1 Br ist und R2, R3, R4, Z1 und Z2 H sind.
  55. Verfahren nach Anspruch 52, wobei R1, R2, Z1 und Z2 H sind und R3 und R4 CH2CH=CH2 sind.
  56. Verfahren nach Anspruch 52, wobei R1, R2, R3, Z1 und Z2 H sind und R4 CH2CH=CH2 ist.
  57. Verfahren nach Anspruch 52, wobei R1, R2, Z1 und Z2 H sind und R3 und R4 CH2CH=CH2 sind oder R1, R2, R4, Z1 und Z2 H sind und R3
    ist.
  58. Verfahren zum Modulieren der Aktivität eines Multiple Lineage Kinase-Proteins, umfassend das Inkontaktbringen des Proteins oder einer Zelle, die das Protein enthält, mit einer Verbindung mit der Formel
    wobei

    Ring B und Ring F unabhängig voneinander und jeweils zusammen mit den Kohlenstoffatomen, an die sie gebunden sind, aus der Gruppe, bestehend aus

    (a) einem ungesättigten 6-gliedrigen carbocyclischen aromatischen Ring, in dem 1 bis 3 Kohlenstoffatome durch Stickstoffatome ersetzt sein können,

    (b) einem ungesättigten 5-gliedrigen carbocyclischen aromatischen Ring und

    (c) einem ungesättigten 5-gliedrigen carbocyclischen aromatischen Ring, in dem entweder

    (1) ein Kohlenstoffatom durch ein Sauerstoff-, Stickstoff- oder Schwefelatom ersetzt ist,

    (2) zwei Kohlenstoffatome durch ein Schwefel- und ein Stickstoffatom, ein Sauerstoff- und ein Stickstoffatom oder zwei Stickstoffatome ersetzt sind oder

    (3) drei Kohlenstoffatome durch drei Stickstoffatome ersetzt sind,

    ausgewählt sind,

    R1 aus der Gruppe, bestehend aus

    (a) H, substituiertem oder nicht substituiertem Alkyl mit 1 bis vier Kohlenstoffen, substituiertem oder nicht substituiertem Aryl, substituiertem oder nicht substituiertem Arylalkyl, substituiertem oder nicht substituiertem Heteroaryl oder substituiertem oder nicht substituiertem Heteroarylalkyl,

    (b) -C(=O)R9, wobei R9 aus der Gruppe, bestehend aus Alkyl, Aryl und Heteroaryl, ausgewählt ist.

    (c) -OR10, wobei R10 aus der Gruppe, bestehend aus H und Alkyl mit 1 bis 4 Kohlenstoffen, ausgewählt ist,

    (d) -C(=O)NH2, -NR11R12, -(CH2)pNR11R12, -(CH2)pOR10, -O(CH2)pOR10 und -O(CH2)pNR11R12, wobei p 1 bis 4 ist und wobei entweder

    (1) R11 und R12 jeweils unabhängig voneinander aus der Gruppe, bestehend aus H und Alkyl mit 1 bis 4 Kohlenstoffen, ausgewählt sind oder

    (2) R11 und R12 zusammen eine Verbindungsgruppe mit der Formel -(CH2)2-X1-(CH2)2- bilden, wobei X1 aus der Gruppe, bestehend aus -O-, -S-, -CH2-, ausgewählt ist,

    ausgewählt ist,

    R2 aus der Gruppe, bestehend aus H, Alkyl mit 1 – 4 Kohlenstoffen, -OH, Alkoxy mit 1 bis 4 Kohlenstoffen, -OC(=O)R9, -OC(=O)NR11R12, -O(CH2)p NR11R12, -O(CH2)pOR10, substituiertem oder nicht substituiertem Arylalkyl mit 6 bis 10 Kohlenstoffen und substituiertem oder nicht substituiertem Heteroarylalkyl, ausgewählt ist,

    R3, R4, R5 und R6 jeweils unabhängig voneinander aus der Gruppe, bestehend aus

    (a) H, Aryl, Heteroaryl, F, Cl, Br, I, -CN, CF3, -NO2, -OH, -OR9, -O(CH2)pNR11R12, -OC(=O)R9, -OC(=O)NR2R7, -OC(=O)NR11R12, -O(CH2)pOR10, -CH2OR10, -NR11R12, -NR10S(=O)2R9, -NR10C(=O)R9,

    (b) -CH2OR14, wobei R14 der Rest einer Aminosäure ist, nachdem die Hydroxylgruppe der Carboxylgruppe entfernt ist,

    (c) -NR10C(=O)NR11R12, -CO2R2, -C(=O)R2, -C(=O)NR11R12, -CH=NOR2, -CH=NR9, -(CH2)pNR11R12, -(CH2)pNHR14 oder -CH=NNR2R2A, wobei R2A das Gleiche wie R2 ist,

    (d) -S(O)yR2, -(CH2)pS(O)yR9, -CH2S(O)yR14, wobei y 0, 1 oder 2 ist,

    (e) Alkyl mit 1 bis 8 Kohlenstoffen und Alkenyl mit 2 bis 8 Kohlenstoffen und Alkinyl mit 2 bis 8 Kohlenstoffen, wobei

    (1) jede Alkyl-, Alkenyl- oder Alkinylgruppe nicht substituiert ist oder

    (2) jede Alkyl-, Alkenyl- oder Alkinylgruppe mit 1 bis 3 Gruppen, ausgewählt aus der Gruppe, bestehend aus Aryl mit 6 bis 10 Kohlenstoffen, Heteroaryl, Arylalkoxy, Heterocycloalkoxy, Hydroxyalkoxy, Alkyloxy-Alkoxy, Hydroxyalkylthio, Alkoxy-Alkylthio, F, Cl, Br, I, -CN, -NO2, -OH, -OR9, -X2(CH)pNR11R12, -X2(CH2)pC(=O)NR11R12, -X2(CH2)pOC(=O)NR11R12, -X2(CH2)pCO2R9, -X2(CH2)pS(O)yR9, -X2(CH2)pNR10C(=O)NR11R12, -OC(=O)R9, -OCONHR2, -O-Tetrahydropyranyl, -NR11R12, -NR10C(=O)R9, -NR10CO2R9, -NR10C(=O)NR11R12, -NHC(=NH)NH2, NR10S(O)2R9, -S(O)yR9, -CO2R2, -C(=O)NR11R12, -C(=O)R2, -CH2OR10, -CH=NNR2R2A, -CH=NOR2, -CH=NR9, -CH=NNHCH(N=NH)NH2, -S(=O)2NR2R2A, -P(=O)(OR10)2, -OR14 und einem Monosaccharid mit 5 bis 7 Kohlenstoffen, wobei jede Hydroxylgruppe des Monosaccharids unabhängig voneinander entweder nicht substituiert ist oder durch H, Alkyl mit 1 bis 4 Kohlenstoffen, Alkylcarbonyloxy mit 2 bis 5 Kohlenstoffen oder Alkoxy mit 1 bis 4 Kohlenstoffen ersetzt ist, substituiert ist,

    ausgewählt sind,

    X2 O, S oder NR10 ist,

    R7 und R8 jeweils unabhängig voneinander aus der Gruppe, bestehend aus H, Alkyl mit 1 bis 4 Kohlenstoffen, Alkoxy mit 1 bis 4 Kohlenstoffen, substituiertem oder nicht substituiertem Arylalkyl mit 6 bis 10 Kohlenstoffen, substituiertem oder nicht substituiertem Heteroarylalkyl, -(CH2)pOR10, -(CH2)pOC(=O)NR11R12 und -(CH2)pNR11R12 oder R7 und R8 zusammen eine Verbindungsgruppe mit der Formel -CH2-X3-CH2- bilden, wobei X3 X2 oder eine Bindung ist, ausgewählt sind,

    m und n jeweils unabhängig voneinander 0, 1 oder 2 sind,

    Y aus der Gruppe, bestehend aus -O-, -S-, -N(R10)-, -N+(O)(R10)-, -N(OR10)und -CH2-, ausgewählt ist,

    Z aus der Gruppe, bestehend aus einer Bindung -O-, -CH=CH-, -S-, -C(=O)-, -CH(OR10)-, -N(R10)-, -N(OR10)-, -CH(NR11R12)-, -C(=O)N(R17)-, -N(R17)C(=O)-, -N(S(O)yR9)-, -N(S(O)yNR11R12)-, -N(C(=O)R17)-, -C(R15R16)-, -N+(O)(R10)-, -CH(OH)-CH(OH)- und -CH(O(C=O)R9)CH(OC(=O)R9A)-, ausgewählt ist, wobei R9A das Gleiche wie R9 ist,

    R15 und R16 jeweils unabhängig voneinander aus der Gruppe, bestehend aus H, -OH, -C(=O)R10, -O(C=O)R9, Hydroxyalkyl und -CO2R10, ausgewählt sind,

    R17 aus der Gruppe, bestehend aus H, Alkyl, Aryl und Heteroaryl, ausgewählt ist,

    A1 und A2 aus der Gruppe, bestehend aus H, H; H, OR2; H, -SR2; H, -N(R2)2 und einer Gruppe, in der A1 und A2 zusammen eine Einheit, ausgewählt aus der Gruppe, bestehend aus =O, =S und =NR2, bilden, ausgewählt sind,

    B1 und B2 aus der Gruppe, bestehend aus H, H; H, -OR2; H, -SR2; H, -N(R2)2 und einer Gruppe, in der B1 und B2 zusammen eine Einheit, ausgewählt aus der Gruppe, bestehend aus =O, =S und =NR2, bilden, ausgewählt sind,

    unter der Maßgabe, daß mindestens eines der Paare A1 und A2 oder B1 und B2 =O bilden.
  59. Verfahren zum Modulieren der Aktivität eines Multiple Lineage Kinase-Proteins, umfassend das Inkontaktbringen des Proteins oder einer Zelle, die das Protein enthält, mit einer Verbindung mit der Formel
    wobei

    Z1 H ist und Z2 H ist oder Z1 und Z2 zusammen =O bilden,

    R1 aus der Gruppe, bestehend aus H, Cl, CH2SO2C2H5, Br, CH2S(CH2)2NH2, CH2S(CH2)2N(CH3)2, CH2S(CH2)2NH2, n-C4H9, NHCONHC6H5, NHCONHC2H5, CH2SC2H5, CH2SC6H5, N(CH3)2, CH3, CH2OCONHC2H5, NHCO2CH3, CH2OC2H5, CH2N(CH3)2, OH, O-n-Propyl, CH=NNH-C(=NH)NH2, CH=N-N(CH3)2, CH2S(CH2)2NH-n-C4H9, CH2OCH2OCH2CH3, CH2S[3-(1,2,4-Triazin)], CH2CH2SCH3

    und
    ausgewählt ist,

    R2 aus der Gruppe, bestehend aus H, Br, Cl, I, CH2S(CH2)2N(CH3)2, NHCONHC2H5, CH2SC2H5, CH2OCH2OCH2CH3, CH2S(3-(1,2,4-Triazin)), CH2CH2SCH3 und CH2OH, ausgewählt ist,

    X aus der Gruppe, bestehend aus H, CH2OH, CH2NH-SerinH, CO2CH3, CONHC6H5, CH2NHCO2C6H5, CH2NHCO2CH3, CH2N3, CONHC2H5, CH2NH-Glycin, CON(CH3)2, -CH2NHCO2-, CONH2, CONHC3H7, CH2NH-Serin, CH2SOCH3, CH=NOH, CH2NH-Prolin, CH2CH2(2-Pyridyl), CH=NNHC(=NH)NH2, CONH(CH2)2OH, CH=NNHCONH2, CH2OCOCH3, -CH2OC(CH3)2O-, CH2SC6H5, CH2SOC6H5, CO2n-Hexyl, CONHCH3, CO2(CH2)4CH3,

    und
    ausgewählt ist,

    R aus der Gruppe, bestehend aus OH und OCH3, ausgewählt ist.
  60. Verfahren nach Anspruch 59, wobei Z1 und Z2 H sind, X CO2CH3 ist, R1 NHCONHC2H5 ist, R2 CH2CH2(2-Pyridyl) ist und R OH ist.
  61. Verfahren nach Anspruch 59, wobei Z1 und Z2 H sind, X CO2CH3 ist, R1 und R2 CH2OCH2OCH2CH3 sind und R OH ist.
  62. Verfahren nach Anspruch 59, wobei Z1 und Z2 H sind, X CO2CH3 ist, R1 und R2 CH2SCH2CH3 sind und R OH ist.
  63. Verfahren nach Anspruch 59, wobei Z1, Z2, R1 und R2 H sind, X CO2CH3 ist und R OH ist.
  64. Verfahren nach Anspruch 59, wobei Z1, Z2, R1 und R2 H sind, X CO2(CH2)4CH3 ist und R OH ist.
  65. Verfahren nach Anspruch 59, wobei Z1, Z2 und R1 H sind, R2 CH2OH ist, X CO2CH3 ist und R OH ist.
  66. Verfahren nach Anspruch 59, wobei Z1 und Z2 H sind, R1 und R2 H2S(3-(1,2,4-Triazin)) sind, X CO2CH3 ist und R OH ist.
  67. Verfahren nach Anspruch 59, wobei Z1 und Z2 H sind, R1 Br ist, R2 I ist, X CO2CH3 ist und R OH ist.
  68. Verfahren nach Anspruch 59, wobei Z1 und Z2 H sind, R1 und R2 CH2CH2SCH3 sind, X CO2CH3 ist und R OH ist.
  69. Verfahren nach Anspruch 59, wobei Z1, Z2, R1 und R2 H sind, X CO2CH3 ist und R OCH3 ist.
  70. Verfahren nach Anspruch 59, wobei Z1 und Z2 zusammen =O bilden, R1 und R2 Br sind, X CO2CH3 ist und R OH ist.
Es folgen 24 Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com