PatentDe  


Dokumentenidentifikation DE102005002530A1 23.03.2006
Titel Chimäre DNA-Polymerase
Anmelder Bioline Limited, London, GB
Erfinder Ignatov, Konstantin, Moskau/Moskva, RU;
Kramarov, Vladimir, Moskau/Moskva, RU;
Billigham, Sam, London, GB
Vertreter Maikowski & Ninnemann, Pat.-Anw., 10707 Berlin
DE-Anmeldedatum 14.01.2005
DE-Aktenzeichen 102005002530
Offenlegungstag 23.03.2006
Veröffentlichungstag im Patentblatt 23.03.2006
IPC-Hauptklasse C12N 9/10(2006.01)A, F, I, 20051017, B, H, DE
IPC-Nebenklasse C12N 15/54(2006.01)A, L, I, 20051017, B, H, DE   C12N 15/63(2006.01)A, L, I, 20051017, B, H, DE   C12Q 1/48(2006.01)A, L, I, 20051017, B, H, DE   
Zusammenfassung Durch die vorliegende Erfindung wird eine chimäre temperaturstabile DNA-Polymerase bereitgestellt, die einen Bereich aus einer Tth-DNA-Polymerase I, einen Bereich aus einer Taq-DNA-Polymerase I sowie eine DNA-Polymerasedomäne enthält. Die DNA-Polymerasedomäne umfaßt einen Anteil einer DNA-Polymerasedomäne aus der Tth-DNA-Polymerase I in operativer Verknüpfung mit einem Anteil einer DNA-Polymerasedomäne aus der Taq-DNA-Polymerase I. Ebenso bereitgestellt werden eine Nukleinsäuresequenz sowie eine Aminosäuresequenz des erfindungsgemäßen chimären temperaturstabilen Enzyms. Das erfindungsgemäße chimäre DNA-Polymeraseenzym eignet sich bei DNA-Amplifikationsreaktionen, wie z. B. der Polymerasekettenreaktion.

Beschreibung[de]
GEBIET DER ERFINDUNG

Die vorliegende Erfindung betrifft temperaturstabile DNA-Polymerasen, diese codierende Polynukleotid- und Aminosäuresequenzen, ihre Synthese sowie Verfahren zu ihrer Verwendung.

TECHNISCHER HINTERGRUND

Temperaturstabile DNA-Polymerasen sind allgemein bekannt und eignen sich für einen weiten Bereich von Laborverfahren, vor allem in der Molekularbiologie. Solche Enzyme werden bei Primerverlängerungstechniken, der Nukleinsäuresequenzierung und der Polymerasenkettenreaktion (polymerase chain reaction, PCR) eingesetzt.

DNA-Polymerasen, die die matrizengesteuerte Polymerisation von Desoxyribonukleosidtriphosphaten (dNTPs) unter Bildung von DNA katalysieren, werden in verschiedenen In-vitro-DNA-Syntheseanwendungen eingesetzt, wie z.B. Primerverlängerungstechniken, DNA-Sequenzierung und DNA-Amplifikation.

Temperaturstabile DNA-Polymerasen eignen sich insbesondere bei einer Reihe dieser Techniken, da sich temperaturstabile Enzyme bei relativ hohen Temperaturen verwenden lassen. Dies weist hinsichtlich der Genauigkeit der Primerbindung Vorzüge auf, beispielsweise aufgrund der hohen Stringenz der verwendeten Bedingungen. Die am besten charakterisierten der bekannten Enzyme sind möglicherweise die aus Thermus aquaticus (Taq) und Thermus thermophilus (Tth) isolierten DNA-Polymerasen.

Diese Enzyme weisen eine definierte Bandbreite unterschiedlicher Eigenschaften und Beschränkungen auf. So unterscheiden sich beispielsweise Taq- und Tth-DNA-Polymerasen von einander in den folgenden, in der Praxis signifikanten Eigenschaften:

  • 1) Tth-DNA-Polymerase ist für die Amplifikation langer (über 2 kb) DNA-Sequenzen in der PCR effektiver als Taq-DNA-Polymerase [Ohler L.D., und Rose E.A., PCR Methods Appl. Bd. 2 (1992), S. 51–59; Ignatov K.B. et al., Mol. Biol. (Russ.) Bd. 31 (1997), S. 956–961], was als größere Menge an produzierter DNA angesehen werden kann;
  • 2) Taq-DNA-Polymerase ist gegenüber der Anwesenheit eines vielgepaarten (zur Matrize nicht komplementären) Nukleotids am 3'-Ende des Primes empfindlicher als Tth-DNA-Polymerase [Ignatov K.B. et al., Bioorg. Khim. (Russ.) Bd. 23 (1997), S. 817–822], wodurch die Verwendung der Taq-DNA-Polymerase in allelespezifischen Primerverlängerungsreaktionen gestattet ist;
  • 3) Taq-DNA-Polymerase ist bei der DNA-Amplifikation im Zuge einer PCR spezifischer als Tth-DNA-Polymerase [Ignatov K.B. et al., Bioorg. Khim. (Russ.) Bd. 23 (1997), S. 817–822] und ergibt somit ein höheres Verhältnis von Zielprodukt zu insgesamt synthetisierter DNA.

Um die Effizienz von Laborverfahren, bei denen die oben erwähnten DNA-Polymerasen eingesetzt werden, zu erhöhen, wird die Erzeugung einer neuen DNA-Polymerase, die die Vorteile, jedoch nicht die Nachteile dieser Enzyme besitzen würde, als sehr sinnvoll betrachtet. So würden beispielsweise Primerverlängerungstechniken (wie z.B. allele-spezifische Primerverlängerung) und die PCR-Amplifikation von DNA eine temperaturstabile DNA-Polymerase benötigen, die die DNA-Syntheseeffizienz der Tth-DNA-Polymerase und die für die Taq-DNA-Polymerase charakteristische Spezifität der DNA-Amplifikation auf PCR-Basis in sich vereint.

Es konnte bereits gezeigt werden, daß die Vereinigung von Anteilen von Proteinmolekülen aus unterschiedlichen DNA-Polymerasen in einer Polypeptidkette zur Konstruktion chimärer DNA-Polymerasen führen könnte, die eine Kombination aus den Eigenschaften im Besitz der Ausgangs-DNA-Polymerasen aufweisen [Ignatov K.B. et al., Mol. Biol. (Russ.) Bd. 31 (1997), S. 956–961; Villbrandt B. et al., Protein Eng. Bd. 13 (2000), S. 645–654; U.S.-Patent Nr. 6,228,628; U.K.-Patent Nr. GB 2 344 591].

Es konnte gezeigt werden, daß der N-terminale Bereich der Taq-DNA-Polymerase eine signifikante Wirkung auf die Effizienz einer PCR mit DNA-Matrizen mit einer Länge von mehr als 2 kb ausübt. So wird beispielsweise durch Deletion der ersten 235 Aminosäuren der Taq-DNA-Polymerase die Fähigkeit dieses Enzyms zur Amplifikation langer DNA-Sequenzen vermindert [Barnes W.M., Gene Bd. 112 (1992), S. 29–35]. Die Fähigkeit der Taq- und Tth-DNA-Polymerasen zur Amplifikation langer DNA-Sequenzen wurde auch Sequenzen zwischen den entsprechenden Aminosäurepositionen 498 und 554 bei der Taq-DNA-Polymerase bzw. 500 und 556 bei der Tth-DNA-Polymerase zugeschrieben [Blanco L. et al., Gene Bd. 100 (1991), S. 27–28; Ignatov K.B. et al., Mol. Biol. (Russ.) Bd. 31 (1997), S. 956–961]. Unterschiede in diesen Bereichen haben jedoch keine Auswirkung auf die Spezifität der DNA-Synthese und die Empfindlichkeit der beiden DNA-Polymerasen gegenüber der Anwesenheit einer Fehlpaarung am 3'-Ende des Primers [Ignatov K.B. et al., Mol. Biol. (Russ.) Bd. 31 (1997), S. 956–961].

Die oben erwähnten früheren Erkenntnisse gestatteten den Erfindern die Schlußfolgerung, daß eine Vereinigung des N-terminalen Bereichs der Tth-DNA-Polymerase (einschließlich des die Aminosäuren 500-556 überspannenden Bereichs) mit dem C-terminalen Bereich der Taq-Polymerase (der die den Aminosäuren 600-832 der Taq-Sequenz entsprechende Sequenz enthält) in einer einzigen Polypeptidkette gestattet, eine chimäre temperaturstabile DNA-Polymerase zu gewinnen, die die Syntheseeffizienz der Tth-DNA-Polymerase und die Spezifität der Taq-DNA-Polymerase besitzt. Somit wäre diese chimäre DNA-Polymerase mit einer Kombination wünschenswerter Eigenschaften, die in der Natur nicht vorkommen, bei verschiedenen In-Vitro-DNA-Syntheseanwendungen geeignet.

KURZE BESCHREIBUNG DER ERFINDUNG

Die vorliegende Erfindung betrifft ein chimäres temperaturstabiles Enzym, daß DNA-Polymeraseaktivität aufweist.

In einer ersten Ausführungsform, wird durch die vorliegende Erfindung ein chimäres temperaturstabiles Enzym mit einem N-terminalen Bereich, einem C-terminalen Bereich und einer DNA-Polymerasedomäne bereitgestellt. Damit umfaßt der N-terminale Bereich des chimären temperaturstabilen Enzyms einen N-terminalen Bereich aus einer Tth-DNA-Polymerase I und der C-terminale Bereich des chimären temperaturstabilen Enzyms einen C-terminalen Bereich aus einer Taq-DNR-Polymerase I. Die DNA-Polymerasedomäne umfaßt einen Anteil einer DNA-Polymerasedomäne des N-terminalen Bereichs aus einer Tth-DNA-Polymerase I in operativer Verknüpfung mit einem Anteil einer DNA-Polymerasedomäne des C-terminalen Bereichs aus einer Taq-DNA-Polymerase I.

Das erfindungsgemäße chimäre temperaturstabile Enzym kann ebenso einen Anteil der oder die gesamte 5'-Nukleasedomäne, die innerhalb des N-terminalen Bereichs aus der Tth-DNA-Polymerase I liegt, umfassen. Dieser Einschluß einer 5'-Nukleasedomäne verleiht dem chimären temperaturstabilen Enzym eine 5'-nach-3'-Nukleaseaktivität.

Vorzugsweise umfaßt das erfindungsgemäße chimäre temperaturstabile Enzym die Aminosäuresequenz der SEQ ID No: 1 oder eine Variante oder ein Fragment davon mit der unten angegebenen Bedeutung.

Vorzugsweise weist eine Variante der SEQ ID No: 1 wenigstens 92% Sequenzidentität mit SEQ ID No: 1 auf, beispielsweise 93%, 94%, 95%, 96%, 97%, 98% oder 99% Sequenzidentität. Somit kann sich beispielsweise die Variante von der als SEQ ID No: 1 aufgeführten Sequenz um eine oder mehrere Additionen, Substitutionen, Deletionen oder Insertionen, vorzugsweise konservativer Substitutionen, einer oder mehrerer (wie z.B. 1 oder 2, 3, 4, 5, 6, 7, 8 oder 9, oder etwa 10, 12, 14, 16, 18 oder 19) Aminosäuren unterscheiden. Die Variante behält DNA-Polymerase I-Aktivität und eventuell 5'-Nukleaseaktivität.

Durch die Erfindung wird ebenso ein Fragment der SEQ ID No: 1 oder ein Fragment der oben erwähnten Variante der SEQ ID No: 1 bereitgestellt. Ein solches Fragment kann die Reste 280 bis 828 der SEQ ID No: 1 oder seiner Variante, wenn diese der SEQ ID No: 1 vergleichend gegenübergestellt ist, umfassen. Das Fragment behält die DNA-Polymerase I-Aktivität und eventuell die 5'-Nukleaseaktivität.

So wurde beispielsweise in dem chimären temperaturstabilen Enzym der SEQ ID No: 1 das in Position 2 der Tth-DNA-Polymerase-I-Sequenz der SEQ ID No: 13 gefundene Asp gegen die Glu ausgetauscht und das Leu in Position 3 der Tth-DNA-Polymerase I der SEQ ID No: 13-Sequenz gegen Ala im erfindungsgemäßen chimären temperaturstabilen Enzym ausgetauscht. Somit können die Reste 2 und 3 des SEQ ID No: 1 zu Asp bzw. Leu variiert werden. Weitere Varianten werden unten weiter erörtert.

Durch die vorliegende Erfindung wird eine Nukleinsäure bereitgestellt, die ein erfindungsgemäßes chimäres temperaturstabiles Enzym codiert. Vorzugsweise weist die Nukleinsäure die Nukleotidsequenz, wie sie in der SEQ ID No: 2 gezeigt ist, auf.

Eine weitere Ausführungsform der vorliegende Erfindung betrifft einen rekombinanten DNA-Vektor, der die das erfindungsgemäße chimäre temperaturstabile Enzym codierende Nukleinsäuresequenz in operativer Verknüpfung mit einem Promoter enthält, sowie eine mit dem rekombinanten DNA-Vektor transformierte Wirtszelle. Ebenso umfaßt ist ein Verfahren zur Herstellung eines erfindungsgemäßen chimären temperaturstabilen Enzyms, bei dem man die erfingungsgemäße Wirtszelle unter den Expressionsbedingungen für das Enzym kultiviert und das Enzym aus der Zelle gewinnt.

In einer weiteren Ausführungsform der vorliegende Erfindung wird ein Kit bereitgestellt, der ein erfindungsgemäßes chimäres temperaturstabiles Enzym ebenso wie einen Reaktionspuffer und dNTPs umfassen kann. Ein solcher Kit kann zusammen mit Primern und doppelsträngigerer Matrizen-DNA bei der Technik der DNA-Amplifikation unter Verwendung der Polymerasenkettenreaktion (PCR) eingesetzt werden.

KURZE BESCHREIBUNG DER FIGUREN UND TABELLEN

Mit 1 wird ein Schema bereitgestellt, in dem Schritte zur Konstruktion des die erfindungsgemäße chimäre Polymerase codierenden chimären Gens und eines Expressionsvektors dargestellt sind.

Mit 2 wird eine photographische Abbildung eines Agarosegels bereitgestellt, bei der die Ausbeute eines 2500bp großen, durch PCR-Amplifikation mit Taq-DNA-Polymerase, Tth-DNR-Polymerase bzw. der chimären DNA-Polymerase der vorliegenden Erfindung erhältliche DNA-Fragments verglichen wird.

Mit 3 wird eine photographische Abbildung eines Agarosegels bereitgestellt, bei der die Spezifität der mit Taq-DNA-Polymerase, Tth-DNA-Polymerase bzw. der chimären DNA-Polymerase der vorliegende Erfindungdurchgeführten PCR-Amplifikationsreaktionen verglichen wird.

In TABELLE 1 sind Daten des Einbaus einer radioaktiven Markierung in das 500-bp große, mit Taq oder Tth oder der chimären DNA-Polymerase mittels PCR mit Primern, die ggf. 3'-fehlpaarende Nukleotide enthalten, synthetisierte DNA-Fragment, aufgeführt.

AUSFÜHRLICHE BESCHREIBUNG DER ERFINDUNG

Durch die vorliegende Erfindung werden eine chimäre temperaturstabile DNA-Polymerase sowie Mittel zur Herstellung des Enzyms bereitgestellt. Um das Verständnis der Erfindung zu erleichtern, wird nachfolgend eine Reihe von Begriffen definiert.

Chimär

Der Begriff „chimär" wird im Zusammenhang mit der vorliegende Erfindungmit Bezug auf ein Enzym verwendet, dessen Aminosäuresequenz Teilsequenzen von Aminosäuresequenzen aus wenigstens zwei voneinander verschiedenen Proteinen umfaßt. Diese Teilsequenzen können unter Erhalt des chimären Enzyms operativ verknüpft sein. Unter operativer Verknüpfung versteht man die Zusammenfügung von Teilsequenzbestandteilen, so daß ein funktionelles Enzym erhalten wird. Die Verknüpfung kann mit verschiedenen Verfahren, wie z.B. Ligation, erreicht werden.

Temperaturstabiles Enzym

Temperaturstabile Enzyme sind im Fachgebiet allgemein bekannt. Der Begriff „temperaturstabiles Enzym", wie er hierin verwendet wird, bezieht sich auf ein Enzym, das wärmestabil ist und optimal bei einer erhöhten Temperatur reagiert. Das temperaturstabile Enzym der vorliegende Erfindungkatalysiert die Primerverlängerung optimal bei einer Temperatur zwischen 60 und 90°C und kann unter den Temperaturkreislaufbedingungen, die üblicherweise in Kreislauf-Sequenzreaktionen und Polymerasekettenreaktionsamplifikationen verwendet werden, eingesetzt werden (beschrieben in U.S.-Patent No. 4,965,188).

N-terminaler Bereich aus einer Tth-DNA-Polymerase I

Unter „N-terminalem Bereich aus einer Tth-DNA-Polymerase I" versteht man die Aminosäuresequenz (a), die Position 1 bis 601 der SEQ ID No: 13 entspricht; (b) eine Variante, die wenigstens 87%, 90%, 95%, 96%, 97%, 98% oder 99% Identität mit (a) aufweist; oder (c) ein C-terminales Fragment von (a) oder (b) mit einem N-Terminus, der an einer Position beginnt, die einem Rest von 4 bis 280 der SEQ ID No: 13 entspricht. Die Variante (b) kann eine Sequenz aufweisen, die beispielsweise bis auf eine Änderung einer einzigen Aminosäure oder 2, 3, 4, 5, 6, 7, 8 oder 9 Änderungen oder etwa 10, 15, 20, 30, 40, 50, 60 oder 70 Änderungen (a) entspricht. Vorzugsweise weist die Variante 1 bis 10 Aminosäureänderungen, beispielsweise 1 bis 5 Änderungen, auf. Die Variante kann mittels Addition, Substitution, Deletion oder Insertion einer oder mehrerer Aminosäuren, vorzugsweise mittels einer konservativen Substitution, wie unten definiert, hergestellt werden. Das Fragment (c) kann als Minimalsequenz eine Aminosäuresequenz von Positionen 280 bis 555 der SEQ ID No: 13 umfassen. Die Varianten und Fragmente zeigen bei Verknüpfung mit dem C-terminalen Bereich eine Taq-DNA-Polymerase I DNA-Polymerase-I-Aktivität. Die Varianten und Fragmente können ebenso 5'-Nukleaseaktivität zeigen.

In einer bevorzugten Ausführungsform umfaßt der N-terminale Bereich aus einer Tth-DNA-Polymerase I eine durchgehende Aminosäuresequenz von zwischen Position 1 bis 280 bis zu einer Position n einer Tth-DNA-Polymerase I und enthält einen Anteil einer DNA-Polymerasedomäne. Die Position n kann sich zwischen den Aminosäuren 555 bis 601 einer Tth-DNA-Polymerase I befinden und entspricht einer Aminosäure in Position m einer Taq-DNA-Polymerase I, wobei m gleich n-2 ist. Vorzugsweise umfaßt der N-terminale Bereich aus einer Tth-DNA-Polymerase I eine Aminosäuresequenz zwischen den Positionen 4 bis 600 der SEQ ID No: 13.

C-terminaler Bereich aus einer Taq-DNA-Polymerase I

Unter „C-terminaler Bereich aus einer Taq-DNA-Polymerase I" versteht man die Aminosäuresequenz (a), die Position m+1 bis 832 der SEQ ID No: 14 entspricht; (b) eine Variante, die wenigstens 92%, 93%, 94%, 95%, 96%, 97%, 98% oder 99% Identität mit (a) aufweist; oder (c) ein Fragment von (a) oder (b) mit einer Aminosäuresequenz, die Position m+1 bis zwischen 826 und 832 der SEQ ID No: 14 entspricht. Die Position m kann sich zwischen den Aminosäuren 553 bis 598 einer Taq-DNA-Polymerase I befinden und entspricht einer Aminosäure in Position n einer Tth-DNA-Polymerase I, wobei n gleich m+2 ist. Die Variante (b) kann eine Sequenz aufweisen, die beispielsweise (a) entspricht, abgesehen von einer Änderung einer einzigen Aminosäure oder 2, 3, 4, 5, 6, 7, 8 oder 9 Änderungen oder etwa 10, 12, 14, 16, 18 oder 19 Änderungen. Vorzugsweise weist die Variante 1 bis 10 Aminosäureänderungen, beispielsweise 1 bis 5 Änderungen, auf. Die Variante kann mittels Addition, Substitution, Deletion und Insertion einer oder mehrerer Aminosäuren, vorzugsweise mittels einer konservativen Substitution, wie unten definiert, hergestellt werden. Das Fragment (c) kann als Minimalsequenz eine Aminosäuresequenz von Positionen 599 bis 826 der SEQ ID No: 14 umfassen. Die Varianten und Fragmente zeigen bei Verknüpfung mit dem N-terminalen Bereich einer Tth-DNA-Polymerase I DNA-Polymerase-I-Aktivität.

In einer bevorzugten Ausführungsform umfaßt der C-terminale Bereich aus einer Taq-DNA-Polymerase I eine durchgehende Aminosäuresequenz von einer Position m+1 bis 832 einer Taq-DNA-Polymerase I und enthält einen Anteil einer DNA-Polymerasedomäne. Vorzugsweise umfaßt der C-terminale Bereich aus einer Taq-DNA-Polymerase I eine Aminosäuresequenz zwischen Positionen 554 bis 832 der SEQ ID No: 14.

Struktur eines chimären temperaturstabilen Enzyms

Vorzugsweise umfaßt das erfindungsgemäße chimäre temperaturstabile Enzym eine Aminosäuresequenz (a), die SEQ ID No: 1 entspricht; (b) eine Variante, die wenigstens 92%, 93%, 94%, 95%, 96%, 97%, 98% oder 99% Identität mit (a) aufweist; oder (c) ein Fragment von (a) oder (b). Die Variante (b) kann eine Sequenz aufweisen, die beispielsweise (a) entspricht, abgesehen von einer Änderung einer einzigen Aminosäure oder 2, 3, 4, 5, 6, 7, 8 oder 9 Änderungen oder etwa 10, 12, 14, 16, 18 oder 19 Änderungen. Vorzugsweise weist die Variante 1 bis 10 Aminosäureänderungen, beispielsweise 1 bis 5 Änderungen, auf. Die Variante kann mittels Addition, Substitution, Deletion und Insertion einer oder mehrerer Aminosäuren, vorzugsweise mittels einer konservativen Substitution, wie unten definiert, hergestellt werden. Die Varianten und Fragmente zeigen DNA-Polymerase-I-Aktivität und eventuell 5'-Nukleaseaktivität.

Erfindungsgemäße Fragmente können etwa 550, 600, 650, 700, 750 oder 800 Aminosäuren umfassen. Vorzugsweise umfassen Fragmente eines chimären temperaturstabilen Enzyms einen N-terminalen Bereich, einen C-terminalen Bereich und DNA-Polymerasedomäne. Beispielweise einen N-terminalen Bereich aus einer Tth-DNA-Polymerase I oder einen Anteil davon und einen C-terminalen Bereich einer Taq-DNA-Polymerase I oder einen Anteil davon, wie oben beschrieben.

Besonders bevorzugt umfaßt das chimäre temperaturstabile Enzym der vorliegende Erfindung die in SEQ ID No: 1 gezeigte Sequenz oder eine Variante oder ein Fragment davon.

Konservative Substitutionen

Zu den konservativen Substitutionen, auf die oben Bezug genommen wird, gehören beispielsweise die in der folgenden Tabelle aufgeführten Substitutionen, bei denen Aminosäuren im selben Block in der zweiten Spalte und vorzugsweise in der selben Reihe in der dritten Spalte gegeneinander ausgetauscht werden können:

Aminosäureidentität

Die prozentuale Identität von Aminosäuresequenzen läßt sich mit kommerziell erhältlichen Alogrithmen berechnen. Dabei können die folgenden Programme (zur Verfügung gestellt von National Center for Biotechnology Information) zur Bestimmung von Homologien verwendet werden: BLAST, gapped BLAST, BLASTN und PSI-BLAST, die mit den Standardparametern verwendet werden können.

Anteil einer DNA-Polymerasedomäne

Ein „Anteil einer DNA-Polymerasedomäne" bezieht sich auf eine Sequenz von Aminosäuren, die Teil einer DNA-Polymerasedomäne aus einer Tth-DNA-Polymerase I und/oder einer Taq-DNA-Polymerase I bilden. In der vorliegende Erfindungist vorzugsweise ein Anteil einer DNA-Polymerasedomäne des N-terminalen Bereichs aus einer Tth-DNA-Polymerase I mit einem Anteil einer DNA-Polymerasedomäne des C-terminalen Bereichs aus einer Taq-DNA-Polymerase I operativ verknüpft.

Zelle

Die Ausdrücke „Zelle", „Zelllinie", und „Zellkultur", wie sie hier verwendet werden, lassen sich untereinander austauschbar verwenden, wobei all diese Bezeichnungen die Nachkommen einschließen. Somit umfassen die Worte „Transformanten" oder „transformierte Zellen" die primäre betreffende Zelle und davon abgeleitete Kulturen, ohne Berücksichtigung der Anzahl der Transfers. Ebenso versteht sich, daß aufgrund beabsichtigter oder unbeabsichtigter Mutationen alle Nachkommen hinsichtlich des DNA-Gehalts nicht absolut identisch sein müssen. Mutante Nachkommen, die die gleiche Funktionalität aufweisen, auf die ein Screening in der ursprünglich transformierten Zelle durchgeführt wurde, sind umfaßt.

Gen

Der Begriff „Gen" bezieht sich auf eine DNA-Sequenz, die zur Herstellung eines gewinnbaren bioaktiven Polypeptids oder Vorläufermoleküls notwendige Kontroll- und Codierungssequenzen umfaßt.

Oligonukleotide

Der Begriff „Oligonukelotide", wie er hier verwendet wird, ist definiert als ein Molekül, daß aus zwei oder mehreren Desoxyribonukleotiden oder Ribonukleotiden besteht. Die genaue Größe hängt von vielen Faktoren ab, die wiederum von der letztendlichen Funktion oder Verwendung des Oligonukleotids abhängen. Oligonukleotide lassen sich mit allen geeigneten Verfahren, einschließlich beispielsweise der Clonierung und Restriktion entsprechender Sequenzen und direkter chemischer Synthese mit einem Verfahren, wie z.B. dem Phosphotriesterverfahren, dem Diethylphosphoramidit verfahren und dem Festträgerverfahren, herstellen. Eine Übersicht über Syntheseverfahren ist in [Goodchild J., Bioconjug. Chem. Bd. 1 (1990), S. 165–187] gegeben.

Primer

Der Begriff „Primer", wie er hier verwendet wird, bezieht sich auf ein Oligonukleotid, daß als Startpunkt der Synthese fungieren kann, wenn es Bedingungen ausgesetzt wird, unter denen die Primerverlängerung initiiert wird. Die Synthese eines Primerverlängerungsprodukts, das zu einem Nukleinsäurestrang komplementär ist, wird in Gegenwart der notwendigen vier unterschiedlichen Nukleosidtriphosphate sowie einer temperaturstabilen DNA-Polymerase in einem geeigneten Puffer bei einer geeigneten Temperatur gestartet. Ein „Puffer" enthält Co-Faktoren (wie z.B. zweiwertige Metallionen) und Salz (zur Bereitstellung der geeigneten Ionenstärke), eingestellt auf den gewünschten pH-Wert.

Ein Primer, der an den nicht codierenden Strang einer Gensequenz hybridisiert (und dementsprechend eine Teilsequenz des codierenden Strangs darstellt), wird hier als „stromaufwärts" Primer bezeichnet. Ein Primer, der an den codierenden Strang einer Gensequenz hybridisiert, wird hier als „stromabwärts" Primer bezeichnet.

Restriktionsendonucleasen

Die Begriffe „Restiktionsendonucleasen" und „Restriktionsenzyme" beziehen sich auf Enzyme, die üblicherweise bakteriellen Ursprungs sind und die Doppelstrang-DNA an oder nahe einer spezifischen Nukleotidsequenz schneiden.

Konstruktion eines chimären temperaturstabilen Enzyms

Durch die vorliegende Erfindung wird ein chimäres temperaturstabiles Enzym bereitgestellt, das die Eigenschaften einer hohen Effizienz der PCR-Amplifikation langer (mehr als 2 kb) DNA-Sequenzen, einer hohen Empfindlichkeit gegenüber der Anwesenheit eines fehlgepaarten (zur Matrize nicht komplementären) Nukleotids am 3'-Ende des Primers sowie einer hohen Spezifität bei der DNA-Amplifikation im Zuge einer PCR aufweist. Dabei stammen die Eigenschaften von wenigstens zwei unterschiedlichen Quellen, wobei die Eigenschaften vorzugsweise in Kombination vorliegen.

Es versteht sich, daß ein chimäres Protein auf vielerlei Weise konstruiert werden kann. Das erfindungsgemäße chimäre temperaturstabile Enzym kann durch direkte Manipulation von Aminosäuresequenzen hergestellt werden. In einer alternativen und bevorzugten Ausführungsform wird das chimäre temperaturstabile Enzym von einem chimären Gen exprimiert, das die chimäre Aminosäuresequenz codiert, d.h. über die Konstruktion eines rekombinanten DNA-Moleküls mit anschließender Expression des Proteinprodukts.

Die Manipulation auf der DNA-Ebene gestattet das Zusammenfügen von DNA-Fragmenten aus unterschiedlichen Genen mittels Ligation unter Erhalt von eine chimäre Polymerase codierender DNA. DNA-Fragmente aus unterschiedlichen DNA-Polymerasegenen können durch DNA-Reinigung mit anschließender Restriktionsenzymverdauung, PCR oder z.B. sogar direkter DNA-Synthese erhalten werden. Das Protein kann dann von der DNA exprimiert werden, wobei in Wirtszellen gehaltene Expressionsvektoren verwendet werden. Bei der Clonierung und Manipulation von DNA sowie der Proteinexpression handelt es sich jeweils um Standardtechniken im Fachgebiet, wobei sich Einzelheiten geeigneter Techniken in Sambrook et al, Molecular cloning – A Laboratory Manual 1989 finden.

Durch die vorliegende Erfindung wird daher ebenso ein chimäres temperaturstabiles Enzym codierende DNA zusammen mit einem diese DNA enthaltenden Vektor, diesen Vektor enthaltende Wirtszellen und Kulturen solcher Zellen ebenso wie Verfahren zur Herstellung des Enzyms bereitgestellt.

Verfahren zur Herstellung des Enzyms sind im Fachgebiet allgemein bekannt und umfassen die Kultivierung einer erfindungsgemäßen Wirtszelle unter Bedingungen für die Expression eines chimären temperaturstabilen Enzyms sowie die Gewinnung des Enzyms aus der Wirtszelle. „Gewinnung des Enzyms" bedeutet den Vorgang der Isolierung und/oder Reinigung des Proteins des chimären temperaturstabilen Enzyms aus der Wirtszelle. So läßt sich beispielsweise eine Reinigung auf Grundlage der Größe, Löslichkeit Ladung und/oder der spezifischen Bindungsaffinität (z.B. durch Verwenddung eines Antikörpers) des Proteins erzielen.

Im allgemeinen wird eine erfindungsgemäße Nukleinsäure als Isolat in isolierter und/oder gereinigter Form oder frei bzw. weitgehend frei von Material, mit dem sie natürlicherweise assoziiert ist, außer möglicherweise einer oder mehrerer Regulationssequenz(en) zur Expression, bereitgestellt. Dabei kann die Nukleinsäure vollständig oder teilweise synthetisch sein und genomische DNA, cDNA oder RNA enthalten.

DNA und Vektoren, die ein erfindungsgemäßes Enzym vollständig oder teilweise codieren, können geeigneterweise derartige Kontrollelemente, wie z.B. Start-/Stop-Codons, Promotoren usw., beinhalten, wie es nach den Wünschen des Fachmanns als notwendig oder sinnvoll erachtet wird. Geeignete Konstrukte sind in den beiliegenden Beispielen dargestellt.

Das chimäre Gen wird aus dem Tth-DNA-Polymerase-Gen und dem Taq-DNA-Polymerase-Gen unter Verwendung von auf dem Gebiet der Molekularbiologie allgemein bekannten Standardtechniken der Genmanipulation hergestellt, wie in Beispiel 1 beschrieben.

Das für Tth-DNA-Polymerase codierende Gen, die Nukleotidsequenz des Tth-DNA-Polymerase-Gens ebenso die vollständige Aminosäuresequenz des codierten Proteins sind im U.S.-Patent No. 5,618,711 beschrieben.

Das für Taq-DNA-Polymerase codierende Gen, die Nukleotidsequenz des Taq-DNA-Polymerase-Gens ebenso wie die vollständige Aminosäuresequenz des codierten Proteins sind in [Lawyer, F. C. et al., J. Biol. Chem., 261, 11, 6427–6437] sowie im U.S.-Patent No. 5,079,352 beschrieben.

Sequenz eines chimären temperaturstabilen Enzyms aus Beispiel 1

Die Aminosäuresequenz eines erfindungsgemäßen chimären temperaturstabilen Enzyms ist in SEQ ID No: 1 angegeben. Ein Teil der Aminosäuresequenz des chimären temperaturstabilen Enzyms von Aminosäure 4 bis 600 umfaßt die Sequenz der Aminosäuren 4-600 der Tth-DNA-Polymerase I. Ein Teil der Aminosäuresequenz des chimären temperaturstabilen Enzyms von Aminosäure 556 bis 834 umfaßt die Sequenz der Aminosäuren 554-832 der Taq-DNA-Polymerase I. Somit ist die Sequenz der Aminosäuren 556-600 des chimären temperaturstabilen Enzyms sowohl mit der Sequenz der Aminosäuren 556-600 der Tth-DNA-Polymerase I als auch der Sequenz der Aminosäuren 554-598 der Taq-DNA-Polymerase I identisch.

Die Sequenz der Aminosäuren 1-3 des erfindungsgemäßen chimären temperaturstabilen Enzyms ergab sich aus der Konstruktion des rekombinanten Expressionsvektors (beschrieben im Beispiel 1).

Für das chimäre temperaturstabile Enzym aus Beispiel 1 codierende Nukleinsäure

Die Nukleotidsequenz der ein chimäres temperaturstabiles Enzym codierenden Nukleinsäure ist in SEQ ID No: 2 angegeben. Die für das chimäre temperaturstabile Enzym codierende Nukleinsäure wurde wie in Beispiel 1 beschrieben, erhalten.

Die Nukleotidsequenz der die chimäre DNA-Polymerase codierenden Nukleinsäure besteht aus Teilsequenzen:

der Sequenz der Nukleotide 1 – 8, die sich aus der Konstruktion des rekombinanten Expressionsvektors ergab, beschrieben in Beispiel 1;

der Sequenz der Nukleotide 9 – 1786, die dem Gen für Tth-DNA-Polymerase entnommen wurde und die mit der Nukleotidsequenz 9 – 1786 des Tth-DNA-Polymerase-Gens identisch ist;

der Sequenz der Nukleotide 1787 – 2505, die dem Gen für Taq-DNA-Polymerase entnommen wurde und die mit der Nukleotidsequenz 1781 – 2499 des Taq-DNA-Polymerase-Gens identisch ist.

Eigenschaften eines chimären temperaturstabilen Enzyms der vorliegende Erfindung

Ein chimäres temperaturstabiles Enzym der vorliegende Erfindungstellt eine signifikante Verbesserung gegenüber den in der Literatur beschriebenen temperaturstabilen DNA-Polymerasen dar. Insbesondere liefert die erfindungsgemäße DNA-Polymerase die folgende Kombination von Eigenschaften:

  • 1. Hohe Effizienz der Amplifikation langer DNA-Sequenzen. Die Effizienz des chimären Enzyms ist wenigstens 5mal so hoch wie die der Taq-DNA-Polymerase und nicht niedriger als die Tth-DNA-Polymerase (Beispiel 3).
  • 2. Hohe Empfindlichkeit gegenüber der Anwesenheit eines fehlgepaarten Nukleotids am 3'-Primerende. Das chimäre Enzym ist wenigstens 6mal empfindlicher gegenüber der Anwesenheit einer Fehlpaarung am 3'-Ende des Primers als Tth-DNA-Polymerase und nicht weniger empfindlich als die Taq-DNA-Polymerase (Beispiel 4).
  • 3. Hohe Spezifität der DNA-Amplifikation bei der PCR. Das chimäre Enzym zeigt eine wesentlich höhere Spezifität bei der Amplifikation von DNA auf PCR-Basis als die Tth-DNA-Polymerase und nicht weniger Spezifität als die Taq-DNA-Polymerase (Beispiel 5); und
  • 4. Die DNA-Polymerase läßt sich leicht und effizient auf einem hohen Niveau in einem rekombinanten Expressionssystem exprimieren, wodurch die kommerzielle Produktion des Enzyms erleichtert wird (Beispiel 2).

Die Kombination von Eigenschaften im Besitz des erfindungsgemäßen chimären temperaturstabilen Enzyms eignet sich insbesondere für Polymerasekettenreaktionen und liefert in signifikanter Weise verbesserte Ergebnisse. Die vorliegende Erfindung umfaßt ebenso ein Kit zur Verwendung bei der PCR, der das erfindungsgemäße chimäre temperaturstabile Enzym, einen Reaktionspuffer und dNTPs enthalten kann. Primer sowie für die Reaktion spezifische doppelsträngige Matrizen-DNA können ebenso im Kit enthalten sein. Ein derartiges Verfahren zur DNA-Amplifikation kann die folgenden Schritte umfassen, bei denen man:

  • a) ein Reaktionsgemisch, das das erfindungsgemäße chimäre temperaturstabile Enzym, einen Reaktionspuffer, dNTPs, Primer sowie doppelsträngige Matrizen-DNA umfaßt, bereitstellt;
  • b) das Reaktionsgemisch zur Trennung der Matrizen-DNA erwärmt;
  • c) das Reaktionsgemisch abkühlt, um die Bindung der Primer an die Matrizen-DNA zu gestatten;
  • d) das Reaktionsgemisch zur Auslösung des durch das chimäre temperaturstabile Enzym katalysierten Annealing der dNTPs erwärmt;
  • e) die Schritte b) bis d) zur Herstellung mehrerer Kopien der Matrizen-DNA wiederholt.

Die Eigenschaften des erfindungsgemäßen chimären temperaturstabilen Enzyms werden nachfolgend in den beiliegenden Beispielen veranschaulicht.

FIGUREN

Die Figuren, auf die in den Beispielen Bezug genommen wird, werden nachfolgend ausführlicher beschrieben.

1. Schema, in dem die Schritte bei der Konstruktion des Plasmids pTTT, das das chimäre Gen der erfindungsgemäßen chimären Polymerase enthält, dargestellt sind (ausführlich in Beispiel 1 beschrieben).

2. Elektrophoretische Analyse von PCR-Produkten, bei der die Ausbeute eines 2500bp großen, durch PCR-Amplifikation mit Taq-DNA-Polymerase, Tth-DNA-Polymerase sowie dem chimären temperaturstabilen Enzym der vorliegenden Erfindung erhältlichen DNA-Fragments verglichen wird, wobei sich zeigt, daß 0,5 U des chimären Enzyms eine ähnliche Effizienz der PCR-Amplifikation aufweist wie 0,5 U Tth-Polymerase und 2,5 U Taq-Polymerase. Das 2500bp große DNA-Fragment wurde mit 0,5 U Tth (Spur 1); 0,5 U des chimären Enzyms (Spur 2); 0,5 U, 1,5 U, 2,5 U Taq-Polymerase (Spuren 3, 4 bzw. 5) amplifiziert (ausführlich in Beispiel 3 beschrieben).

3. Elektrophoretische Analyse von in Gegenwart einer beträchtlichen Menge an E. coli-DNA erhaltenen PCR-Produkten, bei der die Spezifität der mit Taq-DNA-Polymerase, Tth-DNA-Polymerase sowie dem chimären temperaturstabilen Enzym durchgeführten PCR-Amplifikationsreaktionen verglichen wird, wobei sich zeigt, daß das chimäre Enzym eine wesentlich höhere Spezifität in der PCR als Tth und nicht weniger Spezifität als Taq-Polymerase zeigt. Die Reaktionen wurden mit 3,5 U Tth (Spur 1), 3,5 U des chimären Enzyms (Spur 2) sowie 3,5 U Taq-DNA-Polymerase (Spur 3) durchgeführt (ausführlich in Beispiel 5 beschrieben).

Die Beispiele betreffen die Herstellung und das Testen eines erfindungsgemäßen chimären temperaturstabilen Enzyms. Die Beispiele dienen der Veranschaulichung der vorliegenden Erfindung, sind jedoch nicht daran gebunden. Alle Verfahren, Preparationen, Lösungen und ähnliches, die nicht spezifisch definiert sind, lassen sich in Sambrook et al. finden. Alle Lösungen sind wässrig und werden in sterilem, deionisiertem Wasser angesetzt, soweit nicht anders angegeben. Alle Enzyme wurden von Bioline Limited (London, GB) bezogen.

BEISPIEL 1 Konstruktion eines chimären Gens und eines Expressionssystems

Es wurde ein chimäres Gen konstruiert, daß einen Anteil des Tth-DNA-Polymerase-Gens und einen Anteil des Taq-DNA-Polymerase-Gens umfaßt. Die genaue Ausführung erfolgte wie in diesem Beispiel nachfolgend beschrieben.

Ein. Fragment des Tth-DNA-Polymerase-Gens [US-Patent Nr. 5,618,711], das die Aminosäuren 4 bis 597 repräsentiert, wurde durch PCR-Amplifikation von Gesamt-DNA aus Thermus thermophilus erhalten, wobei als Primer die beiden synthetischen DNA-Primer PrTTH1 und PrTTH2 (unten) verwendet wurden. Die Gesamt-DNA wurde aus Thermus thermophilus mit dem Phenol-Deproteinisierungsverfahren isoliert. Als Primer wurden dabei verwendet:

PrTTH1 5'-ATAGATCTGATGCTTCCGCTCTTTGA-3' [SEQ ID No: 3]

PrTTH2 5'-GGCCCGGCGGATCCTCTGGCCCAA-3'[SEQ ID No: 4]

Der Stromaufwärts-Primer PrTTH1 ist zur Wildtyp-DNR, beginnend mit Codon 4, homolog; dieser Primer ist dafür vorgesehen, eine Bgl II-Stelle in das amplifizierte DNA-Produkt einzubauen. Der Stromabwärts-Primer PrTTH2 ist zu den Codons 592-599 auf dem nicht-codierenden Strang des für Tth-DNA-Polymerase codierenden Wildtyp-Gens homolog und enthält eine BamH I-Stelle.

Die PCR wurde unter Verwendung eines DNA Thermal Cycler 480 (Perkin-Elmer-Cetus) durchgeführt. Das Reaktionsgemisch (50 mkl) enthielt 67 mM Tris-HCl (pH 8,8), 16,6 mM (NH4)2SO4, 0,01% Tween-20, je 0,2 mM dNTP, 1,5 mM MgCl2, mit je 10 pmol Primer, 100 ng DNA als Matrize, und 5 U Taq-DNA-Polymerase. Die Reaktion umfaßte 25 Zyklen: 30 s bei 94°C; 30 s bei 58°C; 100 s bei 72°C.

Ein DNA-Fragment des Taq-DNA-Polymerase-Gens [Lawyer, F. C. et al., J. Biol. Chem., Bd. 261, S. 6427–6437], das für die Aminosäuren 592 bis 832 codiert, wurde durch PCR-Amplifikation von Gesamt-DNA aus Thermus aquaticus YT1 erhalten, wobei als Primer die beiden synthetischen DNA-Primer PrTAQ1 und PrTAQ2 (unten) eingesetzt wurden. Die Gesamt-DNA wurde aus Thermus aquaticus YT1 mit dem Phenol-Deproteinisierungsverfahren isoliert [Sambrook et al.]. Dabei wurden als Primer verwendet:

PrTAQ1 5'-CAGAGGATCCGCCGGGCCTTCA-3' [SEQ ID No: 5]

PrTAQ2 5'-AAGTCGACTCACTCCTTGGCGGAGAGCCA-3' [SEQ ID No: 6]

Der Stromaufwärts-Primer PrTAQ1 ist zur Wildtyp-DNA aus Thermus aquaticus YT1 DNA [Lawyer et al.], beginnend mit dem Codon 592 des DNA-Polymerase-Gens, homolog und enthält eine BamH I-Stelle. Der Stromabwärts-Primer PrTAQ2 ist zu den Codons 827-832 auf dem anderen Strang des Wildtyp-Gens, das die DNA-Polymerase aus Thermus aquaticus codiert, homolog und ist dafür vorgesehen, eine SalG I-Stelle sowie Stopcodon in das amplifizierte Fragment einzubauen.

Die PCR wurde unter Verwendung eines DNA Thermal Cycler 480 (Perkin-Elmer-Cetus) durchgeführt. Das Reaktionsgemisch (50 mkl) enthielt 67 mM Tris-HCl (pH 8,8), 16,6 mM (NH4)2SO4, 0,01% v/v Tween-20, je 0,2 mM dNTP, 1,5 mM MgCl2, mit je 10 pmol Primer, 100 ng DNA als Matrize, und 5 U Taq-DNA-Polymerase. Die Reaktion umfaßte 25 Zyklen: 30 s bei 94°C; 30 s bei 58°C; 150 s bei 72°C.

Die amplifizierten Fragmente (aus den Tth- und Taq-Genen) wurden mittels 2% (w/v) Agarose-Gelelektrophorese und Phenolextraktion gereinigt und mit Ethanol gefällt. Danach wurden sie mit der Restriktionsendonuklease am BamH I verdaut und ligiert. Das aus den Tth- und Taq-DNA-Fragmenten bestehende chimäre DNA-Fragment wurde als Ergebnis der Manipulationen erhalten.

Das chimäre DNA-Fragment wurde mittels 1,5% (w/v) Agarose-Gelelektrophorese und Phenolextraktion gereinigt und danach mit Ethanol gefällt. Das Fragment wurde mit den Restriktionsendonukleasen Bgl II und SalG I verdaut und in das Plasmid pCQV2 [Queen, C., J. Mol. Appl. Genet., Bd. 2, S. 1–10], das mit den Restriktionsenzymen BamH I und SalG I verdaut und zuvor mit alkalischer Phosphatase aus Kälberdarm [Sambrook et al.] behandelt worden war, ligiert. Als Ergebnis wurde das die chimäre DNA-Polymerase codierende chimäre Gen in pCQV2 unter Kontrolle des PR-Promoters kloniert.

Die Ligation wurde mit T4-DNA-Ligase in einem Volumen von 50 mkl mit 200 ng Vektor (Plasmid pCQV2) und 200 ng der Insertions durchgeführt. E. coli JM 109-Zellen wurden nach dem Verfahren von Dower et al. [Dower et al., Nucl. Acid. Res., Bd. 16 (1988), S. 1127] mit dem Ligationsgemisch transformiert. Die transformierten Zellen wurden auf LB-Medium bei 30°C angezogen. Es wurden Clone aus Ampicillin-resistenten Kolonien ausgewählt und überprüft, um zu bestimmen, welche davon die Insertion mit dem Gen für die chimäre DNA-Polymerase enthielten.

Ausgewählte positive Clone wurden dann auf die Produktion des Proteins mit dem entsprechenden MW mittels 12% SDS-Polyacrylamid-Gelelektrophoresen [Laemmli U., Nature Bd. 227 (1970), S. 680–685] getestet. Die Zellen wurden bis zu einer optischen Dichte von A600=0,4 in 500 ml LB-Medium mit Ampicillin (75 mgk/ml) bei 30°C] angezogen. Durch Erwärmen auf 42°C wurde die Expression des clonierten Gens induziert. Die Zellen wurden bei 42°C noch weitere 4 h inkubiert. Danach wurden die Zellen durch Zentrifugation geerntet, und das Enzym wurde wie folgt teilweise gereinigt.

Alle Proben wurden bei 4°C isoliert. Zellen (0,5 g) wurden in 2 ml Puffer A (20 mM K-Phosphat pH 7,0, 2 mM DTT, 0,5 mM EDTA) mit 0,2 M NaCl und 0,1 mM Phenylmethylsulfonylfluorid (PMSF) suspendiert. Die Zellen wurden durch Ultraschallbehandlung (MSE, 150 wt) bei maximaler Amplitude 15 s (3 Impulse, jeweils 5 s) über Kühlen auf Eis aufgeschlossen. Die Suspension wurde bei 20.000 g zentrifugiert, der Überstand gesammelt und 5% (v/v) Polyethylenimin mit einer Endkonzentration von 0,1% (v/v) zugegeben. Der erhaltene Niederschlag wurde durch Zentrifugation getrennt und der Überstand abgetrennt. Danach wurden die Überstand-Proteine mit festem Ammoniumsulfat bei 75% Sättigung ausgefällt. Der polymerasehaltige Niederschlag wurde durch Zentrifugation bei 20.000 g gesammelt, in 3 ml Puffer A mit 0,1 M NaCl und 0,2% Tween-20 gelöst, danach 5 Minuten bei 75°C erwärmt und zentrifugiert (10 min, 20.000 g). Die denaturierten Proteine wurden verworfen und der Überstand auf seine Fähigkeit zur Durchführung der PCR getestet. Ein Plasmid wurde aus Zellen, in denen die verkürzte chimäre Polymerase in der PCR aktiv war, isoliert und gereinigt.

PCR-Tests wurden unter Verwendung eines DNA thermal cycler 480 (Perkin Elmer-Cetus) durchgeführt. Das Reaktionsgemisch (50 mkl) enthielt 67 mM Tris-HCl (pH 8,8 bei 25°C), 16,6 mM (NH4)2SO4, 0,01 % Tween-20, 0,2 mM je dNTP, 1,5 mM MgCl2, je 10 pmol Primer (Pr.lambda.1: 5'-GATGAGTTCGTGTCCGTACAACTGG-3' [SEQ ID No: 7] und Pr.lambda.2: 5'-GGTTATCGAAATCAGCCACAGCGCC-3' [SEQ ID No: 8], 50 ng lambda-Matrizen-DNA und 2 mkl des obigen, das Enzym enthaltenden Überstands. 30 Zyklen mit dem folgenden Kreislauf wurden durchgeführt; 30 Sekunden bei 94°C, 40 Sekunden bei 57°C und 30 Sekunden bei 72°C.

Die Plasmid-DNA wurde aus Zellen isoliert, die ein chimäres Enzym produzierten, das in der PCR aktiv war. Das Plasmid wurde gereinigt und mit pTTT bezeichnet. Die für das chimäre Enzym codierende Nukleotidsequenz wurde durch Sequenzieren bestätigt. Die Konstruktion von pTTT ist in 1 gezeigt.

BEISPIEL 2 Herstellung eines chimären temperaturstabilen Enzyms unter Verwendung eines Expressionsvektors (Plasmid pTTT)

E. coli JM 109-Zellen wurden mit dem Plasmid pTTT gemäß dem Verfahren von Dower et al. [1988, Nucl. Acid. Res., Bd. 16, S. 6127] transformiert. Die transformierten Zellen wurden bis zu einer optischen Dichte von A.600 = 0,4 in 7 L LB-Medium mit Ampicillin (75 mkg/ml) bei 30°C angezogen. Die Expression des für die chimäre Polymerase codierenden chimären Gens wurde durch Erwärmen auf 42°C induziert. Die Zellen wurden bei 42°C noch weitere 7 h inkubiert. Die Zellen wurden durch Zentrifugation geerntet.

Die Zellen (35 g) wurden in 70 ml Puffer A (20 mM K-Phosphat pH 7,0, 2 mM DTT, 0,5 mM EDTA) mit 0,2M NaCl und 0,1 mM PMSF suspendiert. Die Zellwände wurden mit einem Ultraschallgerät (MSE, 150 wt) bei maximaler Amplitude 15 Minuten (30 Impulse, jeweils 30 s) und unter Kühlen auf Eis aufgeschlossen. Die Suspension wurde dann bei 40.000 g zentrifugiert, das Pellet verworfen und 5% Polyethylenimin mit einer Endkonzentration von 0,1% zum Überstand gegeben. Der Niederschlag wurden durch Zentrifugation getrennt und die erhaltenen Proteine wurden mit Ammoniumsulfat bei 45% Sättigung ausgefällt. Der erhaltene polymerasehaltige Niederschlag wurde durch Zentrifugation bei 20.000 g gesammelt und in Puffer A (30 ml) mit 0,1 M NaCl und 0,2% Tween-20 gelöst, 15 Minuten bei 75°C in Gegenwart von 10 mM MgCl2 erwärmt und 10 Minuten bei 40.000 g zentrifugiert.

Der Überstand wurde auf eine in Puffer A mit 0,1 M NaCl equilibrierte Phosphocellulose P-11-Säule (2,5 × 20 cm, Whatman) geladen und mit dem gleichen Puffer ausgewaschen. Die Proteine wurden mit einem linearen Gradienten auf NaCl-Konzentrationen im Bereich von 100 bis 500 mM in Puffer A eluiert. Das Gradientenvolumen betrug 800 ml und die Fließgeschwindigkeit 60 ml/h. Die Polymerase wurde bei NaCl-Konzentrationen im Bereich von 280 bis 330 mM eluiert.

Die Fraktionen wurden auf Polymeraseaktivität getestet, wobei ein Assay über den Einschluß des radioaktivmarkierten Nukleotids 32P(dATP) in das säureunlösliche Pellet durchgeführt wurde [Myers T. W., Gelfand D. H., (1991) Biochemistry, Bd. 30, N31, S. 7661–7666].

Insbesondere wurde diejenige Menge des Enzyms, die 10 nmol Desoxynukleotidtriphosphate in die säureunlösliche Fraktion innerhalb von 30 Minuten unter den unten beschriebenen Bedingungen einbaute, als eine Einheit Aktivität verwendet. Das Reaktionsgemisch (50 mkl) enthielt 25 mM N-Tris-[Hydroxymethyl]methyl-3-aminopropansulfonsäure (TAPS), pH 9,3, 50 mM KCl, 2 mM MgCl2; 1 mM &bgr;-Mercaptoethanol; je 0,2 mM dNTP, 1 mkCi 32P (dATP) und 12,5 mkg aktivierte Lachssperma-DNA. Die Polymeraseaktivität wurde bei 73°C bestimmt (Lachssperma-DNA (12,5 mg/ml) wurde in 10 mM Tris-HCl (pH 7,2) mit 5 mM MgCl2 mit pankreatischer DNase I (0,03 U/ml) bei 4°C 1 h aktiviert und danach bei 95°C 5 Minuten erhitzt).

Die Polymeraseaktivität enthaltende Fraktionen wurden vereinigt, gegen Puffer A mit 50 mM NaCl dialysiert und auf eine mit dem gleichen Puffer equilibrierte Säule (0,6 × 6 cm) aus DEAE-Zellulose (Whatman) geladen. Die Proteine wurden mit einem linearen Gradienten aus NaCl-Konzentrationen im Bereich von 50 bis 250 mM in Puffer A eluiert. Das Gradientenvolumen betrug 150 ml und die Fließgeschwindigkeit 15 ml/h. Die Polymerase wurde bei 150–200 mM NaCl eluiert. Die Polymeraseaktivität wurde wie oben beschrieben getestet. Die Ausbeute der Polymeraseaktivität betrug 1,475,000 Einheiten.

Die gereinigten Enzyme wurden bei –20°C im folgenden Puffer gelagert: 100 mM NaCl; 10 mM Tris HCl pH 7,5; 1 mM DTT; 0,2% Tween-20 und 50% (v/v) Glyzerin.

Die Homogenität der Polymerasepreparationen betrug nicht weniger als 95% gemäß SDS-Elektrophoresedaten auf einem 10%-Polyacrylamidgel.

BEISPIEL 3 Effizienz der PCR-Amplifikation

Die Effizienz der PCR-Amplifikation durch das chimäre temperaturstabile Enzym sowie die Taq- und die Tth-Polymerasen wurde über die Amplifikation eines 2500-bp DNA-Fragments abgeschätzt.

PCR-Reaktionen wurden unter Verwendung eines DNA thermal cycler 480 (Perkin Elmer-Cetus) durchgeführt. Das Reaktionsgemisch (50 mkl) enthielt 67 mM Tris-HCl (pH 8,8 bei 25°C), 16,6 mM (NH4)2SO4, 0,01% Tween-20, je 0,2 mM dNTP, 1,5 mM MgCl2, je 10 pmol Primer (Pr.lambda.1: 5'-GATGAGTTCGTGTCCGTACAACTGG-3' [SEQ ID No: 7] und Pr.lambda.3: 5'-TGTTGACCTTGCCTGCAGCAACGC-3' [SEQ ID No: 9], 5 ng Lambda-Matrizen-DNA. Die Reaktionen wurden mit 0,5 U Tth-Polymerase bzw. 0,5 U der chimären Polymerase bzw. 0,5 U, 1,5 U, 2,5 U Taq-Polymerase durchgeführt. Es wurden 26 Zyklen des folgenden Kreislaufs durchgeführt: 30 Sekunden bei 94°C, 40 Sekunden bei 57°C und 100 Sekunden bei 72°C.

Die Ergebnisse sind in 2 gezeigt und zeigen, daß 0,5 U des erfindungsgemäßen chimären Enzyms eine ähnliche PCR-Amplifikationseffizienz aufweisen wie 0,5 U Tth-Polymerase und 2,5 U Taq-Polymerase. Somit weist das chimäre Enzym eine wenigstens 5mal höhere Effizienz in der PCR auf als Taq-Polymerase.

BEISPIEL 4 Empfindlichkeit gegenüber der Anwesenheit eines fehlgepaarten Nukleotids am 3'-Primerende

Die Enzymempfindlichkeit des chimären temperaturstabilen Enzyms sowie der Taq- und Tth-DNA-Polymerasen gegenüber der Anwesenheit einer Fehlpaarung am 3'-Ende eines Primers wurde abgeschätzt, indem die DNA-Mengen, die in der PCR mit den Primern, die entweder das 3'-fehlpaarende Nukleotid enthielten oder nicht enthielten, synthetisiert wurden, miteinander verglichen wurden. Die PCR-Amplifikation des 500-bp großen DNA-Fragments des Phagen lambda wurde mit den Primerpaaren:

Pr.lambda.1 [SEQ ID No: 7]/Pr.lambda.2 [SEQ ID No: 8]; Pr.lambda.12 (5'-GATGAGTTCGTGTCCGTACAACTGC) [SEQ ID No: 10]/Pr.lambda.2 [SEQ ID No: 8]; Pr.lambda.l3 (5'-GATGAGTTCGTGTCCGTACAACTGA) [SEQ ID No: 11]/Pr.lambda.2 [SEQ ID No: 8]; Pr.lambda.14 (5'– GATGAGTTCGTGTCCGTACAACTGT) [SEQ ID No: 12]/ Pr.lambda.2 [SEQ ID No: 8] durchgeführt. Die Primer Pr.lambda.1 und Pr.lambda.2 waren zu dem entsprechenden Fragment der DNA des Phagen lambda komplementär; die Primer Pr.lambda12, Pr.lambda13 und Pr.lambda14 waren mit Pr.lambda1 identisch, mit Ausnahme des 3'-terminalen Nukleotids. Das Reaktionsgemisch (50 &mgr;l) enthielt, 67 mM Tris-HCl (pH 8,8), 16,6 mM (NH4)2SO4, 0,01% Tween-20, je 0,2 mM dNTP, 1,5 mM MgCl2, je 17 pmol Primer, 15 ng DNA des Phagen lambda als Matrize sowie 1,5 U der chimären bzw. Taq- bzw. Tth-DNA-Polymerase. Die Reaktion lief in 25 Zyklen ab: 45 s bei 94°C; 30 s bei 59°C; 30 s bei 72°C.

Zur Abschätzung der Menge an synthetisierter DNA wurde das Reaktionsgemisch mit [alpha-32P]dATP (2&mgr;Ci/50 &mgr;l Reaktionsgemisch) versetzt und danach die Radioaktivität der säureunlöslichen Fraktion bestimmt. Zu diesem Zweck wurde die Reaktion durchgeführt, und 20 &mgr;l des erhaltenen Gemischs wurden auf ein GF/B-Filter (Whatman) aufgetragen. Das Filter wurde mit 10% Trichloressigsäure gewaschen und getrocknet. Die Radioaktivität wurde mit einem Szintillationszähler LS-9800 von Beckman unter Verwendung von Ready-Soly HP-Szintillationsflüssigkeit (Beckman) bestimmt.

Die Ergebnisse sind in Tabelle 1 dargestellt und zeigen, daß die Anwesenheit des fehlpaarenden Nukleotids am 3'-Ende des verlängerten DNA-Strangs die PCR-Amplifikationseffizienz sowohl von der Taq-DNA-Polymerase als auch dem chimären temperaturstabilen Enzym gleichermaßen reduzierte. Somit ist das chimäre Enzym nicht weniger empfindlich gegenüber der Anwesenheit einer Fehlpaarung als Taq-DNA-Polymerase und wenigstens 6mal empfindlicher als Tth-DNA-Polymerase (Tabelle 1).

BEISPIEL 5 Spezifität der DNA-Amplifikation i.n der PCR

Bei der Spezifität einer PCR-DNA-Amplifikation handelt es sich um ein Verhältnis des Zielprodukts der Amplifikation zu der insgesamt synthetisierten DNA. Die Enzymspezifität des chimären temperaturstabilen Enzyms sowie der Taq- und Tth-DNA-Polymerasen wurde abgeschätzt, indem ein 2500 bp großes DNA-Fragment des Phagen lambda in Gegenwart einer beträchtlichen Menge an E. coli-DNA amplifiziert wurde.

Die PCR-Reaktionen wurden unter Verwendung eines DNA thermal cycler 480 (Perkin Elmer-Cetus) durchgeführt. Das Reaktionsgemisch (50 mkl) enthielt 67 mM Tris-HCL (pH 8,8 bei 25°C), 16,6 mM (NH4)2SO4, 0,01% Tween-20, je 0,2 mM dNTP, 1,5 mM MgCl2, je 20 pmol Primer (Pr.lambda.1 [SEQ ID No: 7] und Pr.lambda.3 [SEQ ID No: 9], 5 ng Lambda-Matrizen-DNA sowie 300 ng E. coli DNA. Die Reaktionen wurden mit jeweils 3,5 U chimärem temperaturstabilem Enzym bzw. Tth- bwz. Taq-DNA-Polymerase durchgeführt. Dabei wurden 30 Zyklen des folgenden Kreislaufs ausgeführt: 30 Sekunden bei 94°C, 40 Sekunden bei 57°C und 100 Sekunden bei 72°C.

Die Ergebnisse sind in 3 dargestellt und zeigen, daß das chimäre Enzym eine wesentlich höhere Spezifität bei der DNA-Amplifikation auf PCR-Basis als Tth-DNA-Polymerase und nicht weniger Spezifität als Taq-DNA-Polymerase zeigt.

TABELLE 1

Einbau von radioaktiver Markierung in das 500 bp große DNA-Fragment, das mit Taq, Tth oder dem chimären temperaturstabilen Enzym mittels PCR mit Primern, die ggf. 3'-fehlpaarende Nukleotide enthielten, synthetisiert wurde (ausführlich in Beispiel 4 beschrieben).

Tabelle 1
LITERATURANGABEN Patentdokumente
  • US 6,228,628; Mutant chimeric DNA polymerase, Gelfand D.H., Reichert F.L.
  • GB 2,399,591; Thermostable DNA polymerase, Kramarov V.M., Ignatov K.B., Hallinan J.P.
  • US 4,965,188; Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme, Mullis K.B., Erlich H.A., Gelfand D.H., Horn G., Saiki R.K.
  • US 5,618,711; Recombinant expression vectors and purification methods for Thermus thermaphilus DNA polymerase, Gelfand D.H., Lawyer F.C., Stoffel S.
  • US 5,079,352; Purified thermostable enzyme, Gelfand D.H., Stoffel S., Lawyer F.C., Saiki R.K.
zitierte Literatur
  • Ohler L.D., and Rose E.A. (1992) optimization of long-distance PCR using a transposon-based model system. PCR Methods Appl. 2: 51–59.
  • Ignatov K.B., Kramarov V.M., Chostyakova L.G. und Miroshnikov A.I. (1997). Factors determining different processivity of Tth and Taq DNA polymerases in amplification of phage &lgr; DNA. Mol. Biol. (Russ.) 31: 956–961.
  • Ignatov K.B., Kramarov V.M., Uznadze O.L. und Miroshnikov A.I. (1997) Tth DNA polymerase – mediated amplifacation of DNA fragments using primers with mismatches in the 3'-region. Bioorg. Khim. (Russ.) 23: 817–822.
  • Villbrandt B., Sobek H., Frey B. und Schomburg D. (2000) Domain exchange: chimeras of Thermus aquaticus DNA polymerase, Escherichia coli DNA polymerase I and Thermotoga neapolitana DNA polymerase. Protein Eng. 13: 645–654.
  • Barnes W.M. (1992) The fidelity of Taq polymerase catalyzing PCR is improved by an N-terminal deletion. Gene 112: 29–35.
  • Blanco L., Bernad A., Blasco M.A., und Salas M. (1991) A general structure for DNA- dependent DNA polymerases. Gene 100: 27–28.
  • Goodchild J., (19901 Conjugates of oligonucleotides and modified oligonucleotides: a review of their synthesis and properties. Bioconjugate Chemistry 1: 165–187.
  • Sambrook et al, (1989) "Molecular cloning – A Laboratory Manual", Cold Spring Harbor Laboratory Press.
  • Lawyer F.C., Stoffel S., Saiki R.K., Myambo K., Drummond R., und Gelfand D.H. (1989) Isolation, characterization and expression in E.coli of the DNA polymerase gene from Thermus aquaticus. J. Biol. Chem. 264: 6427–6437.
  • Queen C. (1983) A vector that uses phage signals for efficient synthesis of proteins in E.coli. J. Mol. Appl. Genet. 2: 1–10.
  • Dower W.J., Miller J.F. und Ragsdale C.W. (1988) High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16: 6127–6145.
  • Laemmli U.K. (1970) Cleavage of structural proteins assembly of the head of bacteriophage T4. Nature, 227: 680–685.


Es folgt ein Sequenzprotokoll nach WIPO St. 25.

Dieses kann von der amtlichen Veröffentlichungsplattform des DPMA heruntergeladen werden.


Anspruch[de]
  1. Chimäres temperaturstabiles Enzym mit einem N-terminalen Bereich, einem C-terminalen Bereich und einer DNA-Polymerasedomäne, wobei der N-terminale Bereich einen N-terminalen Bereich aus einer DNA-Polymerase I von Thermus thermophilus (Tth), der C-terminale Bereich einen C-terminalen Bereich aus einer DNA-Polymerase I von Thermus aquaticus (Taq) und die DNA-Polymerasedomäne einen Anteil einer DNA-Polymerasedomäne des N-terminalen Bereichs der Tth-DNA-Polymerase I in operativer Verknüpfung mit einem Anteil einer DNA-Polymerasedomäne des C-terminalen Bereichs der Taq-DNA-Polymerase I umfaßt.
  2. Chimäres temperaturstabiles Enzym nach Anspruch 1, wobei der N-terminale Bereich aus der Tth-DNA-Polymerase I weiterhin eine 5' Nukleasedomäne umfaßt.
  3. Chimäres temperaturstabiles Enzym nach einem der vorhergehenden Ansprüche, wobei der N-terminale Bereich des chimären Enzyms eine durchgehende Aminosäuresequenz zwischen Positionen 1 bis 280 bis n der Tth-DNA-Polymerase I (SEQ ID No: 13) umfaßt, wobei n zwischen den Aminosäuren 555 bis 601 der Tth-DNA-Polymerase I liegt und einer Aminosäure in Position m der Taq-DNA-Polymerase I (SEQ ID No: 14) entspricht, wobei m gleich n-2 ist.
  4. Chimäres temperaturstabiles Enzym nach Anspruch 3, wobei der C-terminale Bereich des chimären Enzyms eine durchgehende Aminosäuresequenz von Position m+1 bis 832 der Taq-DNA-Polymerase I (SEQ ID No: 14) umfaßt.
  5. Chimäres temperaturstabiles Enzym nach einem der vorhergehenden Ansprüche, wobei die Aminosäuresequenz des N-terminalen Bereichs des chimären Enzyms eine Aminosäuresequenz von Positionen 4 bis 600 der Tth-DNA-Polymerase I (SEQ ID No: 13) umfaßt.
  6. Chimäres temperaturstabiles Enzym nach einem der vorhergehenden Ansprüche, umfassend eine Aminosäuresubstitution mit Asp für Glu in Aminosäureposition 2 des N-terminalen Bereichs aus der Tth-DNA-Polymerase I.
  7. Chimäres temperaturstabiles Enzym nach einem der vorhergehenden Ansprüche, umfassend eine Aminosäuresubstitution mit Leu für Ala in Aminosäureposition 3 des N-terminalen Bereichs aus der Tth-DNA-Polymerase I.
  8. Chimäres temperaturstabiles Enzym nach einem der vorhergehenden Ansprüche, umfassend die Aminosäuresequenz der SEQ ID No: 1, oder ein Fragment oder eine Variante davon, wobei das Fragment bzw. die Variante DNA-Polymerase-I-Aktivität zeigen.
  9. Chimäres temperaturstabiles Enzym nach Anspruch 8, wobei die Variante wenigstens 92% Sequenzidentität mit SEQ ID No: 1 aufweist.
  10. Chimäres temperaturstabiles Enzym nach Anspruch 8, wobei das Fragment die Reste 280 bis 828 der SEQ ID No: 1 oder eine Variante davon, wenn diese der SEQ ID No: 1 vergleichend gegenübergestellt wird, umfaßt.
  11. Nukleinsäure, codierend für das chimäre temperaturstabile Enzym nach einem der vorhergehenden Ansprüche.
  12. Nukleinsäure nach Anspruch 11, umfassend die Nukleotidsequenz der SEQ ID No: 2.
  13. Rekombinanter DNA-Vektor, der die Nukleinsäure nach Anspruch 11 oder 12 umfaßt.
  14. Wirtszelle, umfassend den Vektor nach Anspruch 13.
  15. Verfahren zur Herstellung eines chimären temperaturstabilen Enzyms nach einem der Ansprüche 1 bis 10, wobei man die Wirtszelle nach Anspruch 14 unter Bedingungen zur Expression des chimären temperaturstabilen Enzyms kultiviert und das Enzym aus der Wirtszelle gewinnt.
  16. Kit, umfassend das chimäre temperaturstabile Enzym nach einem der Ansprüche 1 bis 10, Reaktionspuffer sowie dNTPs.
  17. Verfahren zur DNA-Amplifikation unter Verwendung der Polymerasekettenreaktion, bei dem man:

    a) ein den Kit aus Anspruch 16, Primer und doppelsträngige Matrizen-DNA umfassendes Reaktionsgemisch bereitstellt;

    b) das Reaktionsgemisch zur Trennung der Matrizen-DNA erwärmt;

    c) das Reaktionsgemisch abkühlt, um die Bindung der Primer an die Matrizen-DNA zu gestatten;

    d) das Reaktionsgemisch zur Auslösung des durch das chimäre temperaturstabile Enzym katalysierten Annealing der dNTPs erwärmt;

    e) die Schritte b) bis d) zur Herstellung mehrerer Kopien der Matrizen-DNA wiederholt.
Es folgen 3 Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com