PatentDe  


Dokumentenidentifikation DE69635751T2 26.10.2006
EP-Veröffentlichungsnummer 0000815197
Titel "LONG QT" GENE UND METHODE ZUR DIAGNOSE ODER PRÄVENTION DES "LONG QT" SYNDROMS
Anmelder University of Utah Research Foundation, Salt Lake City, Utah, US
Erfinder KEATING, Mark T., Salt Lake City, UT 84103, US;
SANGUINETTI, Michael C., Park City, UT 84060, US;
CURRAN, Mark E., Salt Lake City, UT 84102, US;
WANG, Quing, Salt Lake City, UT 84108, US
Vertreter Dörries Frank-Molnia & Pohlman, 80538 München
DE-Aktenzeichen 69635751
Vertragsstaaten AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 08.03.1996
EP-Aktenzeichen 969112689
WO-Anmeldetag 08.03.1996
PCT-Aktenzeichen PCT/US96/03186
WO-Veröffentlichungsnummer 1996028537
WO-Veröffentlichungsdatum 19.09.1996
EP-Offenlegungsdatum 07.01.1998
EP date of grant 18.01.2006
Veröffentlichungstag im Patentblatt 26.10.2006
IPC-Hauptklasse C12C 3/00(2006.01)A, F, I, 20060131, B, H, EP
IPC-Nebenklasse A23D 7/00(2006.01)A, L, I, 20060131, B, H, EP   C12Q 1/68(2006.01)A, L, I, 20060131, B, H, EP   C12P 19/34(2006.01)A, L, I, 20060131, B, H, EP   G01N 33/00(2006.01)A, L, I, 20060131, B, H, EP   C07K 1/00(2006.01)A, L, I, 20060131, B, H, EP   C07K 16/00(2006.01)A, L, I, 20060131, B, H, EP   C07H 21/04(2006.01)A, L, I, 20060131, B, H, EP   

Beschreibung[de]

Die vorliegende Erfindung richtet sich auf ein Verfahren zur Diagnose und zur Verhinderung des verlängerten QT Syndroms („Long QT Syndrome"; LQT). LQT steht in einer Beziehung zu spezifischen Genen, zu denen HERG und SCN5A zählen. LQT kann infolge spezifischer Mutationen in den genannten Genen erblich sein oder aber erworben werden, z.B. als Folge einer Behandlung mit Medikamenten, die zur Behandlung von Herzarrhythmien verabfolgt werden, oder einer Behandlung mit anderen Arten von Medikamenten, wie z.B. Antihistaminika oder Antibiotika, wie z.B. Erythromycin. Die erworbene Form von LQT ist die vorherrschende Form der Krankheit. Diese Erfindung zeigt, dass das HERG Gen für einen K+-Kanal kodiert, der in die erworbene Form von LQT involviert ist. Es wird gezeigt, dass eine Erhöhung des K+-Spiegels in Patienten, welche Medikamente zur Verhinderung von Herzrhythmusstörungen einnehmen, das Risiko der Entwicklung der erworbenen Form von LQT vermindert und daher als vorbeugende Maßnahme dienen kann. Diese Erkenntnis kann jetzt auch verwendet werden, um Medikamente zu entwickeln, die diesen K+-Kanal aktivieren können und in Verbindung mit den Medikamenten verabreicht werden könnten, die gegenwärtig zur Behandlung von Herzarrhythmien verwendet werden. Die Aktivierung des K+-Kanals könnte das Risiko einer Entwicklung von LQT und Torsades de pointes herabsetzen.

Die Veröffentlichungen und anderen Materialien, die hierin verwendet werden, um den Stand der Technik für diese Erfindung zu illustrieren oder zusätzliche Einzelheiten bezüglich deren Ausführung zu offenbaren, sind der Einfachheit halber in der beigefügten Liste der Referenzen aufgeführt.

Obwohl man annimmt, dass auf den plötzlichen Tod infolge von Herzarrhythmien 11 % aller natürlichen Todesfälle entfallen, sind die Mechanismen, die Herzarrhythmien zugrunde liegen, wenig bekannt (Kannel, 1987; Willich et al., 1987). Eine der Formen des Long QT Syndroms (LQT) ist eine ererbte Herzarrhythmie, die plötzliche Bewusstlosigkeit, Synkopen, Schlaganfälle und plötzlichen Tod durch ventrikuläre Tachyarrhythmien, insbesondere Torsades de pointes und Kammerflimmern (ventricular fibrillation), verursacht (Ward, 1964; Romano, 1965; Schwartz et al., 1975; Moses et al., 1991). Diese Krankheit tritt gewöhnlich bei jungen, anderweitig gesunden Individuen auf (Ward, 1964; Romano, 1965; Schwartz, 1975). Die meisten Träger von LQT Genen zeigen im Elektrokardiogramm verlängerte QT Intervalle, ein Zeichen für anomale Herzrepolarisation (cardiac repolysation) (Vincent et al., 1992). Die klinischen Symptome von LQT rühren von episodischen Herzarrhythmien her, insbesondere von Torsades de pointes, benannt nach der charakteristischen Wellenform des Elektrokardiogramms bei dieser Arrhythmie. Torsades de pointes kann sich zu Kammerflimmern entwickeln, einer besonders tödlichen Form der Arrhythmie. Wenn auch LQT keine übliche Diagnose ist, so ist doch Kammerflimmern sehr verbreitet, mehr als 300.000 U.S. Bürger erleiden davon jedes Jahr einen plötzlichen Herztod (Kannel et al., 1987; Willich et al., 1987), und in vielen Fällen können anomale Herzrepolarisationen die zugrunde liegende Ursache sein. LQT stellt daher eine hervorragende Möglichkeit zum Studium der lebensbedrohenden Herzarrhythmien auf der molekularen Ebene dar. Eine häufiger vorkommende Form dieser Krankheit wird „erworbenes LQT" genannt und kann durch viele verschiedene Faktoren, insbesondere durch eine Behandlung mit bestimmten Medikamenten und reduziertem K+-Spiegel im Serum (Hypokaliämie), ausgelöst werden.

Es sind bereits autosomal dominante und autosomal rezessive Formen der erblichen Form dieser Krankheit beschrieben worden. Autosomal rezessives LQT (auch als Jervell-Lange-Nielson Syndrom bekannt) ist mit angeborener neuraler Taubheit in Verbindung gebracht worden; diese Form von LQT kommt selten vor (Jervell und Lange-Nielson, 1957). Autosomal dominantes LQT (Romano-Ward Syndrom) kommt häufiger vor und geht nicht mit anderen phänotypischen Anomalien einher. Eine Krankheit, die ererbtem LQT sehr ähnlich ist, kann auch als das Ergebnis einer pharmakologischen Therapie erworben werden (Schwartz et al. 1975; Zipes, 1987).

1991 wurde die vollständige Verbindung von autosomal-dominantem LQT und einem Polymorphismus des HRAS Gens beschrieben (Keating et al, 1991a; Keating et al., 1991b). Diese Entdeckug lokalisierte LQT1 auf dem Chromosom 11p15.5 und machte eine präsymptomatische Diagnose in einigen Familien möglich. Es wurde früher vermutet, dass autosomaldominantes LQT genetisch homogen ist, und die ersten sieben Familien, an denen die Krankheit studiert wurde, standen in Zusammenhang mit 11p15.5 (Keating et al, 1991b). 1993 wurde gefunden, dass es eine lokale Heterogenität für LQT gibt (Benhorin et al., 1993; Curran et al., 1993b; Towbin et al., 1994). Zwei weitere LQT Loci wurden danach entdeckt, LQT2 auf dem Chromosom 7q35-36 (neun Familien) und LQT3 auf dem Chromosom 3p21-24 (drei Familien) (Jiang et al., 1994). Mehrere Familien konnten nicht mit den bekannten Loci in Verbindung gebracht werden, was eine zusätzliche lokale Heterogenität von LQT anzeigt. Das Ausmaß der Heterogenität lässt vermuten, dass unterschiedliche LQT Gene für unterschiedliche Proteine kodieren können, welche interagieren, um die Herzrepolarisation und das Arrhythmierisiko zu modulieren.

Wenn auch wenig über die Physiologie von LQT bekannt ist, so wird die Krankheit doch mit den verlängerten QT Intervallen in den Elektrokardiogrammen in Verbindung gebracht, einem Anzeichen von anomaler Herzrepolarisation. Diese Verbindung legt nahe, dass Gene, die für Ionenkanäle kodieren, oder ihre Modulatoren, als sinnvolle Kandidaten für LQT angesehen werden können. HRAS, das auf dem Chromosom 11p15.5 lokalisiert ist, wurde als Kandidat für LQT1 aufgrund einer direkten DNS-Sequenzanalyse (nicht publizierte Beobachtungen) sowie durch Linkage-Analysen (Roy et al., 1994) ausgeschlossen. Ein für einen neuroendokrinen Calciumkanal kodierendes Gen (CACNL1A2; Chin et al., 1991; Seino et al., 1992) sowie ein für ein GPT Bindungsprotein kodierendes Gen, welches Calciumkanäle moduliert (GNAI2; Weinstein et al., 1988; Magovcevic et al, 1992) wurden wegen ihrer chromosomalen Loci zu Kandidaten für LQT3. Nachfolgende Linkage-Analysen haben diese Gene jedoch ausgeschlossen (Wang und Keating, nicht veröffentlichte Daten). Ein Gen für einen Skelettmuskelchloridkanal (CLCN1; Koch et al, 1992) sowie ein Gen für einen Muskarin-Acetylcholin-Rezeptor des Herzens (CHRM2; Bonner et al. 1987) wurden wegen ihrer Lokalisation auf dem Chromosom 7q35-36 zu Kandidaten für LQT2, aber spätere Linkage-Analysen haben auch diese Gene ausgeschlossen (Wang et al., 1995).

Theoretisch könnten Mutationen eines Gens, das für Natriumkanäle des Herzens kodiert, LQT verursachen. Spannungsgesteuerte Natriumkanäle (voltage-gated sodium channels) vermitteln eine schnelle Depolarisation in ventrikulären Myocardfasern (myocytes) und leiten auch einen geringen Strom während der Plateauphase des Aktionspotentials (Attwell et al., 1979). Geringe Anomalien in der Funktion von Natriumkanälen (z.B. eine verzögern Inaktivierung des Natriumkanals oder eine veränderte Spannungsabhängigkeit der Kanalinaktivierung) könnten die Herzrepolarisation verzögern, was zu einem verlängerten QT-Intervall und zu Arrhythmien führt. In 1992 haben Gellens und Kollegen ein Gen für einen Natriumkanal des Herzens, SCN5A, kloniert und charakterisiert (Gellens et al., 1992). Die Struktur dieses Gens war ähnlich wie die anderer für Natriumkanäle kodierender Gene, und das Gen kodierte für ein großes, 2016 Aminosäuren enthaltendes Protein. Diese Kanalproteine enthalten vier homologe Domänen (DI bis DIV), von denen jede sechs als Membran spannend vermutete Segmente aufweist (S1 bis S6). SCN5A wurde kürzlich auf dem Chromosom 3p21 kartiert, wodurch es zu einem exzellenten Kandidaten für LQT3 wird (George et al., 1995).

In 1994 identifizierten Warmke und Ganetzky eine neue humane cDNS eines mit humanem Ether-a-go-go verwandten Gens (HERG, Warmke und Ganetzky, 1994). HERG wurde durch PCR Analyse eines somatischen Zellhybrid-Panels auf dem humanen Chromosom 7 lokalisiert (Warmke und Ganetzky, 1994). Die Funktion des von HERG kodierten Proteins war nicht bekannt, aber es hat eine vorhergesagte Homologie der Aminosäuresequenz mit Kaliumkanälen. HERG wurde aus einer aus dem Hippocampus stammenden cDNS Bibliothek durch Homologie mit einem Ether-a-go-go-Gen (eag) von Drosophila, das für einen Calcium-modulierten Kaliumkanal kodiert, isoliert (Bruggemann et al., 1993). HERG ist jedoch nicht das humane Homologe von eag, es hat nur etwa 50% Homologie der Aminosäuresequenz. Die Funktion von HERG war nicht bekannt, es wurde jedoch im Herz stark exprimiert, und es wurde angenommen, dass es eine wichtige Rolle bei der Repolarisation der Aktionspotentiale des Herzens spielt (Curran et al., 1995).

Hierin werden Beweise dafür geliefert, dass SCN5A gleich LQT3 und HERG gleich LQT2 ist. Drei Familien mit Mutationen in SCN5A wurden identifiziert und charakterisiert, und es konnte gezeigt werden, dass in allen drei Familien eine vollständige Beziehung zwischen LQT3 und SCN5A besteht. Was das HERG Gen betrifft, so wurden neue LQT Familien identifiziert und charakterisiert, und es konnte gezeigt werden, dass bei allen eine Beziehung zu Markern auf dem Chromosom 7q35-36 besteht, was die Lage von LQT2 bestätigt. Zweitens wurde HERG auf dem Chromosom 7q35-36 kartiert, was HERG zu einem Kandidaten für LQT2 macht. Drittens wurde gezeigt, dass HERG im Herzen stark exprimiert wird. Schließlich wurden sechs HERG Mutationen identifiziert, welche LQT verursachen; eine dieser Mutationen war neu (de novo).

Erworbenes LQT rührt üblicherweise von einer Therapie mit Medikamenten her, die K+-Kanäle des Herzens blockieren (Roden, 1988). Die Medikamente, die am häufigsten mit LQT in Verbindung gebracht werden, sind Antiarrhythmika (wie z.B. Quinidine, Solatol), die als Teil des Spektrums ihrer pharmakologischen Aktivität den schnell aktivierenden verzögerten K+-Rektifier-Strom (rapidly-activating delayed rectifier K+ current) des Herzens, IKr, blockieren. Auch andere Medikamente können erworbenes LQT verursachen. Dazu zählen Antihistaminika und einige Antibiotika, wie z.B. Erythromycin. IKr ist in isolierten Herzmuskelfasern charakterisiert worden (Balser et al., 1990; Follmer et al, 1992; Sanguinetti und Jurkiewicz, 1990; Shibasaki, 1987; Yang et al., 1994), und es ist bekannt, dass IKr eine wichtige Rolle für den Beginn der Repolarisation von Aktionspotentialen spielt. Trotz umfangreicher Bemühungen ist das Gen, das für diesen Kanal kodiert, bisher nicht identifiziert worden.

Um die physiologische Rolle von HERG zu definieren, wurde die cDNS in voller Länge kloniert, und der Kanal wurde in Oocyten von Xenopus exprimiert. Voltage-clamp-Analysen der resultierenden Ströme ergaben, dass HERG für einen K+-Kanal kodiert, dessen biophysikalische Charakteristika nahezu identisch mit IKr sind. Diese Daten lassen vermuten, dass HERG für die bedeutendste Untereinheit des IKr-Kanals kodiert und zeigen einen mechanistischen Zusammenhang zwischen einigen Formen von erblichem und durch Medikamente induziertem LQT.

Es sollte hier erwähnt werden, dass Takahashi et al. im Journal of Cardiology 23:99-106, 1993, klinische Charakteristika und Befunde von Patienten beschreiben, die an einem erworbenen oder ererbten verlängertem QT Syndrom litten und parallel dazu durch Medikamente verursachte Torsades de Pointes entwickelten. Sie beschreiben auch die Verwendung von Kalium als therapeutische Ergänzung für die Behandlung von Torsades de Pointes.

Die vorliegende Erfindung zeigt die molekulare Basis des verlängerten QT Syndroms. Genauer gesagt hat die vorliegende Erfindung gezeigt, dass molekulare Varianten sowohl des SCN5A als auch des HERG Gens die Pathogenese von LQT auslösen oder dabei eine Rolle spielen. Weiterhin hat die Erfindung klargestellt, dass die erworbene Form von LQT mit dem K+-Kanal zusammenhängt, für den HERG kodiert. Genotypische Analysen zeigen, dass SCN5A in drei nicht verwandten Familien vollständig mit LQT3 verbunden ist. In betroffenen Mitgliedern von zwei dieser Familien wurde die selbe Deletion innerhalb des Gens festgestellt. Diese Deletion unterbrach Sequenzen innerhalb einer Region, von der bekannt ist, dass sie wichtig für die Inaktivierung von Natriumkanälen ist, was einen zellulären Mechanismus für mit dem Chromosom 3 verbundenen LQT nahe legt. Genotypische Analysen zeigen, dass HERG auch mit LQT2 in sechs Familien verbunden ist. Zu den in diesen Familien gefundenen Mutationen zählen zwei Deletionen innerhalb des Gens, eine Spleißdonor Mutation und drei Missense-Mutationen. Analysen der SCN5A und HERG Gene erlauben eine frühe Identifizierung von Individuen mit ererbtem LQT. Bei der diagnostischen Methode analysiert man die DNS-Sequenz des SNC5A und/oder HERG Gens des zu untersuchenden Individuums und vergleicht sie mit der DNS-Sequenz des ursprünglichen, nicht variierten Gens. Bei einer zweiten Ausführungsform wird bzw. werden das SNC5A und/oder HERG Gen des zu untersuchenden Individuums auf Mutationen hin durchsucht, die LQT auslösen. Die Möglichkeit, LQT vorherzusagen, versetzt den Arzt in die Lage, den Ausbruch der Krankheit mit Medikamenten, wie z.B. Betablockern, zu verhindern. Bei Individuen mit familiärem LQT oder Individuen, die mit Medikamenten gegen Herzanhythmie oder anderen Medikamenten behandelt werden, welche erworbenen LQT auslösen können, wird der K+-Spiegel überwacht, und K+ wird verabreicht, wenn dies nötig ist, um den K+-Spiegel ein wenig über das normale Maß hinaus anzuheben.

Die beigefügten Zeichnungen können wie folgt kurz beschrieben werden:

1A, 1B und 1C. Genetische Verbindung von SCN5A und LQT3. Stammbaumstruktur und genotypische Analysen von LQT Sippen 2322 (1A), 2171 (1B) und 2321 (1C). Individuen mit den charakteristischen Merkmalen von LQT, einschließlich von verlängerten QT-Intervallen im Elektrokardiogramm und einer Vorgeschichte von Synkopen oder drohendem plötzlichem Herztod sind durch ausgefüllte Kreise (Frauen) oder Quadrate (Männer) gekennzeichnet. Nicht betroffene Individuen sind durch leere Symbole gekennzeichnet, und Individuen mit einem nicht eindeutigen Phänotypus sind gepunktet dargestellt. Verstorbene Individuen sind durch einen Querstrich gekennzeichnet. Die Ergebnisse der genotypischen Analysen sind unterhalb eines jeden Symbols angegeben. Genotype für die folgenden, mit LQT3 verbundenen polymorphen Marker werden gezeigt (Telomere zu Zentromeren): D3S1298, SCN5A 7-8, SCN5A 3-4 und D3S1100. Mit der Krankheit kosegregierende Haplotypen sind durch einen Kasten (box) gekennzeichnet. Rekombinationen sind durch eine horizontale schwarze Linie gekennzeichnet. Haplotyp-Analysen zeigen, dass LQT3 und SCN5A in allen durch Chromosom 3 verbundenen Familien eng miteinander verbunden sind.

2. Homologie der Aminosäuresequenzen von Natriumkanälen in der cytoplasmischen Region zwischen DIII und DIV. Die Sequenzen wurden durch GDB erhalten.

3A bis 3D. Ströme, die durch depolarisierende, schrittweise veränderte Spannungen in Oocyten von Xenopus, in die cRNS von HERG injiziert worden war, ausgelöst wurden. 3A. – Ströme, die durch Impulse von 4 sec in Schritten von 10 mV von –50 mV bis –10 mV aktiviert wurden. Während eines Impulses stieg die Stromstärke mit der Spannung progressiv an, ebenso wie der Tailcurrent bei der Rückkehr zum Haltepotential. Das Haltepotential betrug –70 mV. Die Einfügung gibt das Spannungs-Impuls-Protokoll wieder. 3B – Ströme, die durch Testimpulse von 0 bis +40 mV, gesteigert in Schritten von 10 mV, ausgelöst wurden. Während eines Impulses nahm die Stromstärke mit der Spannung progressiv ab, wobei der Tailcurrent sich auf +10 mV einstellte. Es ist bemerkenswert, dass die Ströme keine langsame Inaktivierung zeigen. 3C – Strom-Spannungs-Beziehung für HERG Spitzenstrom, aufgezeichnet während Impulsen von 4 sec (n = 10). 3D – Spannungsabhängigkeit der HERG Kanalaktivierung. Die Amplituden der Tailcurrents wurden bei –70 mV nach Impulsen von 4 sec gemessen und dann in Bezug auf den stärksten Strom normalisiert. Die Daten wurden einer Boltzmann-Funktion angepasst: I = 1/(1 + exp[(Vt – V1/2)/k]), wobei I den relativen Tail-Strom, Vt das Testpotential, V1/2 die für die halbe Aktivierung des Stromes erforderliche Spannung und k den Neigungsfaktor bedeuten. (V1/2 = 15,1 ± 0,6 mV; k = 7,85 ± 0,2 mV; n = 10).

4A–D. Kinetik der Aktivierung und Deaktivierung des HERG Stromes. 4A – Die aktivierenden Ströme wurden durch Impulse von 3,25 sec aktiviert, um Potentiale im Bereich von –50 bis +20 mV zu testen (10 mV). Die Ströme und die entsprechenden einzelnen exponentiellen Fittings (I = A0 + A1·e–t/t) sind übereinander gelegt. 4B – Deaktivierung von HERG Strömen. Der Strom wurde mit Impulsen von 1,6 sec auf +20 mV aktiviert, gefolgt von einer Rückkehr zu Testpotentialen im Bereich von –40 bis –100 mV in Schritten von 10 mV. Die deaktivierenden Ströme und die diesen entsprechenden biexponentiellen Fittings (Itail = A0 + AMPfexp –t/tf + AMPs·exp–t/ts) sind übereinandergelegt. Verlustströme wurden nicht abgezogen (currents not leak subtracted). 4C – Spannungsabhängige Kinetik der Aktivierung (n = 15) und schnellen Deaktivierung (n = 11). 4D – Zeitkonstanten (tf, ts) und relative Amplituden der schnellen (AMPf) und der langsamen (AMPs) Komponenten der Deaktivierung des HERG Stromes, aufgetragen als Funktion des Testpotentials (n = 11). Die relativen Amplituden bei –80 und –90 mV wurden wegen der geringen Stromstärken in der Nähe des Umkehrpotentials nicht gemessen.

5A–C. Das Umkehrpotential von HERG variiert mit [K+]t, wie für einen K+-selektiven Kanal zu erwarten war. 5A – Tailcurrents wurden in einem Oocyten, der sich in einem Bad aus einer ND96 Lösung ([K+]e = 2 mM) befand, bei Potentialen von –105 bis 80 mV (in Schritten von 5 mV) nach einem Impuls bis +20 mV ausgelöst. Das geschätzte Umkehrpotential der Ströme betrug –97 mV. Verlustströme wurden nicht abgezogen. 5B – Tailcurrents wurden in dem selben Oocyten, der sich in einem Bad aus einer modifizierten ND96 Lösung ([K+]e = 10 mM) befand, bei Potentialen von –75 bis 50 mV (in Schritten von 5 mV) ausgelöst. Das Umkehrpotential der Tailcurrents betrug –65 mV. 5C – Das Umkehrpotential (Erev) des HERG Stromes variiert als Funktion von [K+]e. Erev wurde für jeden Oocyten gemessen, indem man den Nullschnittpunkt einer Auftragung der Tail-Strom-Amplitude als Funktion des Testpotentials bestimmte. Die Daten stellen einen Mittelwert aus fünf Bestimmungen dar, mit Ausnahme von 2 mM [K+]e (n = 15). Die gestrichelte Linie stellt die nach der Nernst-Gleichung für einen perfekt K+-selektiven Kanal vorhergesagte Beziehung dar. Die durchgezeichnete Kurve stellt eine Anpassung (fit) der Daten an die Stromgleichung von Goldman-Hodgkin-Katz dar (Goldman, 1943; Hodgkin und Katz, 1949; Erev = 58·log{(r[Na+]e + [K+]e/(r[Na+]i + [K+]i)}. Die aus dieser Kurve bestimmte relative Durchlässigkeit von Na+ zu K+ (r) betrug 0,007.

6A–E. Aktivierung von HERG Strom durch extrazelluläres K+. 6A bis C – Ströme, die bei Impulsen von 4 sec bei Testpotentialen im Bereich von –50 bis +20 mV in einem Oocyten hervorgerufen wurden, der sich in einem Bad aus modifizierter ND96 Lösung befand, das 10 mM KCl (A) oder 2 mM KCl (B) oder gewöhnliche ND96 Lösung ohne Zusatz von KCl enthielt (C), wobei im letzteren Fall 5 min nach dem Zeitpunkt gemessen wurde, zu dem der Oocyt in das Bad gewechselt hatte. 6D – Beziehung zwischen Stromstärke und Spannung bei den Strömen, die in den Grafiken A bis C dargestellt sind. 6E – Die Amplitude des HERG Stromes variiert als Funktion von [K+]e. Die Ströme wurden gemessen bei einem Testpotential von +20 mV (n = 4 – 6). Die durchgezogene Linie ist eine linearere Verbindung der gemessenen Daten (IHERG = 189 + 37,5·[K+]e). Es ist zu bemerken, dass man nicht erwarten sollte, dass diese Beziehung bei niedrigerem und höherem [K+]e eine lineare Funktion von [K+]e sein würde.

7A–D. Die HERG Rektifikation geht auf eine schnelle Inaktivierung zurück. 7A – Die Ströme wurden bei Testpotentialen von +20, 0, –40 und –70 bis –120 mV (in Schritten von 10 mV) gemessen, nach Aktivierung durch einen Impuls von 260 msec bis auf +40 mV ([K+]e = 10 mM). Die Ströme wurden bei einer Samplingrate (sampling rate) von 10 kHz aufgezeichnet. Nur die letzten 30 msec des Aktivierungsimpulses sind wiedergegeben, an die sich die 90 msec des Tailcurrent anschlossen. P/3 Subtraktion wurde angewandt, um den Verluststrom zu eliminieren; die anfänglichen 2 msec des Tailcurrent wurden nicht ausgewertet. Die bei einigen Potentialen (+20 bis –60 mV) aufgezeichneten Tailcurrents wurden mit einer einzelnen Exponentialfunktion angepasst, weil die Deaktivierung langsam genug erfolgte, so dass sie nicht signifikant zu der Nettokinetik (net kinetics) des Tailcurrent beitrug. Bei stärker negativen Potentialen (–70 bis –120 mV) wurden die Ströme mit einer biexponentiellen Funktion angepasst, was der schnellen Phase der Deaktivierung Rechnung trägt, die mit der Erholung von der Inaktivierung überlappt. Fittings zu den Daten sind über die Strommessdaten (current traces) gelegt. 7B – Zeitkonstanten für die Erholung von schneller Inaktivierung, bestimmt aus FKurven (fits) der Tailcurrents, wie zuvor beschrieben. 7C – I-V Beziehung von HERG bei voller Aktivierung. Die maximale Konduktanz des HERG Stromes (118 &mgr;S) wurde mittels der Neigung des linearen Teils der Stromamplituden bei Potentialen zwischen –90 und –120 mV bestimmt. 7D – Spannungsabhängigkeit der schnellen Inaktivierung des HERG Stromes. Der Rektifikationsfaktor R wurde für jedes Potential unter Verwendung der Stromamplituden berechnet, die in der Grafik 7C aufgetragen sind: R = [G·n·(Vt – Erev)]IHERG, wobei: G = maximale Konduktanz von HERG (118 &mgr;S); n = Aktivierungsvariable bei +40 mV (1,0); Vt = Testpotential; und Erev = Umkehrpotential (–73 mV) ist. Die Daten wurden einer Boltzmann-Gleichung angepasst: 1/(1 + exp[(Erev – V1/2/k]). Der Wert von V1/2 betrug –49 mV, und der Neigungsfaktor war +28 mV.

8A–D. Der HERG Strom wird durch La3+ blockiert. 8A – Kontrollströme, aktiviert durch Impulse von 4 sec bei Potentialen im Bereich von –50 bis +50 mV. Verluststrom wurde nicht von den Strömen subtrahiert. 8B – Nach demselben Impulsprotokoll ausgelöste Ströme, nachdem die Oocyten 10 &mgr;M LaCl3 ausgesetzt waren. 8C – I-V Beziehung von HERG Strömen, gemessen am Ende der Testimpulse von 4 sek Dauer. 8D – Isochronale Aktivierungskurven wurden anhand von Auftragungen der Tailcurrentamplituden als Funktion des Testpotentials bestimmt. Die Daten wurden einer Boltzmann-Funktion angepasst, um die gleichmäßige isochronale Aktivierungskurve zu erhalten. La3+ verschob den Halbwertspunkt der Aktivierung von –16 mV auf +23 mV.

9. Deletionen innerhalb des SCN5A Gens kosegregieren mit der Krankheit in der Sippe 2321. Der Stammbaum der Sippe 2321 wird gezeigt. Die Ergebnisse von PCR Analysen unter Verwendung des Primerpaares 3-4 und denaturierender Polyacrylamidgel-Elektrophorese sind unter jedem Symbol angegeben. Es ist bemerkenswert, dass das Allel von 235 Basenpaaren mit der Krankheit in dieser Familie kosegregiert und anzeigt, dass eine mit einer Deletion im Gen SNC5A verbundene Krankheit vorliegt. Um eine falsche phänotypische Klassifizierung zu vermeiden, waren die in dieser Studie angewandeten phänotypischen Merkmale sehr streng, und dementsprechend wurden viele Teilnehmer als Individuen mit ungewissem Phänotypus klassifiziert. Individuen mit einem QTc von 0,47 sec oder mehr wurden als betroffen klassifiziert, während Individuen mit einem QTc von 0,41 sec oder weniger als nicht betroffen angesehen wurden. Alle anderen Individuen wurden als Individuen mit ungewissem Phänotypus klassifiziert. Wenn typische Kriterien angewandt wurden (Individuen mit einem QTc von 0,44 sec oder mehr würden als betroffen angesehen, und Individuen mit einem QTc von weniger als 0,44 sec würden als normal klassifiziert), würden alle betroffenen Mitglieder der Sippen 2321 und 2322 die Deletion im Gen SNC5A tragen, während alle nicht betroffenen Mitglieder nur das normale Allel besitzen.

10. Deletion im Gen SNC5A in der Sippe 2322. Die Ergebnisse von PCR-Analysen unter Verwendung des Primerpaares 3-4 und denaturierender Polyacrylamidgel-Elektrophorese sind unter jedem Symbol angezeigt. Es ist bemerkenswert, dass das Allel von 235 Basenpaaren mit der Krankheit in dieser Familie kosegregiert und anzeigt, dass eine mit einer Deletion im Gen SNC5A verbundene Krankheit vorliegt. Die durch die Reihen (lanes) 4 und 8 repräsentierten Individuen hatten die Deletion, wurden aber als phänotypisch ungewiss klassifiziert. Diese Individuen hatten einen QTc von 0,46 sec, und mit weniger strengen Kriterien bezüglich des Phänotypus würden sie als betroffen angesehen worden sein.

11A und 11B. DNS- und Aminosäuresequenzen der mit LQT einher gehenden Deletion im Gen SCNC5A. DNS Sequenzanalyse identifizierte in der Sippe K2322 die Deletion im Gen SNC5A. Die DNS-Sequenzen von normalen (11A) und anomalen (11B) PCR-Produkten definieren eine Deletion von 9 bp. Diese Mutation verursacht eine Deletion von 3 Aminosäuren (KPQ) in der cytoplasmatischen Region zwischen DIII und DIV. Die entfallenen Sequenzen sind angezeigt.

12. Schematische Darstellung der vorhergesagten Topologie des von SNC5A kodierten Proteins sowie der Lage der mit LQT verbundenen Deletion.

13A bis 13F. Stammbaumstruktur und genotypische Analysen von fünf neuen LQT Familien. Individuen mit den charakteristischen Merkmalen von LQT, einschließlich von verlängertem QT-Intervall und einer Geschichte von Synkopen, Schlaganfällen oder drohendem plötzlichem Herztod, sind mit ausgefüllten Kreisen (Frauen) oder Quadraten (Männer) gekennzeichnet. Nicht betroffene Individuen sind durch leere Kreise oder Quadrate gekennzeichnet. Individuen mit ungewissem Phänotypus oder solche, deren phänotypische Daten nicht verfügbar waren, haben punktierte Kreise oder Quadrate. Kreise oder Quadrate mit einem Schrägstrich zeigen verstorbene Individuen an. Haplotypen für mit LQT2 verbundene polymorphe Marker sind unter jedem Individuum angegeben. Zu diesen Markern zählen (Zentromere zu Telomeren) D7S505, D7S636, HERG 5-11, HERG 3-8 und D7S483 (Gyapay et al, 1994; Wang et al., 1995). Haplotypen, die mit dem Phänotypus der Krankheit kosegregieren, sind durch einen Kasten gekennzeichnet. Rekombinationen sind durch eine horizontale schwarze Linie gekennzeichnet. Von allen Individuen oder ihren Betreuern wurde, nachdem sie informiert worden waren, das Einverständnis eingeholt, gemäß den Richtlinien der örtlichen Überwachungsorgane. Haplotypanalysen zeigen, dass der LQT-Phänotypus in diesen Sippen mit Markern auf dem Chromosom 7q35-36 verbunden ist.

14. Idiogramm des Chromosoms 7 mit Angabe der Lage von HERG/LQT2.

15. Teilweise genomische Struktur von HERG und Lage von PCR Primern, die in dieser Studie verwendet wurden. Regionen, welche für die vorhergesagten Membran spannende Domänen (S1 bis S6), die Porendomäne und die Nukleotid bindende Domäne (NBD) kodieren, sind angegeben. Die DNS Sequenzen für die Grenzen zwischen Exon und Intron sind: Intron I, 5'-AGGAGgtgggg(SEQ ID NO:15)...ccccagCTGATC(Seq ID NO:16)-3'; Intron II, 5'-TGGCTgtgagt(SEQ ID NO:17)...ccccagCCCTC (SEQ ID NO:18)-3'; Intron III, 5'-CCTGGgtatgg(SEQ ID NO:19)...ctccagGGAAG(SEQ II) NO:20)-3'.

16A bis 16C. Deletionen im HERG Gen, die mit LQT in zwei Familien verbunden sind. Der Stammbaum von K2287 (16A) resultiert aus PCR Amplifikationen unter Verwendung des Primerpaares 1-9 (16A). Die Resultate der DNS Sequenzierung von normalen und mutierten HERG Genen in K2287 (16B) und die Auswirkung der Deletionen auf die vorhergesagte Struktur des HERG Proteins (16C) werden gezeigt. Es ist bemerkenswert, dass ein anomales Fragment von 143 bp in betroffenen Mitgliedern dieser Sippe zu beobachten ist, was für die Anwesenheit einer mit der Krankheit verbundenen Deletion innerhalb des Gens spricht. Die DNS-Sequenzen von normalen und anomalen PCR-Produkten definieren eine Deletion von 27 bp (&Dgr;I500-F508). Diese Mutation verursacht eine Deletion von 9 Aminosäuren im Leseraster für die dritte Membran spannende Domäne (S3). Die entfallenen Sequenzen sind angezeigt.

17A bis 17C. Die Stammbaumstruktur von K2593 ist wiedergegeben (17A). Verstorbene Mitglieder sind durch einen Schrägstrich gekennzeichnet. Die Resultate von SSCP Analysen unter Verwendung des Primerpaares 1-9 sind unter jedem Individuum angegeben (17A). Es ist bemerkenswert, dass in dieser Familie ein anomales SSCP Konformer (conformer) mit der Krankheit kosegregiert. Die DNS Sequenz zeigt die Deletion eines einzelnen Basenpaares an (&Dgr;1271) (17B). Diese Deletion resultiert in einer Verschiebung im Leseraster, worauf ein Stopkodon nach 12 Aminosäuren abwärts folgt (17C). Das ausgelassene Nukleotid wird durch einen Pfeil angezeigt.

18A bis 18I. Punktmutationen in HERG in drei Sippen. Die Stammbäume von K1956 (18A), K2596 (18C) und K2015 (18E) sind dargestellt. Unter jedem Stammbaum sind die Resultate von SSCP Analysen mit dem Primerpaar 5-11 (K1956) (18B), dem Primerpaar 1-9 (K2596) (18D) und dem Primerpaar 4-12 (K2015) (18F) angegeben. Anomale SSCP Konformere kosegregieren in jeder Sippe. Analysen der DNS-Sequenzen der normalen und der anomalen Konformere zeigen eine C durch T-Substitution an der Position 1682 in K1956. Diese Mutation führt zu einer Substitution von Valin durch ein hochkonserviertes Alanin im Kodon 561 (A561V) (18G). Analysen von K2596 zeigen eine Substitution von A durch G in der Position 1408 (eine Substitution von T durch C im Antisense-Strang ist in 18D dargestellt). Diese Mutation führt zu einer Substitution von Asparaginsäure durch ein konserviertes Asparagin in der zweiten Transmembrandomäne ((N470D) (18H). Analysen von K2015 zeigen eine Substitution von G durch C (eine Substitution von C durch G auf dem Antisensestrang wird gezeigt) (18F). Diese Mutation liegt in der Spleßdonor-Sequenz des Introns III (18I). Kodierende Sequenzen sind in großen Buchstaben und intronische Sequenzen sind in kleinen Buchstaben dargestellt. Es ist bemerkenswert, dass die Substitution von G durch C die Spleißdonor-Sequenz (splice donor site) unterbricht (HERG, M-eag, elk, Warmke und Ganetzky, 1994; R-eag; Ludwig et al., 1994).

19A bis 19C. De novo Mutation von HERG in einem sporadischen Fall von LQT. Die Stammbaumstruktur von K2269 (19A) und SSCP-Analysen (Primerpaar 14-16) (19A) zeigen ein anomales Konfomer in einem sporadischen Fall von LQT. Die Analyse der DNS Sequenz ergab eine Substitution G durch A in der Position 1882 der cDNS Sequenz (eine Substitution von C durch T im Antisensestrang wird in 19B gezeigt). Es ist bemerkenswert, dass diese Mutation zur Substitution eines Serins durch ein hoch konserviertes Glycin im Kodon 628 (G628S) (19C) führt. Es ist bekannt, dass diese Aminosäuresequenz kritisch für die Kaliumionenselektivität ist.

20. Eine Northern Blot Analyse von mRNS von HERG zeigt eine starke Expression im Herzen. Ein Northern Blot (Clonetech, poly A+ RNS, 2 mg/Spur) wurde unter Verwendung einer die Nukleotide 679 bis 2239 enthaltenden cDNS von HERG durchgeführt. Zwei mRNS des Herzens von etwa 4,1 und 4,4 kb sind angezeigt. Die Hintergrundsignale von aus der Lunge extrahierter mRNS waren hoch, aber es ließen sich keine spezifischen Banden identifizieren.

21. Schematische Darstellung der Topologie des Proteins, für das HERG kodiert, und darin die Lage der mit LQT verbundenen Mutationen. Der Einfachheit halber sind nicht alle Aminosäuren dargestellt. Durch SSCP Analysen wurden HERG Mutationen in vier der 14 mit dem Chromosom 7 verbundenen Sippen identifiziert.

Die vorliegende Erfindung richtet sich auf den Nachweis, dass LQT sowohl auf dem SCN5A als auch auf dem HERG Gen kartiert ist und dass molekulare Varianten dieser Gene die Pathogenese von erblichem LQT verursachen oder daran beteiligt sind. Weiterhin hängt der K+-Kanal, für den das HERG Gen kodiert, mit der erworbenen Form von LQT zusammen. Genauer gesagt betrifft die vorliegende Erfindung Mutationen in den SCN5A und HERG Genen und ihre Verwendung für die Diagnose von LQT sowie die Überwachung und Regelung der K+-Spiegel in Patienten mit familiärem LQT oder in Patienten, die sich einer medikamentösen Therapie von Herzrhythmusstörungen unterziehen oder andere Medikamente einnehmen, welche zu erworbenem LQT führen können. Die vorliegende Erfindung betrifft weiterhin Methoden zur Durchmusterung von Menschen auf die Anwesenheit von Varianten der SCN5A und HERG Gene, welche LQT auslösen. Da nunmehr LQT früher (d.h. vor dem Auftreten von Symptomen) und mit größerer Sicherheit festgestellt werden kann, stehen Optionen für eine bessere Behandlung derjenigen Patienten zur Verfügung, die als mit erblichem LQT behaftet identifiziert wurden.

Die vorliegende Erfindung stellt Methoden zum Durchmustern der SNC5A und HERG Gene zur Identifizierung von Mutationen zur Verfügung. Diese Methoden können weiterhin die Stufen der Amplifizierung eines Teils der SCN5A oder HERG Gene einschließen und können auch eine Stufe umfassen, in der eine Gruppe von Polynukleotiden verfügbar gemacht wird, welche als Primer für die Amplifikation der erwähnten Teile der SNC5A und HERG Gene dienen. Das Verfahren eignet sich zur Identifizierung von Mutationen zur Verwendung entweder für die Diagnose von LQT oder zur Prognose von LQT.

Das verlängerte QT Syndrom ist eine vererbte oder erworbene Krankheit, die einen plötzlichen Tod durch Herzrhythmusstörungen, insbesondere durch Torsades de pointes oder Kammerflimmern, verursacht. LQT war bisher auf drei Loci kartiert: LQT1 auf dem Chromosom 11p15.5, LQT2 auf dem Chromosom 7q35-36 und LQT3 auf dem Chromosom 3p21-24. Es ist eine Entdeckung der vorliegenden Erfindung, dass es einen genetischen Zusammenhang zwischen LQT3 und einem Polymorphismus innerhalb des Gens für den Natriumkanal des Herzens, gibt. Es ist weiterhin eine Entdeckung der vorliegenden Erfindung, dass eine genetische Verbindung zwischen LQT2 und einem Polymorphismus innerhalb von HERG besteht. Eine weitere Entdeckung der vorliegenden Erfindung besteht darin, dass es eine Verbindung zwischen dem K+-Kanal, für den das HERG Gen kodiert, und der erworbenen Form von LQT gibt. SSCP und DNS Sequenzanalysen zeigen identische Deletionen innerhalb des Gens SNC5A in betroffenen Mitgliedern von zwei nicht miteinander verwandten LQT Familien. Die entfallenen Sequenzen liegen in einer Region, die für die Kanalinaktivierung wichtig ist. Diese Befunde lassen vermuten, dass Mutationen von SCN5A ein mit dem Chromosom 3 zusammenhängendes LQT verursachen und zeigen einen wahrscheinlichen zellulären Mechanismus für diese Krankheit an. SSCP und DNS Sequenzanalysen ergaben zwei bestimmte Deletionen innerhalb von HERG in zwei betroffenen Individuen. Eine der Mutationen verursachte eine Deletion von 27 bp von der Position 1498 an. Diese Deletion unterbricht die dritte Membran spannende Domäne (S3) von HERG. Die andere Deletion war die einer einzelnen Base in der Position 1261. Dies führt zu einer Verschiebung des Leserasters bei den Sequenzen, die für die erste Membran spannende Domäne (S1) kodieren, und zu einem neuen Stopkodon innerhalb von 12 Aminosäuren. Ähnliche Analysen ergaben auch drei verschiedene Missense-Mutationen in drei anderen betroffenen Individuen sowie eine Spleißdonor-Mutation in einem betroffenen Individuum.

Ein Beweis dafür, dass die SCN5A und HERG Gene bei erblichem LQT beteiligt sind, wurde dadurch erhalten, dass in der DNS, die von betroffenen Mitgliedern der Sippe stammte, Sequenzen gefunden wurden, die anomale SCN5A oder HERG Genprodukte oder anomale Gehalte an den Genprodukten ergaben. Solche für LQT empfänglich machende Allele kosegregieren mit der Krankheit in großen Sippen. Sie kommen auch in viel höherem Maße Maße in mit LQT behafteten Individuen vor, die nicht aus den Sippen stammen, als in Individuen aus der allgemeinen Bevölkerung. Der Schlüssel liegt darin, Mutationen zu finden, die ernst genug sind, um offensichtliche Störungen der normalen Funktion des Genprodukts zu verursachen. Diese Mutationen können eine Anzahl verschiedener Formen annehmen. Die ernstesten Formen sind Verschiebungen des Leserasters oder große Deletionen, die dazu führen würden, dass das Gen für ein anomales Protein kodiert oder die Proteinexpression erheblich verändert. Zu den weniger schwerwiegenden störenden Mutationen würden kleine Deletionen im Leseraster und nicht konservative Substitutionen von Basenpaaren zählen, die einen erheblichen Effekt auf das erzeugte Protein haben würden, wie z.B. ein Wechsel zu oder von einem Cysteinbaustein, von einer basischen zu einer sauren Aminosäure oder umgekehrt, von einer hydrophilen zu einer hydrophoben Aminosäure oder umgekehr oder andere Mutationen, die die sekundäre oder tertiäre Proteinstruktur beeinflussen würden. Von „silent mutations" oder solchen, die zu einer konservativen Aminosäuresubstitution führen, würde man im allgemeinen keine Störung der Proteinfunktion erwarten.

Gemäß der diagnostischen oder prognostischen Methode nach der vorliegenden Erfindung wird eine Veränderung der Wildtyp SCN5A oder HERG Gene entdeckt. Weiterhin kann die Methode ausgeführt werden, indem man Wildtyp SCN5A oder HERG Gene auffindet und damit sicherstellt, dass LQT nicht aus diesen beiden Loci resultiert. Der Terminus „Veränderung eines Wildtyp Gens" schließt alle Formen von Mutationen einschließlich von Deletionen, Insertionen und Punktmutationen in kodierenden oder nicht kodierenden Regionen ein. Deletionen können die eines ganzen Gens oder nur eines Teiles eines Gens sein. Punktmutationen können zu Stopkodons, Verschiebungen des Leserasters oder Substitutionen von Aminosäuren führen. Somatische Mutationen sind solche, die lediglich in bestimmten Geweben auftreten und nicht in der Keimbahn vererbt werden. Keimbahnmutationen können in jedem Gewebe des Körpers gefunden werden und sind erblich. Punktmutationen können in regulatorischen Regionen, wie z.B. in dem Promotor des Gens, stattfinden und führen zum Verlust oder zu einer Verminderung der Expression der mRNS. Punktmutationen können auch die richtige Weiterverarbeitung der RNS und dadurch die Expression der SCN5A oder HERG Genprodukte verhindern oder die Stabilität der mRNS oder die Translationseffizienz herabsetzen.

Die Anwesenheit von erblichem LQT kann nachgewiesen werden, indem man ein beliebiges Gewebe eines Menschen auf Mutationen in den SCN5A und/oder HERG Genen untersucht. Beispielsweise würde eine Person, die eine Keimbahnmutation im SCN5A oder HERG Gen trägt, dazu neigen, einen LQT zu entwickeln. Dies kann bestimmt werden, indem man DNS aus einem beliebigen Gewebe aus dem Körper der Person untersucht. Am einfachsten nimmt man Blut ab und untersucht die aus den Zellen des Blutes extrahierte DNS. Weiterhin kann eine pränatale Diagnose gestellt werden, indem man fötale Zellen, Placentazellen oder Fruchtwassserzellen auf Mutationen in den SCN5A und/oder HERG Genen untersucht. Veränderungen der Wildtyp SCN5A oder HERG Allele, ob z.B. durch Punkmutationen oder Deletionen, können durch jede der hierin offenbarten Methoden entdeckt werden.

Es gibt verschiedene Methoden, die angewandt werden können, um Variationen in der DNS Sequenz zu entdecken. Durch direkte DNS Sequenzierung, sei es manuell oder in Form von automatisierter Fluoreszenzsequenzierung, können Sequenzvariationen entdeckt werden. Einen anderen Ansatz bietet der „single-stranded conformation polymorphism" Assay (SSCP) (Orita et al., 1989). Mit dieser Methode werden nicht alle sequentiellen Veränderungen entdeckt, insbesondere dann nicht, wenn das DNS Fragment größer als 200 bp ist, sie kann jedoch optimiert werden, so dass man die meisten DNS Sequenzvariationen findet. Die verminderte Nachweisempfindlichkeit ist ein Nachteil, aber der mit SSCP mögliche hohe Durchsatz macht SSCP zumindest auf dem Gebiet der Forschung im Vergleich zur direkten Sequenzierung zu einer attraktiven, brauchbaren Methode zur Entdeckung von Mutationen. Diejenigen Fragmente, die eine veränderte Mobilität auf dem SSCP Gel zeigen, werden dann sequenziert, um die exakte Natur der Sequenzvariation zu bestimmen. Zu den anderen Ansätzen, die sich auf die Entdeckung von Fehlstellen (mismatches) zwischen zwei komplementären DNS Strängen gründen, gehören die denaturierende Gelelektrophorese (clamped denaturing gel electrophoresis) (CDGE) (Sheffield et al., 1991), die Heteroduplex-Analyse (HA) (White et al., 1992) und die chemische Mismatch-Spaltung („chemical mismatch cleavage") (CMC) (Grompe et al., 1989). Keine der zuvor genannten Methoden spürt große Deletionen, Duplikationen oder Insertionen auf, und auch eine regulatorische Mutation, die die Translation oder Transkription des Proteins beeinflusst, wird nicht gefunden. Andere Methoden, die diese Arten von Mutationen zu entdecken gestatten könnten, wie z.B. der „Protein-Truncation-Assay" oder der „asymmetric assay", detektieren nur spezifische Typen von Mutationen und würden nicht Missense-Mutationen auffinden. Eine Übersicht über die zur Zeit verfügbaren Methoden zur Entdeckung von DNS-Sequenzvariationen kann in dem kürzlichen erschienenen Review von Grompe (1993) gefunden werden. Wenn eine Mutation erst bekannt ist, kann ein Allel-spezifisches Nachweisverfahren, wie z.B. Allel-spezifische Oligonukleotid-(ASO)-Hybridisierung, verwendet werden, um schnell eine große Zahl von Proben auf dieselbe Mutation hin zu durchmustern.

Eine schnelle vorläufige Analyse zur Entdeckung von Polymorphismus in DNS Sequenzen kann durchgeführt werden, indem man eine Reihe von Southern Blots von DNS betrachtet, die durch ein oder mehrere Restriktionsenzyme geschnitten wurden, vorteilhaft mit einer großen Zahl von Restriktionsenzymen. Jeder Blot enthält Material von einer Reihe von normalen Individuen und von einer Reihe von mit LQT behafteten Patienten. Southern Blots, welche eine Hybridisierung von Fragmenten zeigen (die sich in der Länge von Vergleichs DNS unterscheiden, wenn sie mit Sequenzen, die nahe bei den SNC5A oder HERG Loci liegen oder sie einschließen, hybridisiert werden), zeigen eine möglich Mutation an. Wenn Restriktionsenzyme verwendet werden, die sehr große Restriktionsfragmente erzeugen, dann wird eine Pulsfeld-Gelelektrophorese (PFGE) angewandt.

Eine Prüfung auf Punktmutationen kann durch molekulares Klonieren der SNC5A- oder HERG Allele und Sequenzieren der Allele unter Verwendung bekannter Techniken durchgeführt werden.

Es gibt sechs gut bekannte Methoden für einen in höherem Maße vollständigen, aber immer noch indirekten Test für die Bestätigung, dass ein anfälliges Allel vorliegt: 1) Einstrang-Konformationsanalyse (SSCP) (Orita et al., 1989); 2) denaturierende Gradientengelelektrophorese (DGGE) (Wartell et al., 1990; Sheffield et al., 1989); RNase Protektionsassays (Finkelstein et al., 1990; Kinszler et al., 1991); 4) Allel-spezifische Oligonukleotide (ASOs) (Conner et al., 1983); 5) die Verwendung von Proteinen zur Entdeckung von Nukleotid-Mismatches, wie z.B. das mutS Protein aus E.Coli (Modrich, 1991); und 6) Allel-spezifische PCR (Ranon und Kidd, 1989). Für Allel-spezifische PCR werden Primer verwendet, die an ihren 3'-Enden mit bestimmten SCN5A oder HERG Mutationen hybridisieren. Wenn die betreffende Mutation nicht vorliegt, wird kein Amplifizierungsprodukt erhalten. Ein Amplification Refractory Mutation System (ARMS) kann ebenfalls verwendet werden, wie in der Europäischen Patentanmeldung mit der Veröffentlichungsnummer 0 332 435 und von Newton et al., 1989 beschrieben wurde. Insertionen und Deletionen in Genen können auch durch Klonieren, Sequenzieren und Amplifizieren entdeckt werden. Weiterhin können Sonden zum Nachweis eines Restriktionsfragment-LängenPolymorphismus (RFLP) für das Gen oder umgebende Markergene eingesetzt werden, um die Veränderung eines Allels oder eine Insertion in ein polymorphes Fragment nachzuweisen. Ein solches Verfahren eignet sich besonders für die Durchmusterung von Verwandten eines betroffenen Individuums auf die Mutation hin, die bei dem Individuum gefunden wurde. Auch andere Methoden des Standes der Technik können verwendet werden, um Insertionen (inserionen) und Deletionen in den SCN5A und/oder HERG Genen nachzuweisen.

Bei den ersten drei Methoden (SSCP, DGGE und RNase Protektionsassay) erscheint eine neue elektrophoretische Bande. Durch SSCP wird eine Bande gefunden, die differentiell wandert, weil die veränderte Sequenz einen Unterschied bei der einsträngigen, intramolekularen Basenpaarung verursacht. Bei der RNase Protektion wird das mutierte Polynukleotid in zwei oder mehr kleinere Fragmente gespalten. DGGE entdeckt Unterschiede in den Migrationsraten von mutierten Sequenzen im Vergleich mit den Wildtyp Sequenzen, wobei ein denaturierendes Gradientengel eingesetzt wird. Bei dem Allel-spezifischen Oligonukleotid-Assay wird ein Oligonukleotid konstruiert, das eine spezifische Sequenz entdeckt, und der Assay wird durchgeführt, indem man die Anwesenheit oder Abwesenheit eines Hybridisierungssignals prüft. Bei dem mutS Assay bindet das Protein nur an Sequenzen, die ein Nukleotid-Mismatch in einem Heteroduplex aus mutierter und Wildtyp Sequenz enthalten.

Mismatche im Sinne der vorliegenden Erfindung sind hybridisierte Nukleinsäure-Duplexe, bei denen die Stränge nicht zu 100% komplementär sind. Der Mangel an vollständiger Homologie kann Deletionen, Insertionen, Inversionen oder Substitutionen als Ursache haben. Die Prüfung auf Mismatche kann verwendet werden, um Punktmutationen in dem Gen oder in dessen m mRNS Produkt zu entdecken. Wenn diese Techniken auch weniger empfindlich als die Sequenzierung sind, so sind sie doch bei einer großen Zahl von Proben einfacher durchzuführen. Ein Beispiel für eine Mismatch-Spalt-Technik ist die RNase Protektionsmethode. In der Praxis der vorliegenden Erfindung verwendet man eine markierte Riboprobe, die zu der kodierenden Sequenz des humanen Wildtyp SCN5A oder HERG Gens komplementär ist. Die Riboprobe und entweder mRNS oder DNS, die aus der zu untersuchenden Person isoliert wurde, werden zusammengefügt (hybridisiert) und danach mit dem Enzym RNase A verdaut, welches in der Lage ist, Mismatche in einer RNA Duplexstruktur zu entdecken. Wenn ein Mismatch von der RNase A entdeckt wird, spaltet sie die Duplexstruktur an dieser Stelle. Wenn also ein Mismatch von der RNase entdeckt und die Duplexstruktur gespalten wurde, wird bei der Trennung der zusammengefügten RNS Präparation an einer elektrophoretischen Gelmatrix ein RNS Produkt gefunden, das kleiner ist als die Duplex-RNS von voller Länge für die Riboprobe und die mRNS oder DNS. Die Riboprobe braucht nicht die volle Länge der mRNS oder des Gens zu haben, sondern kann ein Segment eines der beiden sein. Wenn die Riboprobe nur ein Segment der mRNS oder des Gens umfasst, ist es wünschenswert, mehrere dieser Proben zu verwenden, um die vollständige mRNS Sequenz auf Mismatche zu durchmustern.

In ähnlicher Weise können DNS-Sonden verwendet werden, um durch enzymatische oder chemische Spaltung Mismatche zu finden. Siehe z.B. Cotton et al., 1988; Shenk et al. 1975; Novack et al., 1986. Alternativ können Mismatche durch Veränderungen in der elektrophoretischen Mobilität von Mismatche enthaltenden Duplexen im Vergleich zu Komplexen ohne Mismatch nachgewiesen werden. Siehe z.B. Cariello, 1988. Entweder mit Riboproben oder mit DNS-Sonden kann die mRNS oder DNS, die möglicherweise eine Mutation enthält, mittels PCR (siehe weiter unten) vor der Hybridisierung amplifiziert werden. Veränderungen in dem SCN5A oder HERG Gen können auch mittels Southern Hybridisierung aufgefunden werden, insbesondere wenn die Veränderungen „gross-rearrangements" sind, wie z.B. Deletionen und Insertionen.

DNS-Sequenzen des SCN5A oder HERG Gens, welche unter Verwendung von PCR amplifiziert wurden, können ebenfalls mittels Allel-spezifischer Sonden durchmustert werden. Diese Sonden sind Nukleinsäure-Oligomere, von denen jedes eine Region der Gensequenz enthält, die eine bekannte Mutation aufweist. Beispielsweise kann ein Oligomer etwa 30 Nukleotide lang sein, entsprechend einem Anteil der Gensequenz. Durch Verwendung einer Reihe solcher Allel-spezifischer Sonden können mittels PCR amplifizierter Produkte durchmustert werden, um festzustellen, ob eine zuvor identifizierte Mutation in dem Gen vorhanden ist. Die Hybridisierung von Allel-spezifischen Sonden mit amplifizierten SCN5A oder HERG Gensequenzen kann beispielsweise auf einem Nylonfilter stattfinden. Die Hybridisierung mit einer bestimmten Sonde unter stringenten Hybridisierungsbedingungen zeigt an, dass in dem Gewebe die selbe Mutation wie in der Allel-spezifischen Sonde vorliegt.

Der sicherste Test auf Mutationen an einem bestimmten Ort besteht darin, genomische SCN5A oder HERG-Sequenzen von Patienten mit denen einer Vergleichspopulation direkt zu vergleichen. Alternativ könnte man mRNS nach Amplifizierung, z.B. mittels PCR, sequenzieren, wodurch es sich erübrigt, die Exonstruktur des Kandidatengens zu bestimmen.

Mutationen außerhalb der kodierenden Region des SCN5A oder HERG Gens können in Proben von Patienten nachgewiesen werden, indem man die nicht kodierenden Regionen untersucht, wie z.B. Introns oder regulierende Sequenzen in der Nähe oder innerhalb der Gene. Ein früher Hinweis darauf, dass Mutationen in nicht kodierenden Regionen wichtig sind, kann von Northern Blot Experimenten stammen, welche zeigen, dass in Patienten im Vergleich mit einer Kontrollpopulation Boten-RNS Moleküle von anomaler Größe oder in ungewöhnlich großer Menge vorkommen.

Veränderungen in der Expression von mRNS von SCN5A oder HERG können durch beliebige geeignete Methoden des Standes der Technik nachgewiesen werden. Dazu zählen Northern Blot Analyse, PCR Amplifizierung und RNase Protektion. Eine verminderte Expression von mRNS zeigt eine Veränderung des Wildtyp Gens an. Eine Veränderung des Wildtyp Gens kann auch entdeckt werden, indem man von normalen SCN5A oder HERG Genen stammende Proteine auf Veränderungen hin durchnustert. Beispielsweise können mit SCN5A oder HERG immunoreaktive Antikörper verwendet werden, um ein Gewebe zu durchmustern. Das Fehlen eines dem Antikörper entsprechenden Antigens würde eine Mutation anzeigen. Antikörper, die für Produkte von mutierten Allelen spezifisch sind, können ebenfalls verwendet werden, um mutierte Genprodukte zu finden. Solche immunologischen Assays können nach beliebigen Methoden des Standes der Technik durchgeführt werden. Dazu zählen Western Blots, immunohistochemische Assays und ELISA Assays. Beliebige Methoden zum Nachweis eines veränderten SCN5A oder HERG Proteins können dazu dienen, eine Veränderung der Wildtyp SCN5A oder HERG Gene zu entdecken. Funktionale Assays, wie z.B. die Bestimmung von Proteinbindungen, sind ebenfalls geeignet. Weiterhin können Assays verwendet werden, die eine biochemische Funktion von SCN5A oder HERG nachweisen. Wenn ein mutiertes SCN5A oder HERG Genprodukt gefunden wird, zeigt dies an, dass das normale SCN5A oder HERG Gen verändert war.

Mutierte SCN5A oder HERG Gene oder Genprodukte können auch in anderen Proben aus dem menschlichen Körper nachgewiesen werden, z.B. in Serum, Stuhl, Urin und Speichel. Die selben Techniken, die zuvor für den Nachweis von mutierten Genen oder Genprodukten diskutiert wurden, können auch bei diesen anderen Proben verwendet werden. Wenn man solche anderen Proben durchmustert, kann man in einfacher Weise eine frühe Diagnose von erblichem LQT stellen.

Die Primerpaare nach der vorliegenden Erfindung sind für den Nachweis der Nukleotidsequenz bestimmter SCN5A oder HERG Allele unter Verwendung von PCR brauchbar. Die Paare von einsträngigen DNS-Primern können mit Sequenzen kombiniert werden, die innerhalb des SCN5A oder HERG Gens auf den Chromosomen 3 bzw. 7 liegen oder das Gen umgeben, um die amplifizierende DNS-Synthese des Gens selbst auszulösen. Ein kompletter Satz dieser Primer erlaubt die Synthese aller Nukleotide der kodierenden Sequenzen des Gens, d.h. der Exons. Der Satz von Primern erlaubt vorzugsweise die Synthese sowohl der Intron- als auch der Exon-Sequenzen. Auch Allel-spezifische Primer können verwendet werden. Solche Primer kombinieren nur mit bestimmten, mutierten SCN5A oder HERG Allelen und amplifizieren somit ein Produkt nur in Anwesenheit des mutierten Allels als Template.

Um die nachfolgende Klonierung der amplifizierten Sequenzen zu erleichtern, können die Primer Restriktionsenzym-Erkennungssequenzen aufweisen, die an ihren 5'-Terminus angefügt sind. Somit leiten sich alle Nukleotide der Primer von SCN5A oder HERG Sequenzen oder von Sequenzen in der Nähe von SCN5A oder HERG Sequenzen ab, mit Ausnahme von den paar Nukleotiden, die zur Erkennung durch Restriktionsenzyme dienen. Solche Enzyme und ihre Orte sind im Stand der Technik gut bekannt. Die Primer selbst können mittels Methoden synthetisiert werden, die ebenfalls in der Technik gut bekannt sind. Im allgemeinen werden die Primer unter Verwendung von Apparaten für die Synthese von Oligonukleotiden hergestellt, die im Handel erhältlich sind. Auf der Grundlage der bekannten Sequenzen von SCN5A (Gellens et al. 1992) und HERG (Warmke und Ganetzky, 1994) ist der Fachmann ohne weiteres in der Lage, bestimmte Primer zu konstruieren.

Die nach der vorliegenden Erfindung zur Verfügung stehenden Nukleinsäuresonden eignen sich für eine Reihe von Zwecken. Sie können für eine Southern Hybridisierung mit genomischer DNS sowie in der RNase Protektionsmethode zum Nachweis von Punktmutationen, wie zuvor beschrieben, eingesetzt werden. Die Sonden können auch zum Nachweis von Produkten der PCR-Amplifizierung dienen. Weiterhin können sie verwendet werden, um Mismatche in den SCN5A oder HERG Genen oder in mRNS nach anderen Methoden zu finden.

Es ist gefunden worden, dass Personen mit den Wildtyp SCN5A und HERG Genen keinen erblichen LQT zeigen. Mutationen, die die Funktion der SCN5A oder HERG Genprodukte stören, sind jedoch an der Pathogenese von LQT beteiligt. So verursacht die Anwesenheit eines veränderten (oder mutierten) SCN5A oder HERG Gens, welches ein Protein mit einem Verlust oder einer Veränderung einer Funktion erzeugt, direkt LQT mit einem erhöhten Risiko von Herzarrhythmie. Um eine Mutation eines SCN5A oder HERG Gens nachzuweisen, wird eine biologische Probe bereitet und im Hinblick auf einen Unterschied zwischen der Sequenz des analysierten Allels und der Sequenz des Wildtyp Allels untersucht. Mutierte SCN5A oder HERG Allele können von Anfang an nach einer der zuvor beschriebenen Methoden identifiziert werden. Die mutierten Allele werden dann sequenziert, um die spezifische Mutation des jeweiligen Allels zu identifizieren. Alternativ können mutierte Allele am Anfang identifiziert werden, indem man nach üblichen Methoden mutierte (veränderte) Proteine identifiziert. Die mutierten Allele werden dann sequenziert, um die spezifische Mutation jedes Allels zu identifizieren. Die Mutationen, insbesondere diejenigen, die zu einer veränderten Funktion des Proteins führen, werden dann für die diagnostischen und prognostischen Methoden nach dieser Erfindung ausgenutzt.

Die vorliegende Erfindung macht es möglich, Patienten mit K+ zu behandeln, um das Risiko zu vermindern, dass sich LQT und/oder Torsades de pointes entwickeln. Die Modulation von HERG durch extrazelluläres K+ ([K+]e) kann von physiologischer Bedeutung sein. Bei Herzrasen oder Ischämie reichert sich K+ innerhalb von zellulären Spalten (clefts) an (Ginant et al., 1992). Diese Erhöhung von [K+]e steigert den Anteil von HERG an dem repolarisierenden Strom. HERG kann daher sogar wichtiger für die Modulation der Dauer des Aktionspotentials bei schnellen Herzfrequenzen oder während der ersten Phase einer Ischämie sein.

Definitionen

Die vorliegende Erfindung verwendet die folgenden Definitionen:

„Sonden". Polymorphismen von Polynukleotiden, die mit Allelen von SCN5A oder HERG assoziiert sind, welche für LQT prädisponieren, werden durch Hybridisierung mit einer Polynukleotidsonde nachgewiesen, die unter stringenten oder mäßig stringenten Hybridisierungs- und Auswaschbedingungen mit den Nukleotiden der Zielsequenz einen stabilen Hybridkomplex bildet. Wenn erwartet wird, dass die Sonden perfekt komplementär zu der Zielsequenz sind, werden stringente Bedingungen gewählt. Die Stringenz der Hybridisierung kann vermindert werden, wenn man Mismatch in geringem Maße erwartet, wenn z.B. Varianten erwartet werden mit der Folge, dass die Sonde nicht komplett komplementär sein wird. Es werden Bedingungen gewählt, die nicht spezifische, zufällige Bindungen ausschließen, d.h. solche die die Hintergrundsignale minimieren. Weil solche Indikationen sowohl neutralen DNS-Polymorphismus als auch Mutationen identifizieren, müssen diese Indikationen weiter analysiert werden, um den Nachweis eines für LQT empfänglich machenden SCN5A oder HERG Allels zu führen.

Sonden für SCN5A oder HERG Allele können von den Sequenzen der SCN5A oder HERG-Region oder von deren cDNS abgeleitet werden. Die Sonden können von jeder geeigneten Länge sein, die die gesamte Länge der SCN5A oder HERG Region oder nur einen Teil davon umfasst und die eine spezifische Hybridisierung mit dieser Region erlaubt. Wenn die Zielregion eine Sequenz umfasst, die mit der der Sonde identisch ist, kann die Sonde kurz sein, d.h. im Bereich von 8 bis 30 Basenpaaren liegen, weil das Hybrid selbst unter stringenten Bedingungen relativ stabil sein wird. Wenn ein gewisses Maß an Mismatch mit der Sonde erwartet wird, d.h. wenn vermutet wird, dass die Sonde mit einer variierten Region hybridisieren wird, kann eine längere Sonde verwendet werden, die mit der Zielsequenz mit der erforderlichen Spezifität hybridisiert.

Die Sonde enthält ein isoliertes Polynukleotid, das an ein Markierungs- oder Reportermolekül angefügt ist und verwendet werden kann, um nach üblichen Methoden andere Polynukleotidsequenzen mit ähnlicher Sequenzfolge zu isolieren. Bezüglich Verfahren zur Herstellung und Markierung von Sonden siehe z.B. Sambrook et al, 1989, oder Asubel et al., 1992. Andere ähnliche Polynukleotide können ausgewählt werden, indem man homologe Polynukleotide verwendet. Alternativ können Polynukleotide, die für diese oder ähnliche Polypeptide kodieren, synthetisiert oder ausgewählt werden, indem man die Redundanz des genetischen Codes ausnutzt. Verschiedene Kodonsubstitutionen können eingeführt werden, beispielsweise „silent changes", (wodurch verschiedene Restriktionsorte geschaffen werden), oder um die Expression in einem bestimmten System zu optimieren. Mutationen können eingeführt werden, um die Eigenschaften des Polypeptids zu modifizieren, vielleicht um die Abbau- oder Umwandlungsrate der Polypeptide zu verändern.

Sonden, welche synthetische Polynukleotide oder andere Polynukleotide nach der vorliegenden Erfindung enthalten, können von natürlich vorkommenden oder rekombinanten ein- oder doppelsträngigen Polynukleotiden abgeleitet oder chemisch synthetisiert werden. Die Sonden können auch durch Nicktranslation, Auffüllreaktion (fill-in reaction) nach Klenow oder andere Methoden des Standes der Technik hergestellt werden.

Bevorzugte Sonden sind Teile der für SCN5A oder HERG kodierenden Polynukleotidsequenzen mit wenigstens etwa acht Nukleotiden, gewöhnlich mindestens etwa 15 Nukleotiden und mit weniger als etwa 6 kb, gewöhnlich weniger als 1,0 kb. Die Sonden können auch verwendet werden, um festzustellen, ob ob in einer Zelle oder einem Gewebe mRNA vorhanden ist, die für SCN5A oder HERG kodiert.

„Regulatorische Sequenzen" bezieht sich auf diejenigen Sequenzen normalerweise innerhalb von 100 kb der kodierenden Region eines Locus, sie können aber auch weiter entfernt von der kodierenden Region sein, die die Expression des Gens beeinflussen (einschließlich der Transkription des Gens sowie der Translation, Spleißen, Stabilität o.ä. der Boten-RNS).

„Wesentliche Homologie oder Ähnlichkeit". Eine Nukleinsäure oder ein Fragment davon ist zu einer anderen Nukleinsäure oder einem Fragment davon „im wesentlichen homolog" (oder „im wesentlichen ähnlich"), wenn sie oder es der anderen Nukleinsäure oder dem Fragment davon (oder dem jeweiligen komplementären Strang) optimal angepasst ist (mit den jeweiligen Insertionen oder Deletionen), wobei die Identität der Nukleotidsequenzen mindestens 60%, gewöhnlich mindestens etwa 70%, öfter noch mindestens etwa 80%, vorteilhaft mindestens 90% und insbesondere etwa 95 bis 98% identische Nukleotidbasen beträgt.

Alternativ liegt eine wesentliche Homologie (oder wesentliche Ähnlichkeit) vor, wenn eine Nukleinsäure oder ein Fragment davon mit einer anderen Nukleinsäure (oder einem dazu komplementären Strang) unter selektiven Hybridisierungsbedingungen zu einem Strang oder dessen Komplement hybridisiert. Die Hybridisierung wird als selektiv angesehen, wenn eine Hybridisierung erfolgt, die wesentlich selektiver ist als ein vollständiges Fehlen von Spezifität. Typischerweise findet eine selektive Hybridisierung statt, wenn mindestens etwa 55% Homologie über eine Länge von mindestens etwa 14 Nukleotiden beobachtet wird, vorteilhaft mindestens etwa 65%, besser noch mindestens etwa 75% und insbesondere mindestens etwa 90%. Siehe Kanehisa, 1984. Die Länge des Homologievergleiches, wie beschrieben, kann sich über längere Strecken erstrecken und wird sich in manchen Fällen oft auf eine Sequenz von mindestens etwa 9 Nukleotiden, üblicherweise von mindestens etwa 20 Nukleotiden, öfter noch von mindestens etwa 24 Nukleotiden, typischerweise von mindestens etwa 28 Nukleotiden, besser noch von mindestens etwa 32 Nukleotiden und vorteilhaft von mindestens etwa 36 Nukleotiden beziehen.

Die Hybridisierung von Nukleinsäuren wird durch solche Bedingungen beeinflusst, wie z.B. Salzkonzentration, Temperatur, organische Lösungsmittel zusätzlich zu der Basenzusammensetzung, Länge der komplementären Stränge und Anzahl der Mismatche der Nukleotidbasen in den hybridisierenden Nukleinsäuren, wie der Fachmann ohne weiteres verstehen wird. Stringente Temperaturbedingungen schließen im allgemeinen Temperaturen von mehr als 30°C, typischerweise von mehr als 37°C und insbesondere von mehr als 45°C ein. Stringente Bedingungen hinsichtlich der Salzkonzentration sind gewöhnlich weniger als 1.000 mM, typischerweise weniger als 500 mM und insbesondere weniger als 200 mM. Die Kombination der Parameter ist jedoch viel wichtiger als die Messung irgendeines einzelnen Parameters. Siehe z.B. Wetmur und Davidson, 1968.

Die Sequenzen einer. Sonde können unter bestimmten Bedingungen auch mit Duplex DNS spezifisch hybridisieren und bilden dann einen Triplex oder einen DNS Komplex höherer Ordnung. Die Herstellung solcher Sonden und geeignete Hybridisierungsbedingungen sind im Stand der Technik gut bekannt.

Herstellung von rekombinanten oder chemisch synthetisierten Nukleinsäuren; Vektoren, Transformation, Wirtszellen

Große Mengen von Polynukleotiden nach der vorliegenden Erfindung können durch Replikation in geeigneten Wirtszellen hergestellt werden. Normale oder synthetische Polynukleotidfragmente, die für ein gewünschtes Fragment kodieren, werden in rekombinante Polynukleotidkonstrukte, üblicherweise DNS Konstrukte, eingebaut, welche sich in prokariotische oder eukariotische Zellen einführen lassen und dort replizieren. Üblicherweise eignen sich die Polynukleotidkonstrukte zur Einführung in einen Einzeller, wie z.B. Hefe oder Bakterien, sie können aber auch zur Einführung in kultivierte Säugerzellen, Pflanzen- oder andere eukaryotische Zelllinien (mit oder ohne Integration in das Genom) vorgesehen sein. Die Reinigung von Nukleinsäuren, die nach den Verfahren der vorliegenden Erfindung hergestellt wurden ist z.B. von Sambrook et al., 1989 oder Asubel et al., 1992 beschrieben.

Die Polynukleotide nach der vorliegenden Erfindung können auch durch chemische Synthese hergestellt werden, z.B. nach dem Phosphoramidit-Verfahren, das von Beaucaga und Carruthers, 1981, beschrieben wurde, oder mittels des Triester-Verfahrens nach Matteucci et al., 1981, und die Herstellung kann in kommerziell verfügbaren automatisierten Syntheseapparaten erfolgen. Ein doppelsträngiges Fragment kann aus dem einsträngigen Produkt der chemischen Synthese entweder durch Synthese des komplementären Stranges, der dann unter geeigneten Bedingungen mit dem anderen Strang kombiniert wird, erhalten werden, oder man fügt den komplementären Strang unter Verwendung von DNS Polymerase und einer geeigneten Primersequenz hinzu.

Polynukleotid-Konstrukte, die für die Einführung in eine prokaryotische oder eukaryotische Wirtszelle konstruiert wurden, können ein Replikationssystem umfassen, das von der Wirtszelle erkannt wird und das ausgewählte, für das gewünschte Polypeptid kodierende Polynukleotidfragment sowie vorteilhaft auch regulatorische Sequenzen für die Initiierung der Translation und der Transkription, funktionell mit dem für das Polypeptid kodierenden Segment verbunden, enthält. Expressionsvektoren können z.B. einen Replikationsursprung (origin of replication) oder eine autonom replizierende Sequenz (ARS) sowie Expressionskontrollsequenzen, einen Promotor, einen Enhancer und die notwendigen Orte für die Verarbeitung von In Formationen, wie z.B. Ribosom bindende Orte, RNS verknüpfende Orte, Polyadenylierungs-orte, transkriptionelle Terminatorsequenzen und mRNA stabilisierende Sequenzen, enthalten. Solche Vektoren können nach Standardmethoden der Rekombinationstechnik hergestellt werden, die im Stand der Technik gut bekannt sind und z.B. von Sambrook et al., 1989 oder Ausubel et al., 1992 beschrieben wurden.

Man wählt einen geeigneten Promotor und andere nötige Vektorsequenzen so aus, dass sie in der Wirtszelle funktionell sind, also arbeiten. Zu den geeigneten Vertretern können diejenigen zählen, die mit SCN5A oder HERG Genen natürlich assoziiert sind. Beispiele für geeignete, arbeitende Kombinationen von Zelllinien und Expressionsvektoren finden sich bei Sambrook et al., 1989 und Ausubel et al., 1982; siehe auch Metzger et al., 1988. Viele brauchbare Vektoren sind in der Technik bekannt und können von Anbietern, wie z.B. Stratagene, New England Biolabs, Promega, Biotech, und anderen Firmen bezogen werden. Promotoren, wie z.B. trp, lac und Phagenpromotoren, tRNS Promotoren und glykolytische Enzympromotoren, können in prokaryotischen Wirtszellen eingesetzt werden. Zu den in Hefe brauchbare Promotoren gehören Promotorregionen für Metallothionein, 3-Phosphoglyceratkinase oder andere glykolytische Enzyme, wie z.B. Enolase oder Glyceraldehyd-3-phosphodehydrogenase, für die Verwertung von Maltose und Galaktose verantwortliche Enzyme sowie andere Enzyme. Zur Verwendung bei der Expression in Hefen geeignete Vektoren und Promotoren sind weiterhin von Hitzman et al., EP 73 675A beschrieben. Zu den geeigneten nicht natürlichen Säugerpromotoren können die frühen und späten Promotoren von SV40 (Fiers et al., 1978) oder Promotoren zählen, die von dem Molony Leukämievirus der Maus, dem Tumorvirus der Maus, von Sarkomviren der Vögel, dem Adenovirus II, von dem Rinderpapillomvirus oder Polyoma abgeleitet sind. Weiterhin kann das Konstrukt mit einem amplifizierbaren Gen verbunden sein (z.B. DHFR), so dass zahlreiche Kopien des Gens hergestellt werden können. Beschreibungen für geeignete Eenhancer und andere Expressionskontrollsequenzen finden sich auch in Enhancers and Eukaryotic Gene Expression, Cold Spring Harbor Press, Cold Spring Harbor, New York (1983).

Die Expressionsvektoren können autonom replizieren oder können replizieren, indem sie in das Genom der Wirtszelle eingebaut werden, nach Methoden, die in der Technik gut bekannt sind.

Expressions- und Klonierungsvektoren enthalten wahrscheinlich einen auswählbaren Marker, ein Gen, das für ein Protein kodiert, welches für das Überleben oder das Wachstum der mit dem Vektor transformierten Wirtszelle nötig ist. Die Anwesenheit dieses Gens stellt sicher, dass nur diejenigen Wirtszellen wachsen, die diese Insertionen exprimieren. Typische Selektionsgene kodieren für Proteine, die a) Resistenz gegen Antibiotika oder andere toxische Substanzen, wie z.B. Ampicilin, Neomycin, Methotrexat usw., vermitteln, b) auxotrophe Mängel ergänzen oder c) kritische Nährstoffe liefern, die aus komplexen Medien nicht verfügbar sind, wie z.B. das für D-Alaninracemase für Bacilli kodierende Gen. Die Auswahl eines geeigneten wählbaren Markers hängt von der Wirtszelle ab, und geeignete Marker für verschiedene Wirtszellen sind in der Technik gut bekannt.

Die Vektoren, die die Nukleinsäuren von Interesse enthalten, können in vitro transskribiert werden, und die resultierende RNS kann nach gut bekannten Methoden in die Wirtszelle eingeführt werden, wie z.B. durch Injektion (siehe Kubo et al., 1988). Alternativ kann der Vektor direkt in die Wirtszellen eingeführt werden, nach Verfahren, die in der Technik gut bekannt sind und je nach der Art der Wirtszellen variieren. Zu diesen Verfahren zählen Elektroporation; Transfektion unter Verwendung von Calciumchlorid, Rubidiumchlorid, Calciumphosphat, DEAE-Dextran oder anderen Substanzen; Bombardement mit Mikroprojektilen; Lipofektion; Infektion (wobei der Vektor ein infektiöser Stoff ist, wie z.B. ein Retrovirusgenom); und andere Methoden. Siehe allgemein Sambrook et al., 1989 und Ausubel et al., 1992. Die Einführung der Polynukleotide in die Wirtszelle nach beliebigen Methoden des Standes der Technik, u.a. nach den zuvor beschriebenen Methoden, wird hierin als „Transformation" bezeichnet. Die Zellen, in die die zuvor beschriebenen Nukleinsäuren eingeführt worden sind, sollen auch die Nachkommenschaft dieser Zellen einschließen.

Große Mengen an Nukleinsäuren und Polypeptiden nach der vorliegenden Erfindung können hergestellt werden, indem man die SCN5A oder HERG Nukleinsäuren oder Teile davon in prokaryotischen oder eukaryotischen Zellen exprimiert. Die am meisten verwendeten prokaryotischen Wirtszellen sind Stämme von Escherichia coli, wenn auch andere Prokaryoten, wie z.B. Bacillus subtilis oder Pseudomonas verwendet werden können.

Säugerzellen oder andere eukaryotische Wirtszellen, wie z.B. die von Hefen, Fadenpilzen, Pflanzen, Insekten oder Amphibien oder Vogelarten, können ebenfalls für die Herstellung der Proteine nach der vorliegenden Erfindung brauchbar sein. Die Vermehrung von Säugerzellen in Kulturen ist per se gut bekannt. Siehe Jakoby und Pastan (Herausgeber) 1979. Beispiele für üblicherweise verwendete Wirtszellen von Säugern sind VERO und HeLa Zellen, Ovarialzellen von chinesischen Hamstern (CHO) sowie W138-, BHK- und COS Zelllinien, obwohl der Fachmann erkennen wird, dass auch andere Zelllinien geeignet sein können, um z.B. höhere Expressionsraten, wünschenswerte Gykolysierungsmuster oder andere Eigenschaften zu erzielen.

Klone werden ausgewählt durch Verwendung von Markern, je nach der Art der Vektorkonstruktion. Der Marker kann sich an dem selben oder an einem anderen DNS Molekül befinden, vorzugsweise an dem selben DNS Molekül. In prokaryotischen Zellen kann das transformierte Produkt beispielsweise anhand seiner Resistenz gegenüber Ampicillin, Tetracyclin oder anderen Antibiotika ausgewählt werden. Die Produktion eines besonderen Produkts kann aufgrund von dessen Temperaturempfindlichkeit ebenfalls als geeigneter Marker dienen.

Prokaryotische oder eukaryotische Zellen, die mit den Polynukleotiden nach der vorliegenden Erfindung transformiert wurden, sind nicht nur für die Herstellung der Nukleinsäuren und der Polypeptide nach der vorliegenden Erfindung brauchbar, sondern beispielsweise auch für das Studium der Charakteristika von SCN5A und HERG Polypeptiden.

Die hierin offenbarten Sonden und Primer auf der Basis von SCN5A und HERG Gensequenzen werden verwendet, um homologe SCN5A und HERG Gensequenzen und Proteine in anderen Spezies zu identifizieren. Diese Gensequenzen und Proteine werden in den hierin beschriebenen diagnostischen, prognostischen oder therapeutischen Methoden sowie für Durchmusterungen bei der Suche nach Medikamenten verwendet, und zwar für die Spezies, aus der sie isoliert wurden.

Methoden zur Verwendung: Nukleinsäurediagnose und diagnostische Kits

Um die Anwesenheit von SCN5A oder HERG Allelen zu entdecken, die ein Individuum für LQT prädisponieren, wird eine biologische Probe, wie z.B. Blut, präpariert und auf die Anwesenheit oder Abwesenheit von bestimmten SCN5A oder HERG Allelen, die ihren Träger empfänglich für LQT machen, untersucht. Um das Vorliegen von LQT zu entdecken, oder als ein prognostischer Indikator, wird eine biologische Probe präpariert und auf die Anwesenheit oder Abwesenheit von mutatnten Allelen von SCN5A und/oder HERG untersucht. Die Ergebnisse dieser Tests und interpretierende Information werden einer für die Gesundheitsfürsorge zuständigen Stelle zur Weiterleitung an die untersuchte Person mitgeteilt. Solche Diagnosen können in diagnostischen Laboratorien durchgeführt werden, oder alternativ werden diagnostische Kits hergestellt und an die für die Gesundheitsfürsorge zuständige Stelle oder an Privatpersonen zur Selbstdiagnose verkauft.

Bei der Durchmusterung werden zu Beginn die relevanten SCN5A oder HERG Sequenzen amplifiziert. Bei einer anderen bevorzugten Ausführungsform der Erfindung geht man bei der Durchmusterung nach einer Strategie ohne PCR vor. Diese Durchmusterungsmethoden schließen eine zweistufige Markeramplifizierungsmethode ein, die in der Technik gut bekannt ist. Sowohl die Methode mit als auch die ohne PCR sind bezüglich des Nachweises der Zielsequenzen sehr empfindlich.

Die populärste der gegenwärtig verwendeten Methoden ist die Amplifizierung der Zielsequenz (target amplifikation). Dabei wird die interessierende Nukleinsäuresequenz mit Polymerasen amplifiziert. Eine besonders bevorzugte, mittels Polymerasen durchgeführte Reaktion ist die Polymerasekettenraktion (PCR). Die Polymerasekettenreaktion und andere mittels Polymerasen durchgeführte Amplifizierungs-Assays können in mit Polymerasen durchgeführten Amplifizierungszyklen eine mehr als millionenfache Vermehrung der Kopienzahl erreichen. Die resultierende Nukleinsäure kann, wenn sie erst einmal amplifiziert ist, sequenziert oder als Substrat für DNS Sonden verwendet werden.

Wenn die Sonden verwendet werden, um die zu analysierende biologische Probe, wie z.B. Blut oder ein Serum, auf die Anwesenheit der Zielsequenz in hin zu untersuchen, können die Proben, falls gewünscht, behandelt werden, um die Nukleinsäuren zu extrahieren. Die Nukleinsäureprobe kann auf verschiedene Weise präpariert werden, um den Nachweis der Zielsequenz zu erleichtern, z.B. durch Denaturieren, Restriktinsverdau, Elektrophorese oder Dot Blotting. Die Zielregion des Nukleinsäureanalyten muss im allgemeinen zumindest teilweise einsträngig sein, damit eine Hybridisierung mit der Zielsequenz der Sonde stattfinden kann. Wenn die Sequenz von Natur aus einsträngig ist, braucht keine Denaturierung stattzufinden. Wenn die Sequenz jedoch doppelsträngig ist, wird es wahrscheinlich nötig sein, sie zu denaturieren. Die Denaturierung kann auf verschiedene, im Stand der Technik bekannte Art und Weise durchgeführt werden.

Der Nukleinsäureanalyt und die Sonde werden unter Bedingungen inkubiert, die die Bildung von stabilen Hybriden aus der Zielsequenz der Sonde und der vermuteten Zielsequenz in dem Analyten fördern. Die Region der Sonden, die verwendet wird, um den Analyten zu binden, kann vollständig komplementär zu der Zielregion auf den menschlichen Chromosomen 3 oder 7 konstruiert sein. Daher sind Bedingungen einer möglichst hohen Stringenz wünschenswert, um falsche Resultate zu verhindern. Bedingungen einer hohen Stringenz werden jedoch nur angewandt, wenn die Sonden komplementär zu solchen Regionen des Chromosoms sind, die einmalig in dem Genom vorkommen. Die Stringenz der Hybridisierung wird durch eine Reihe von Faktoren während der Hybridisierung und während der Waschprozedur bestimmt, einschließlich von Temperatur, Ionenstärke, Basenzusammensetzung, Länge der Sonde und Konzentration des Formamids. Diese Faktoren sind z.B. von Maniatis et al., 1982 und Sambrook et al., 1989 beschrieben. Unter bestimmten Umständen kann die Bildung von Hybriden höherer Ordnung, wie z.B. Triplexen, Quadraplexen usw., erwünscht sein, um eine Möglichkeit zum Nachweis der Zielsequenzen zu schaffen.

Der Nachweis des gegebenenfalls entstehenden Hybrids wird im allgemeinen geführt, indem man mit markierten Sonden arbeitet. Alternativ kann die Sonde nicht markiert, aber durch eine spezifische Bindung an einen markierten Liganden nachweisbar sein. Geeignete Marker und Methoden zur Markierung von Sonden und Liganden sind in der Technik bekannt und schließen beispielsweise radioaktive Marker, die nach bekannten Verfahren (z.B. Nicktranslation, statistisches Primen oder Kinasieren) eingeführt werden können, Biotin, fluoreszierende Gruppen, chemolumineszierende Gruppen (z.B. Dioxetane, besonders ausgelöste Dioxetane), Enzyme, Antikörper und ähnliche Stoffe ein. Variationen dieses grundsätzlichen Schemas sind in der Technik bekannt und schließen diejenigen Variationen ein, die die Abtrennung des Hybrids, das nachgewiesen werden soll, von den externen Materialien erleichtern und/oder das Signal von dem markierten Baustein verstärken. Eine Übersicht über eine Anzahl dieser Variationen bieten z.B. Matthews und Kricka, 1988; Landgren et al., 1988; Mittlin, 1989; U.S. Patent Nr. 4,868,105; und die EPO Publikation Nr. 225 807.

Wie zuvor bemerkt, werden auch nicht auf PCR beruhende Durchmusterungs-Assays in dieser Erfindung in Erwägung gezogen. Bei diesen Verfahren hybridisiert eine Nukleinsäuresonde (oder ein Analogon, in dem z.B. ein Methylphosphonat-Gerüst den normalen Phosphodiester ersetzt) mit der in geringer Menge vorliegenden DNS Zielsequenz. Diese Sonde kann über ein Enzym verfügen, das kovalent an sie gebunden ist, und zwar so, dass die kovalente Bindung die Spezifität der Hybridisierung nicht beeinträchtigt. Der Komplex aus dem Enzym-Sonden-Konjugat und der Nukleinsäure kann von dem freien, nicht gebundenen Konjugat aus Enzym und Sonde abgetrennt werden, und ein Substrat für den Nachweis des Enzyms wird zugesetzt. Die enzymatische Aktivität wird als Wechsel in der Farbentwicklung oder der Lumineszenzstärke wahrgenommen, was zu einer Steigerung der Empfindlichkeit um den Faktor 103 bis 106 führt. Die Herstellung von Konjugaten aus einem Oligodeoxynukleotid und alkalischer Phosphatase sowie ihre Verwendung als Hybridisierungssonden ist z.B. beschrieben von Jablonski et al., 1986.

Zweistufige Markeramplifizierungsmethoden sind in der Technik bekannt. Diese Assays arbeiten nach dem Prinzip, dass ein kleiner Ligand (wie z.B. Digoxigenin, Biotin, o.ä.) mit einer Nukleinsäuresonde verbunden wird, die spezifisch an SCN5A oder HERG zu binden vermag. Allel-spezifische Sonden werden ebenfalls als im Bereich dieses Beispiels liegend angesehen, und zu den beispielhaften Allel-spezifischen Sonden gehören Sonden, die die prädisponierenden Mutationen gemäß dieser Patentanmeldung einschließen.

In einem Beispiel wird der an die Nukleinsäuresonde gebundene kleine Ligand spezifisch von einem Konjugat aus Antikörper und Enzym erkannt. Bei einer Ausführungsform dieses Beispiels ist Digoxigenin mit der Nukleinsäuresonde verbunden. Die Hybridisierung wird durch ein Konjugat aus einem Antikörper und alkalischer Phosphatase nachgewiesen, das ein chemolumineszentes Substrat umwandelt (turn over). Für Methoden zur Markierung von Nukleinsäuresonden gemäß dieser Ausführungsform siehe Martin et al., 1990. In einem zweiten Beispiel wird der kleine Ligand von einem zweiten Konjugat aus Ligand und Enzym erkannt, das mit dem ersten Liganden einen spezifischen Komplex zu bilden vermag. Eine gut bekannte Ausführungsform dieses Beispiels sind Wechselwirkungen vom Biotin-Avidin-Typ. Methoden zur Markierung von Nukleinsäuresonden und ihre Verwendung in Assays auf Basis Biotin-Avidin sind beschrieben von Rigby et al., 1977 und Nguyen et al., 1992.

Es wird auch als im Bereich der Erfindung liegend angesehen, dass die Assays mit Nukleinsäuresonden nach dieser Erfindung mit einem Cocktail von Nukleinsäuresonden durchgeführt werden, die in der Lage sind, SCN5A und/oder HERG nachzuweisen. So wird in einem Beispiel, in dem die Anwesenheit von SCN5A oder HERG in einer Zellprobe nachgewiesen werden soll, mehr als nur eine zu dem Gen komplementäre Sonde verwendet, und insbesondere beträgt die Zahl der Sonden alternativ zwei, drei oder fünf verschiedene Sondensequenzen. In einem anderen Beispiel, in dem die Anwesenheit von Mutationen in dem SCN5A oder HERG Gen in einem Patienten nachgewiesen werden soll, wird mehr als eine zu diesen Genen komplementäre Sonde benutzt, wobei der erwähnte Cocktail Sonden enthält, die an Allel-spezifische Mutationen zu binden vermögen, welche in Populationen von Patienten mit Veränderungen in SCN5A oder HERG identifiziert wurden. Bei dieser Ausführungsform kann eine beliebe Anzahl von Sonden verwendet werden, wobei vorteilhaft Sonden einbezogen werden, die den hauptsächlichen Genmutationen Rechnung tragen, die als ein Individuum für LQT prädisponierend erkannt worden waren.

Anwendungsverfahren: Peptiddiagnose und diagnostische Kits

Das Vorliegen von LQT kann auch anhand von Veränderungen von normalen SCN5A oder HERG Polypeptiden nachgewiesen werden. Solche Veränderungen können durch Sequenzanalysen nach üblichen Techniken bestimmt werden. Vorteilhafter werden Antikörper (polyklonale oder monoklonale) eingesetzt um Unterschiede in den, oder die Abwesenheit von, SCN5A oder HERG Peptiden nachzuweisen. Techniken zur Erzeugung und Reinigung von Antikörpern sind in der Technik gut bekannt, und jede dieser Techniken kann gewählt werden, um die Präparationen zu erzeugen, die in dieser Erfindung beansprucht werden. Bei einer bevorzugten Ausführungsform der Erfindung werden SCN5A oder HERG Proteine durch Antikörper aus Lösungen immunopräzipitiert, oder die Antikörper reagieren mit den Proteinen auf Western- oder Immunoblots von Polyacrylamidgelen. Bei einer anderen bevorzugten Ausführungsform weisen Antikörper SCN5A oder HERG-Proteine in Paraffin oder gefrorenen Gewebeschnitten nach, wobei immunocytochemische Techniken angewandt werden.

Zu den bevorzugten Methoden zum Nachweis von SCN5A oder HERG oder deren Mutationen gehören mit Enzymen verbundene Immunosubstrat-Assays (ELISA), Radioimmunassays (RIA), immunoradiometrische Assays (IRMA) und immonoenzymatische Assays (IEMA) mit Einschluss von Sandwichassays unter Verwendung von monoklonalen und/oder polyklonalen Antikörpern. Beispielhafte Sandwichassays sind von David et al. in den U.S. Patenten Nrn. 4.376.110 und 4.486.530 beschrieben worden, die durch diesen Hinweis in die vorliegende Offenbarung einbezogen werden.

Anwendungsverfahren: Gentherapie

Nach der vorliegenden Erfindung wird auch ein Verfahren zur Verfügung gestellt, mittels dessen an Zellen, welche mutierte SCN5A oder HERG Gene enthalten, normale SCN5A oder HERG Funktionen übertragen werden. Eine solche Übertragung sollte dazu führen, dass die empfangenden Zellen normal funktionieren. Die Wildtyp Gene oder ein Teil dieser Gene kann in die Zelle mit Hilfe eines Vektors eingeführt werden, so dass die Gene extrachromosal bleiben. In diesem Fall wird das Gen in der Zelle von einem extrachromosomalen Lokus aus exprimiert. In höherem Maße bevorzugt wird ein Procedere, bei dem das normale Gen oder ein Teil davon in einer solchen Weise in die Zelle eingeführt wird, dass es bzw. er mit dem in der Zelle vorhandenen endogenen mutierten Gen rekombiniert. Eine solche Rekombination erfordert ein zweifaches Rekombinationsereignis und führt schließlich zur Korrektur der Genmutation. Vektoren für die Einführung von Genen (sowohl solche, die rekombinieren, als auch solche, die extrachromosomal bleiben) sind in der Technik bekannt, und jeder geeignete Vektor kann verwendet werden. Methoden zur Einführung von DNS in Zellen, wie z.B. Elektroporation, Calciumphosphat-co-präcipitation und virale Transduktion, sind ebenfalls in der Technik bekannt, und der Fachmann ist in der Lage, eine geeignete Methode auszuwählen.

Wie zuvor allgemein diskutiert wurde, können die SCN5A oder HERG Gene oder, wo anwendbar, deren Fragmente in Gentherapieverfahren verwendet werden, um die Menge der Expressionsprodukte solcher Gene in den Zellen zu erhöhen. Es kann auch zweckmäßig sein, das Ausmaß der Expression eines bestimmten LQT Gens selbst in denjenigen Herzzellen zu erhöhen, in denen das mutierte Gen in „normalen" Mengen exprimiert wird, das Genprodukt jedoch nicht voll funktionell ist.

Gentherapie würde nach allgemein akzeptierten Methoden durchgeführt werden, wie sie z.B. von Friedman, 1991, beschrieben wurden. Zellen eines Patienten würden zunächst mittels der zuvor beschriebenen Methoden analysiert, um sicherzustellen, dass in den Zellen SCN5A oder HERG produziert werden. Ein viraler oder plasmidischer Vektor (siehe die näheren Erläuterungen in der Folge) wird hergestellt, der eine Kopie des SCN5A oder HERG Gens enthält, die mit Elementen zur Expressionskontrolle verknüpft ist und innerhalb der Zellen zu replizieren vermag. Geeignete Vektoren sind bekannt, z.B. die im U.S. Patent 5,252,479 und in der veröffentlichten PCT Anmeldung WO 93/07282 beschriebenen Vektoren. Der Vektor wird dann in den Patienten injiziert. Wenn das transfizierte Gen nicht permanent in das Genom jeder der Zielzellen eingebaut wird, muss die Behandlung möglicherweise periodisch wiederholt werden.

In der Technik bekannte Gentransfersysteme können in der Praxis der Gentherapiemethoden nach der vorliegenden Erfindung brauchbar sein. Zu diesen Methoden zählen virale und nicht virale Transfermethoden. Eine Anzahl von Viren sind als Vektoren für den Gentransfer verwendet worden, einschließlich von Papovaviren (z.B. SV40, Madzak et al., 1992), Adenovirus (Berkner, 1992; Berkner et al., 1988; Gorziglia und Kapikian, 1992; Quantin et al., 1992; Rosenfeld et al., 1992; Wilkinson et al., 1992; Stratford-Perricaudet et al., 1990), Vacciniavirus (Moss 1992), mit Adeno verbundener Virus (Muzyczka, 1992; Ohi et al, 1990), Herpersviren einschließlich von HSV und EBV (Margolskee, 1992; Johnson et al., 1992; Fink et al., 1992; Breakfield und Geller, 1987; Freese et al., 1990) und Retroviren von Vögeln (Brandyopadhyay und Temin, 1984; Petropoulos et al., 1992), von Mäusen (Miller, 1992; Miller et al., 1985; Sorge et al., 1984; Mann und Baltimore, 1985, Miller et al., 1988) und von Menschen (Shimada et al., 1991; Helseth et al., 1990; Page et al., 1990; Buchschacher und Panganiban, 1992). Die meisten Protokolle von humanen Gentherapien gründeten sich auf abgeschwächte (disabled) murine Retroviren.

Zu den in der Technik bekannten nicht-viralen Methoden zum Gentranfer gehören chemische Verfahren, wie z.B. die Calciumphosphat-co-präcipitation (Graham und van der Eb, 1973; Pellicer et al., 1980); mechanische Verfahren, wie z.B. Mikroinjektion (Anderson et al., 1989; Gordon et al., 1980; Brinster et al., 1981); Constantini und Lacy, 1981), MembranFusions-vermittelter Transfer via Liposome (Felgner et al., 1987; Wang und Huang, 1987; Kaneda et al., 1989; Stewart et al., 1992; Nabel et al, 1990; Lim et al., 1992); und direkte DNS-Aufnahme sowie Rezeptor-vermittelter DNS-Transfer (Wolff et al., 1990; Wu et al., 1991; Zenke et al., 1990; Wu et al., 1989; Wolff et al., 1991; Wagner et al., 1990; Wagner et al., 1991; Cotten et al., 1990; Curiel et al., 1991a; Curiel et al., 1991b).

Bei einem Ansatz, bei dem biologische und physikalische Gentransfermethoden kombiniert werden, wird plasmidische DNS von beliebiger Größe mit einem Polylysinkonjugierten Antikörper kombiniert, der gegenüber dem Hexonprotein von Adenovirus spezifisch ist, und der resultierende Komplex wird an einen Adenovirusvektor gebunden. Der trimolekulare Komplex wird dann verwendet, um Zellen zu infizieren. Der Adenovirusvektor erlaubt eine wirksame Bindung, Einführung in die Zelle und den Abbau des Endosoms, bevor die gekuppelte DNS geschädigt wird.

Es ist gefunden worden, dass Komplexe aus Liposom und DNS in der Lage sind, einen Gentransfer direkt in vivo zu vermitteln. Während gewöhnliche Liposompräparationen beim Gentransfer nicht spezifisch sind, gibt es einen Bericht über lokalisierte in vivo-Aufnahme und Expression z.B. in Tumorzellen (deposits), beispielsweise nach direkter Behandlung in situ (Nabel, 1992).

Gentransferverfahren, bei denen die DNS direkt auf das Herzgewebe zielt, werden bevorzugt. Ein Rezeptor-vermittelter Gentransfer wird z.B. bewirkt durch die Konjugation von DNS (in der Regel in Form eines kovalent geschlossenen Plasmids in der Form eines Supercoils) mit einem Proteinliganden via Polylysin. Die Liganden werden so ausgewählt, dass sie zu den entsprechenden Rezeptoren auf der Zelloberfläche des Typs der Zielzellen bzw. des Zielgewebes passen. Diese Konjugate aus Ligand und DNS können, falls erwünscht, direkt in das Blut injiziert werden und richten sich dann auf das Zielgewebe, auf dessen Zelloberflächen eine Bindung an den Rezeptor erfolgt und der DNS Proteinkomplex in das Zellinnere gelangt. Um das Problem der intrazellulären Zerstörung der DNS zu lösen, kann man eine Co-infektion mit Adenovirus vornehmen und so die endosome Funktion abbrechen.

Die Therapie läuft wie folgt ab: Patienten mit SCN5A oder HERG Allelen, die für LQT empfänglich machen, werden mit einem Genvehikel behandelt, so dass einige oder alle ihre Herzvorläuferzellen mindestens eine zusätzliche Kopie eines normal funktionierenden SCN5A oder HERG Allels erhalten. Nach diesem Schritt haben die behandelten Individuen ein vermindertes Risiko für LQT in dem Maße, in dem die Wirkung des für LQT empfänglich machenden Allels durch die Anwesenheit des normalen Allels aufgehoben wird.

Anwendungsverfahren: Transformierte Wirtszellen

Tiere zur Prüfung von therapeutischen Wirkstoffen können nach Mutagenese ganzer Tiere oder nach Behandlung von Keimbahnzellen oder Zygoten ausgewählt werden. Zu derartigen Behandlungen gehört die Einführung von mutierten SCN5A oder HERG Allelen, üblicherweise von einer zweiten Tierspezies, und ebenso die Einführung von unterbrochenen homologen Genen. Alternativ können die endogenen SCN5A oder HERG Gene der Tiere durch Mutationen erzeugende Insertionen oder Deletionen oder durch andere genetische Veränderungen mittels üblicher Techniken unterbrochen werden (Capecchi et al., 1989; Valancius und Smithies, 1991; Hasty et al., 1991; Shinkai et al., 1992; Mombaerts et al., 1992; Philport et al., 1992; Snouwwaert et al., 1992; Donehower et al., 1992). Nachdem den Tieren die zu testenden Substanzen zugeführt worden sind, muss geprüft werden ob LQT vorliegt. Wenn die Testsubstanz verhindert, dass LQT auftritt, oder LQT unterdrückt, ist sie ein Kandidat für einen therapeutischen Wirkstoff zur Behandlung von LQT. Diese Tiermodelle stellen ein außerordentlich wichtiges Hilfsmittel für die Prüfung von potentiellen therapeutischen Wirkstoffen dar.

Methoden zur Verhinderung von LOT und Torsade de Pointes

Es gibt verschiedene Wege, auf denen sich LQT entwickelt. Mutationen in spezifischen Genen, d.h. in HERG und SCN5A, können LQT auslösen. Eine Behandlung mit einer Anzahl verschiedener Arzneimittel kann ebenfalls zu LQT führen. Zu diesen Arzneimitteln zählen solche, die zur Behandlung von Herzarrhythmien verwendet werden, darunter Antihistamine, und einige Antibiotika, wie z.B. Erythromycin. Unabhängig davon ob das LQT das Ergebnis von Mutationen (erbliches oder familäres LQT) oder durch Arzneimittel induziert wurde (erworbenes LQT), geht es auf eine Einwirkung auf einen Ionenkanal zurück. Die Arzneimittel treten in Wechselwirkung mit dem K+-Kanal IKr, für dessen hauptsächliche Untereinheit HERG kodiert, wodurch der K+-Fluss in Herzzellen beeinflusst wird. Mutationen in HERG können auch den K+-Fluss durch diesen Kanal beeinflussen. Dies kann zu zu einem verlängerten QT-Syndrom führen und Torsades de pointes auslösen. Es ist gefunden worden, dass eine Erhöhung des extrazellulären K+-Spiegels zu einem Anstieg des auswärts gerichteten HERG Stromes führt. Dies ist ein paradoxer Befund, weil eine Erhöhung des extrazellulären K+-Spiegels die chemische Antriebskraft für den auswärts gerichteten K+-Strom herabsetzt. Man hätte daher einer geringeren, und keinen erhöhten auswärts gerichteten Strom erwarten sollen. Diese Beobachtung führt zu dem Schluss, dass extrazelluläres K+ diesen K+-Kanal aktiviert. Diese Aktivierung kann LQT verhindern, das sich anderenfalls als Ergebnis einer zumindest teilweisen Inaktivierung infolge einer Mutation in HERG oder als Resultat einer Behandlung mit einem Medikament einstellen würde. Eine normale extrazelluläre K+-Konzentration im Menschen, wie man sie im Serum misst, liegt im Bereich von 3,5 bis 4,5 mM. Werte im Bereich von 3 bis 5 mM werden häufig beobachtet, weniger häufig werden Werte in den Bereichen von 2 bis 3 oder 5 bis 7 gemessen. Gelegentlich findet man Werte von weniger als 2 mM oder höher als 7 mM. Es wurde gefunden, dass der HERG Strom bei einer extrazellulären K+-Konzentration von 5 mM um 40% stärker ist als der Strom bei 2 mM. Eine Potenzerhöhung dieses Kanals durch erhöhte extrazelluläre K+Spiegel ist von Nutzen. Während schneller Herzfrequenzen oder Ischämie reichert sich K+ in intrazellulären Spalten an. Eine Erhöhung des extrazellulären K+-Spiegels sollte den auswärts gerichteten Strom verstärken, wodurch diese intrazelluläre Akkumulation zurückgedrängt würde. Die Überwachung des extrazellulären K+-Spiegels in Personen mit ererbtem LQT oder in Personen, die sich einer Medikation unterziehen, die erworbenes LQT auslösen kann, versetzt den Arzt in die Lage, Patienten mit einem K+-Spiegel, der niedriger als normal oder auch (nur) normal ist, zusätzliches K+ zu verschreiben. Durch Erhöhung des extrazellulären K+-Spiegels zumindest auf die normale Höhe von 3,5 bis 4,5 mM, vorteilhaft auf übernormale Werte von 4,5 bis 5,5 mM und insbesondere auf Werte von etwa 5 mM wird die Entwicklung von LQT und/oder Torsades de pointes verhindert. Dieses neue Wissen über die Ursachen von LQT wird zu einem Regime führen, bei dem man vorsorglich den extrazellulären K+-Spiegel von Patienten überwacht, die ein Risiko für die Entwicklung von LQT tragen, sei es ein erbliches oder sei es ein erworbenes Risiko, und den Patienten mit niedrigem oder auch nur normalem extrazellulärem K+-Spiegel K+ verabreicht. Eine solche Behandlung wird dazu führen, dass LQT und/oder Torsades de pointes sich nicht entwickeln.

Zwei Strategien sind hierin angewandt worden, um LQT Gene zu identifizieren, ein Kandidaten-Gen-Ansatz und positionelles Klonieren. Informationen über die Lage von drei LQT Loci sind jetzt verfügbar, wobei LQT1 auf dem Chromosom 11p15.5 (Keating et al., 1991a; Keating et al., 1991b), LQT2 auf dem Chromosom 7q35-36 und LQT3 auf dem Chromosom 3p21-24 (Jiang et al., 1994) kartiert ist. Der Kandidaten Gen Ansatz gründet sich auf wahrscheinliche, mechanistische Hypothesen auf phyiologischer Grundlage. Wenn auch über die Physiologie von LQT wenig bekannt ist, so ist die Krankheit doch verbunden mit einer Verlängerung des QT Intervalls im Elektrokardiogramm, einem Anzeichen von anomaler Repolarisation des Herzens. Dieser Zusammenhang legt nahe, dass für Ionenkanäle kodierende Gene oder ihre Modulatoren als Kandidaten für LQT in Betracht kommen. Diese Hypothese wird nun gestützt durch die Entdeckung, dass das mit dem Chromosom 7 zusammenhängende LQT von Mutationen in HERG herrührt, einem Gen für einen Kaliumkanal des Herzens. Ein neuroendokrines Calciumkanal-Gen (CACNLIA2; Chin et al., 1991; Seino et al., 1992) und ein Gen, das für ein GTP bindendes Protein kodiert, welches Kaliumkanäle moduliert (GNAI2; Weinstein et al., 1988; Magovcevic et al., 1992) wurden auf Grund ihrer chromosomalen Positionierung Kandidaten für LQT3. Nachfolgende Linkage-Analysen haben diese Gene jedoch ausgeschlossen (Wang und Keating, unveröffentlichte Daten).

In der Theorie könnten Mutationen in einem Natriumkanal Gen des Herzens LQT verursachen. Spannungs-gesteuerte Natriumkanäle vermitteln eine rasche Depolarisierung in ventrikulären Myocyten und leiten einen schwachen Strom während der Plateauphase des Aktionspotentials (Attwell et al., 1979). Subtile Anomalien der Natriumkanalfunktion (d.h. verzögerte Inaktivierung des Kanals oder veränderte Spannungsabhängigkeit der Inaktivierung des Kanals) könnten die Repolarisation des Herzens verzögern, wodurch eine verlängerte QT Periode und Herzarrhythmien ausgelöst werden. In 1992 klonierten und charakterisierten Gellens und Kollegen ein Natriumkanal-Gen des Herzens, SCN5A (Gellens et al., 1992). Die Struktur dieses Gens war der von Genen ähnlich, die für andere, früher charakterisierte Natriumkanäle kodieren; es kodiert für ein großes Protein mit 2016 Aminosäuren. Diese Kanalproteine enthalten vier homologe Domänen (DI bis DIV), von denen jede sechs vermutlich Membran spannende Segmente enthält (S1-S6). SCN5A wurde kürzlich auf dem Chromosom 3p21 kartiert, wodurch es zu einem ausgezeichneten Kandidaten für LQT3 wird (George et al., 1995).

Die gegenwärtige Erfindung hat genotypische Analysen verwendet, um zu zeigen, dass SCN5A in drei nicht verwandten Familien eng mit LQT3 verbunden ist (Einzelheiten finden sich in den Beispielen). Die selbe Deletion innerhalb von SCN5A findet sich in den betroffenen Mitgliedern von zwei dieser Familien. Beide Familien sind nordamerikanisch und von europäischer Abstammung, die eine deutsch, die andere englisch. Eine Recherche in einer genealogischen Datenbank über mehr als acht Generationen ergab keine Verwandtschaft zwischen den beiden. Weiterhin zeigten genotypische Analysen dieser Sippen, dass unterschiedliche Haplotypen auf den Krankheitschromosomen vorlagen, wie aus 1 hervorgeht. Somit ist es unwahrscheinlich, dass diese Familien verwandt sind. Die erwähnte Deletion betrifft neun Basenpaare und führt zu einer Deletion im Protein von drei Aminosäuren, K1505-P1506-Q1507 (KPQ) in dem cytoplasmatischen Linker zwischen DIII und DIV. Diese Deletionen unterbrachen Sequenzen innerhalb einer Region, von der bekannt ist, dass sie für die Inaktivierung von Natriumkanälen von Bedeutung ist, was einen wahrscheinlich zellulären Mechanismus für mit dem Chromosom 3 verknüpftes LQT nahe legt.

Es gibt weitere Gründe dafür, dass SCN5A eine Rolle bei der Pathogenese von LQT spielt. Beispielsweise legen pharmakologische Daten nahe, dass eine anomale Funktion von Natriumkanälen des Herzens LQT verursachen könnte. Toxine und Medikamente, die die Geschwindigkeit der Inaktivierung der Natriumkanäle herabsetzen oder die Spannungsabhängigkeit der Kanalaktivierung oder -inaktivierung verändern, können die Dauer des Aktionspotentials des Herzens verlängern und Herzarrhythmien verursachen (Honerjager, 1982). Molekulargenetische Studien weisen ebenfalls auf eine Verbindung zwischen der Inaktivierung von Natriumkanälen und klinischen elektrophysiologischen Anomalien hin. Untersuchungen von hyperkalemischer periodischer Paralyse und Paramyotonia congenita zeigen an, dass Mis-sensemutationen in dem Gen, das für Natriumkanäle in Skelettmuskeln kodiert (SCN4A), Myotonie verursacht (Fontaine et al., 1990; Ptacek et al., 1991, 1882; Rojas et al., 1991; MacClatchey et al., 1992b, 1992c; Ebers et al., 1991; Rudolph et al., 1992; Lerche et al., 1993). Physiologische Studien zeigen, dass diese Mutationen die Inaktivierung der Natriumkanäle beeinflussen, was zu repetetiven Depolarisationen führt, was wiederum mit dem myotonischen Phänotypus übereinstimmt (Yang et al., 1994). Aus Analogiegründen könnten ähnliche Mutationen in dem Natriumkanal-Gen des Herzens einen Phänotypus wie LQT verursachen.

Die Mutationen in HERG, einem Kaliumkanal Gen des Herzens, verursachen die mit dem Chromosom 7 verbundene Form von erblichem LQT (Einzelheiten werden in den Beispielen gegeben). Die in HERG identifizierten Mutationen und die Biophysik von alpha-Untereinheiten von Kaliumkanälen legen nahe, dass mit dem Chromosom 7 verbundenes erbliches LQT durch dominant-negative Mutationen und eine daraus resultierende Reduktion von funktionellen Kanälen ausgelöst wird. Im Gegensatz dazu führen bei mit dem Chromosom 3 verbundenem LQT die mit LQT zusammenhängenden Deletionen, die in SCN5A identifiziert wurden, wahrscheinlich zu funktionellen Natriumkanälen des Herzens mit veränderten Eigenschaften, wie z.B. einer verzögerten Inaktivierung oder einer veränderten Spannungsabhängigkeit der Kanalinaktivierung. Eine verzögerte Inaktivierung eines Natriumkanals würde den einwärts gerichteten Strom des Natriums verstärken, wodurch die Membran depolarisiert wird. Diese Wirkung ist ähnlich wie die des veränderten Membranpotentials, das von HERG Mutationen zu erwarten ist, wobei der auswärts gerichtete Strom des Kaliums herabgesetzt wird. Es ist unwahrscheinlich, dass schädlichere Mutationen von SCN5A LQT nach sich ziehen würden. Man würde beispielsweise erwarten, dass eine Verminderung der Gesamtzahl der Natriumkanäle des Herzens die Dauer des Aktionspotentials herabsetzen würde, ein Phänotypus, der dem des LQT entgegengesetzt ist. Die vorliegende Erfindung beschreibt Mutationen, die Deletionen von drei Aminosäuren, KPQ, in dem cytoplasmatischen Linker zwischen DIII und DIV verursachen. Die KPQ-Sequenz ist hoch konserviert, was das Vorliegen eines genetischen Drucks auf die Konservierung hin während der Evolution vermuten lässt (2). Die cytoplasmatische Peptidsequenz, die DIII und DIV verbindet, ist die Region, die für die schnelle Inaktivierung verantwortlich ist (West et al., 1992). Eine heterologe Expression von neuronalen Natriumkanälen in Form von zwei Polypeptiden, denen dieser Linker zwischen DIII und DIV fehlt, führt zu einem Natriumstrom mit stark verlangsamter Inaktivierung (Stuhmer et al., 1989). Ortsspezifische Untersuchungen zur Mutagenese in dieser Region in SCN4A haben sich auf ein anderes Aminosäuretriplett gerichtet, I1488-F1489-M1490 (IFM). Mutationen dieser Aminosäuren zu Glutamin-Bausteinen eliminieren die schnelle Inaktivierung des Natriumkanals, lassen jedoch die langsame Inaktivierung intakt (West et al., 1992). Es wird interessant sein herauszufinden, ob die KPQ Deletion einen ähnlichen Effekt auf die Inaktivierung der Natriumkanäle des Herzens haben wird.

Die Daten lassn einen wahrscheinlich zellulären Mechanismus für mit dem Chromosom 3 verbundenes LQT vorhersagen. Eine verzögerte Inaktivierung myozellulärer Natriumkanäle würde die Dauer des Aktionspotentials und des QT Intervalls verlängern. Eine übermäßige Verlängerung könnte zu einer Reaktivierung von Calcium- oder Natriumkanälen vom L-Typ führen, was eine sekundäre Depolarisation auslösen würde, ein wahrscheinlicher Mechanismus von Torsades de pointes (Antzelevich und Sicouri, 1994).

Noch keine Mutation des SCN5A Gens wurde in der Sippe 2171 festgestellt, der dritten Sippe, in der mit Chromosom 3 verbundenes LQT aufgetreten ist. Wenn auch der Phänotypus der Krankheit in dieser Sippe für eine Verbindung mit SCN5A spricht, so haben doch SSCP Analysen von Sequenzen, die für die vermutliche Inaktivierungsregion kodieren, keine Deletionen oder andere Anomalien gezeigt. Vermutlich resultiert die Krankheit in dieser Familie aus Mutationen von SCN5A in einer anderen Region dieses Gens von etwa 35 kb. Mutationsanalysen in Familien mit hyperkaliämischer periodischer Paralyse und angeborener Paramyotonie haben mehrere andere Regionen von SCN5A nachgewiesen, die für die Kanalinaktivierung wichtig sind (Fontane et al., 1991; Ptacek et al., 1991; Rojas et al., 1991; McClatcheey et al, 1992b, 1992c; Ebers et al., 1991; Rudolph et al., 1992; Lerche et l., 1993).

Wenn auch die Sippen 2321 und 2322 anscheinend nicht miteinander verwandt sind, hatten doch beide die selbe KPQ Deletion. Der Haplotypus des betroffenen Chromosoms war in den beiden Familien verschieden, aber das schließt die Möglichkeit einer entfernten Verwandtschaft nicht aus. Weitere genotypische Analysen von Sequenzen in der Nähe von SCN5A können helfen zu entscheiden, ob diese Deletionen getrennt oder in einem einzelnen Vorfahren aufgetreten sind.

Die präsymptomatische Diagnose von LQT hat sich auf verlängerte QT Intervalle in Elektrokardiogrammen gestützt. Unglücklicherweise werden Untersuchungen mittels Elektrokardiogrammen an jungen, gesunden Personen nur selten durchgeführt. Weiterhin haben viele Träger von LQT Genen relativ normale QT Intervalle, und das erste Anzeichen der Krankheit kann eine fatale Herzarrhythmie sein (Voncent et al., 1992). Da nunmehr zwei LQT Gene identifiziert worden sind, kann ein genetischer Test auf diese Störung in Erwägung gezogen werden. Dies wird fortgesetzte Mutationsanalysen und die Identifizierung weiterer LQT Gene erfordern. Durch detailliertere phänotypische Analysen könnten Unterschiede in den verschiedenen Formen von LQT entdeckt werden. Diese Differenzen können nützlich für die Diagnose und die Behandlung sein.

Die Entdeckung des Zusammenhangs zwischen Mutationen der SCN5A und HERG-Gene und erblichem LQT erlaubt ein frühes, präsymptomatisches Durchmustern von Personen, um diejenigen zu identifizieren, die ein Risiko für die Entwicklung von LQT tragen. Um solche Individuen zu identifizieren, werden SCN5A und HERG Allele auf Mutationen hin durchmustert, entweder direkt oder nach Klonierung der Allele. Die Allele werden auf das Vorliegen von Unterschieden in der Nukleinsäuresequenz im Vergleich zu normalen Allelen untersucht. Dies kann mittels jeder geeigneten Methode geschehen, zu denen, wenn auch nicht ausschließlich, die folgenden zählen: Fluorescente in situ Hybridisierung (FISH), direkte Sequenzierung der DNS, PFGE Analyse, Southern Blot Analyse, einsträngige Konformationsanalyse (SSCP), Linkage-Analyse, RNase Protektionsassay, Allel-spezifische Oligonukleotid (ASO) Dot Blot Analyse und PCR-SSCP Analyse. Beispielsweise werden entweder (1) die Nukleotidsequenzen sowohl der klonierten Allele als auch des normalen Gens oder entsprechender Fragmente (kodierende Sequenzen oder genomische Sequenzen) bestimmt und miteinander verglichen oder (2) es werden die RNA Transkripte des SCN5A Gens oder von Genfragmenten mit einer einsträngigen vollständigen genomischen DNS von einem zu untersuchenden Individuum hybridisiert und der resultierende Heteroduplex mit Ribonuklease A (RNaseA) behandelt und auf ein denaturierendem Gel aufgebracht, um die Position eventueller Mismatche zu entdecken. Zwei dieser Methoden können nach den folgenden Verfahren durchgeführt werden.

Die Allele der SCN5A oder HERG Gene des zu untersuchenden Individuum werden mittels üblicher Techniken kloniert. Beispielsweise wird dem Individuum eine Blutprobe entnommen. Die aus den Zellen dieser Probe isolierte DNS wird teilweise bis zu einer durchschnittlichen Fragmentgröße von etwa 20 kb verdaut. Fragmente im Größenbereich von 18 bis 21 kb werden isoliert. Diese Fragmente werden in einen geeigneten Vektor ligiert. Die Sequenzen der Klone werden dann bestimmt und mit denen des normalen SCN5A Gens verglichen.

Alternativ werden Polymerasekettenreaktionen (PCRs) durchgeführt, mit Primerpaaren für die 5'-Region oder die Exons des normalen SCN5A oder HERG Gens. Beispielsweise können Primerpaare für eines der Introns hergestellt und verwendet werden. Schließlich kann eine PCR auch mit mRNS durchgeführt werden. Die amplifizierten Produkte können dann nach üblichen Methoden mittels Einstrang-Konformationspolymorphismus (SSCP) untersucht werden, um etwaige Unterschiede zu entdecken, und diese werden dann sequenziert und mit der normalen Gensequenz verglichen.

Individuen können schnell auf Varianten des normalen SCN5A oder HERG Gens hin durchmustert werden, indem man die DNS der Individuen unter Verwendung eines geeigneten Primerpaars amplifiziert und das amplifizierte Produkt analysiert, z.B. durch Dot Blot Hybridisierung unter Verwendung von Allel-spezifischen Oligonukleotidsonden.

Bei der zweiten Methode wird RNase verwendet, die bei der Identifizierung von Unterschieden zwischen den normalen SCN5A oder HERG Genen hilfreich ist. Dieser Vergleich wird in Schritten durchgeführt, in denen man kleine Restriktionsfragmente (–500 Basenpaaren) des SCN5A oder HERG Gens als Sonde verwendet. Zuerst wird das SCN5A oder HERG Gen mit einem oder mehreren Restriktionsenzymen verdaut, das bzw. die die Gensequenz in Fragmente von etwa 500 bp zerlegt bzw. zerlegen. Diese Fragmente werden dann auf einem Elektrophoresegel getrennt, von dem Gel gereinigt und in beiden Orientierungen individuell in einen SP6-Vektor (z.B. pSP64 oder pSP65) kloniert. Die Plasmide auf Basis von SP6, die Genfragmente von SCN5A oder HERG als Insertionen enthalten, werden nach Methoden, die in der Technik gut bekannt sind, unter Verwendung des SP6-Transkriptionssystems an vitro transkribiert, und zwar in Gegenwart von [&agr;-32P]GTP, wodurch radioaktiv markierte RNS-Transkripte beider Stränge des Gens entstehen.

Diese RNS-Transkripte werden individuell dazu verwendet, nach üblichen Methoden Heteroduplexe mit der allelischen DNS herzustellen. Mismatche, die in dem RNS:DNS-Heteroduplex infolge von Sequenzunterschieden zwischen dem SCN5A oder HERG Fragment und dem SCN5A oder HERG Allelsubklon aus dem Individuum vorkommen, führen bei Behandlung des Duplex mit RNase zu einer Spaltung des RNS Stranges. Solche Mismatche können das Ergebnis einer Punktmutation oder kleiner Deletionen in dem Allel des Individuums sein. Die Spaltung des RNS Stranges führt zu zwei oder mehr kleinen RNS Fragmenten, die auf dem denaturierenden Gel schneller laufen als die RNS-Sonde selbst.

Etwa gefundene Unterschiede beweisen, dass das Individuum eine molekulare Variante des SCN5A oder HERG Gens trägt und folglich ein verlängertes QT-Syndrom vorliegt. Diese Variante kann in einer Reihe von Formen auftreten. Die ernstesten Formen sind Verschiebungen des Leserasters oder große Deletionen, die ein Gen zur Kodierung eines anomalen Proteins veranlassen oder zu einer signifikant veränderten Genexpression führen würden. Zu den weniger ernsten unterbrechenden Mutationen würden kleine Deletionen im Leseraster und Substitutionen von nicht konservierenden Basenpaaren zählen, die eine signifikante Auswirkung auf das produzierte Protein haben würden, wie z.B. Veränderungen, die ein Cystein einführen oder entfernen würden, Austausch einer basischen gegen eine saure Aminosäure oder umgekehrt, Austausch einer hydrophoben gegen eine hydrophile Aminosäure oder umgekehrt oder andere Mutationen, die die sekundäre oder tertiäre Proteinstruktur beeinflussen würden. Von „Silent- Mutations" oder solchen, die Substitutionen von konservativen Aminosäuren bewirken würden, würde man im allgemeinen nicht erwarten, dass sie die Funktion des Proteins stören.

Genetische Tests werden den praktischen Arzt in die Lage versetzen, Individuen, die ein Risiko von erblichem LQT tragen, schon bei der Geburt oder sogar davor zu identifizieren. Eine vorsymptomatische Diagnose von LQT wird eine Prävention gegenüber dieser Krankheit möglich machen. Existierende medizinische Therapien, mit Einschluss von adrenergischen Blockern, können das Auftreten von Problemen, die mit dieser Krankheit verbunden sind, verhindern oder verzögern. Schließlich verändert diese Erfindung unser Verständnis von der Ursache und der Behandlung von häufigen Herzerkrankungen, wie Herzrhythmusstörungen, die für 11 % aller natürlichen Todesfälle verantwortlich sind. Die bisherige Diagnose hat sich auf die Messung der QT Intervalle von Elektrokardiogrammen konzentriert. Diese Methode ist kein völlig korrekter Indikator für das Vorliegen eines verlängerten QT-Syndroms. Die vorliegende Erfindung ist ein genauerer Indikator für das Vorliegen dieser Krankheit.

Der Zusammenhang zwischen HERG und erworbenem LOT

HERG kodiert für einen K+-Kanal mit einwärts gerichteten Rektifikationseigenschaften, ähnlich wie IKr. Ein cDNS Klon von HERG wurde in voller Länge kloniert, um die physiologischen Eigenschaften von HERG zu bestimmen. Dieser Klon wurde für die Expression in Oocyten von Xenopus präpariert. Die Charakteristika des exprimierten Kanals wurden in Oocyten zwei bis sechs Tage nach der Injektion von cRNS bestimmt, wobei eine übliche Voltage-Clamp-Technik mit zwei Mikroskopen angewandt wurde. HERG Strom wurde aktiviert als Reaktion auf Testpotentiale von > –50 mV. Die Stromstärke des HERG Stromes stieg progressiv mit dem Anstieg des Testpotentiale bis auf –10 mV an (3A) und nahm dann progressiv ab mit dem weiteren Anstieg des Testpotentials auf 0 und >0 mV (3B). Die Deaktivierung des Tailcurrent wurde abgeschätzt, nachdem die Membran auf das Haltepotential von –70 mV zurückgekehrt war. Die Amplitude des Tailcurrent stieg nach der Depolarisierung progressiv an und erreichte einen Endwert bei +10 mV. Die Beziehung zwischen HERG Strom und Spannung (I-V-Beziehung), die in 10 Oocyten bestimmt wurde, ist in 3C dargestellt. Der Spitzenwert des auswärts gerichteten Stromes nahm mit inkrementeller Depolarisation ab, was anzeigt, dass HERG ein einwärts gerichteter Rektifizierer ist. Die Spannungsabhängigkeit der Kanalaktivierung wurde abgeschätzt, indem die relativen Amplituden der Tailcurrents als Funktion des Testpotentials aufgetragen wurden (3D). HERG erreichte die halbe maximale Aktivierung bei einem Potential von –15,1 mV. Diese Daten definieren HERG als Gen für einen verzögerten gleichrichtenden K+-Kanal mit einer Spannungsabhängigkeit der Aktivierung und gleichrichtenden Eigenschaften, die mit IKr nahezu identisch sind (Sanguinetti und Jurkiewicz, 1990; Shibasaki, 1987; Yang et al., 1994). Diese Eigenschaften unterscheiden sich von denen aller anderen Herzströme.

Um HERG weiter zu charakterisieren, wurde der zeitliche Verlauf der Stromaktivierung und Deaktivierung bestimmt. Der zeitliche Verlauf für das Einsetzen des Stromflusses (Aktivierung) wurde bestmöglich an eine einzelne Exponentialfunktion angepasst (4A). Die Geschwindigkeit der Aktivierung stieg mit inkrementellen Veränderungen der Testpotentiale von –40 bis +50 mV an. Deaktivierende Ströme wurden bestmöglich an eine biexponentielle Funktion (4B) angepasst, ähnlich wie IKr (Chinn, 1993; Yang et al., 1994). Die Zeitkonstanten für die Aktivierung des HERG Stromes und die schnelle Phase der Deaktivierung waren eine glockenförmige Funktion des Testpotentials (4C). Die relative Amplitude der schnellen Komponente der Deaktivierung variierte von 0,77 bei –30 mV bis 0,2 bei –120 mV (4D). Die Kinetik des HERG Stromes ist langsamer als die von IKr (Sanguinetti und Jurkiewicz 1990; Shibasaki, 1987; Yang et al., 1994), zeigt jedoch eine identische Spannungsabhängigkeit.

HERG Strom wird durch extrazelluläres K+ aktiviert. Die K+-Selektivität von HERG wurde bestimmt, indem das Umkehrpotential von Strömen in Oocyten gemessen wurde, die in ND96 Lösungen mit verschiedenen Konzentrationen von KCl (0,5 bis 20 mM) getaucht wurden. Die Tailcurrents wurden bei einem variablen Testpotential bis zu +20 mV gemessen, nachdem der Strom durch einen Impuls aktiviert worden war (5A und 5B). Die Spannung, bei der sich die Stromrichtung von einem einwärts gerichteten in einen auswärts gerichteten Strom umkehrte, wurde als das Umkehrpotential, Erev, definiert. Es variierte mit der extrazellulären K+-Konzentration ([K+]e), wie nach der Nernst-Gleichung für [K+]e gleich oder größer als 5 mM zu erwarten war (eine Veränderung von 58 mV für einen 10fachen Anstieg von [K+]e). Erev variierte über den gesamten Bereich von [K+]e auf eine Weise, die durch die Stromgleichung von Goldman-Hodgkin-Katz gut beschrieben wird (5C). Diese Daten zeigen an, dass HERG für K+ gegenüber Na+ um den Faktor 143 selektiv permeabel ist.

Ein charakteristisches Merkmal von IKr des Herzens ist seine Modulation durch [K+]e (Sanguinetti und Jurkiewicz, 1992). Der Effekt von [K+]e für die Stärke des HERG Stromes ist in den 6A bis 6C dargestellt. Der HERG Strom stieg direkt ptoportional zu [K+]e an, obwohl sich die Form der I-V-Beziehung nicht änderte (6D). Die Abhängigkeit des HERG Stromes von [K+]e wurde bestimmt, indem man die Spitzenwerte des auswärts gerichteten Stromes bei +20 mV in Oocyten verglich, die in eine Lösung getaucht wurden, die 0,5 bis 20 mM KCl enthielt. In diesem Konzentrationsbereich variierte die Amplitude des HERG Stromes als eine lineare Funktion von [K+]e (6E). Anders als bei den meisten anderen K+-Strömen nimmt die Stärke des auswärts gerichteten HERG Stromes paradoxerweise ab, wenn man extrazelluläres K+ entfernt.

Die Rektifikation des HERG Stromes resultiert aus einer schnellen Kanalinaktivierung. Eine Hypothese besagt, dass eine einwärts gerichtete Rektifikation von IKr von einer spannungsabhängigen Inaktivierung herrührt, die schneller verläuft als die Aktivierung (Sanguinetti und Jurkiewicz, 1990; Shibasaki, 1987). Das Nettoergebnis dieser konkurrierenden Prozesse ist eine verminderte Stromstärke im Vergleich zu der Stromstärke, die aufgrund der Variablen der Aktivierung im stationären Zustand und der elektrochemischen Triebkraft für den auswärts gerichteten K+-Strom vorhergesagt wird. Es wird angenommen, dass die Spitzenwerte der Endströme nach starken Depolarisationen keine ähnliche Rektifikation zeigen (siehe 3), weil die Kanäle sich von einer schnellen Inaktivierung viel schneller erholen als der Zeitablauf der Deaktivierung. Wenn diese Interpretation korrekt ist, sollte es möglich sein, den Zeitablauf der Erholung von einer schnellen Inaktivierung während des Einsetzens des Tailcurrent zu messen. 7 zeigt die Resultate dieses Experiments. Die Tailcurrents wurden bei verschiedenen Testpotentialen aufgezeichnet, wobei jedem Potential ein Impuls auf +40 mV vorherging (7A). Die Spannungsabhängigkeit der Zeitkonstanten für die Erholung von der schnellen Inaktivierung ist in 7B aufgetragen. Die Erholung war am langsamsten bei –30 mV (t = 18,6 msec) und wurde schneller bei stufenweiser Steigerung oder Absenkung des Testpotentials. Die glockenförmige Beziehung zwischen der Zeitkonstanten für die Erholung von der Inaktivierung und dem Membranpotential hat bei derselben Spannung (–30 mV) einen Spitzenwert wie die Beziehung, die die Spannungsabhängigkeit der Aktivierung und Deaktivierung des HERG Stromes beschreibt 4C). Obwohl der Beginn der schnellen Inaktivierung nicht quantifiziert werden konnte (weil diese viel schneller geschah als die Aktivierung), ist es doch wahrscheinlich, dass der absteigende Ast der Kurve in 6B (von –20 bis +20 mV) auch die Spannungsabhängigkeit der schnellen Inaktivierung beschreibt. Diese Daten zeigen, dass die einwärts gerichtete Rektifikation des HERG Stromes aus einem Inaktivierungsprozess herrührt, der viel schneller ist als der zeitliche Verlauf der Aktivierung.

Die Spannungsabhängigkeit der Kanalrektifikation wurde durch einen Vergleich der voll aktivierten I-V-Beziehung für den HERG Strom (7C) mit der I-V-Beziehung ermittelt, die für einen Ohmschen Leiter zu erwarten war. Die gestrichelte Linie in 7C wurde von einem linearen Abschnitt der Stromamplituden extrapoliert, die zwischen –90 und –120 mV gemessen wurden, und beschreibt die I-V-Beziehung, wie sie sich bei Abwesenheit von einwärts gerichteter Rektifikation (Ohmsche Leitung) darstellen würde. Die Neigung dieser Linie definierte die maximale Leitfähigkeit von HERG in diesem Oocyten (118&mgr;S), und wurde verwendet, um die Spannungsabhängigkeit der Kanalrektifikation zu berechnen (7D). Die Rektifikation hatte den halben Maximalwert bei –49 mV, und die Beziehung hatte einen Neigungsfaktor von 28 mV. Der Halbpunkt war sehr ähnlich, wie für IKr in Knotenzellen des Kaninchens beschrieben, und der Neigungsfaktor war nahezu identisch mit IKr in Oocyten von Meerschweinchen (Tabelle 1).

Der HERG Strom im stationären Zustand kann bei jedem gegebenen Testpotential (Vt) wie folgt definiert werden: IHERG = G·n·R·(Vt – Erev), wobei G den maximalen elektrischen Leitwert (conductance) des HERG Stromes; n die Aktivierungsvariable; R die Rektifikationsvariable; und Erev das Umkehrpotential bedeuten.

Der HERG Strom wird durch Lanthan und Kobalt blockiert, aber nicht durch Methansulfonanilide oder cyclische Nukleotide beeinflusst. IKr von Herzmyozyten wird durch 10 bis 100 &mgr;M Lanthan (La3+), 2 &mgr;M Co (Co2+) (Baiser et al., 1990; Sanguinetti und Jurkiewicz, 1990) sowie durch nM-Konzentrationen von verschiedenen Antiarrhythmika auf Basis von Methansulfonaniliden, wie z.B. E-4031 (Sanguinetti und Jurkiewicz, 1990) und MK-499 (Lynch et al., 1994) blockiert. Es wurde untersucht, ob HERG Strom ebenfalls durch diese Kationen und Wirkstoffe blockiert wird. Bei einem Testpotential von 0 mV redizierten 10 &mgr;M La3+ den HERG Strom um 92±3% (n = 4; 8). Zumindest ein Teil der blockierenden Wirkung von La3+ resultierte aus dem Screening der negativen Ladungen auf der Membranoberfläche (Sanguinetti und Jurkiewicz, 1990), wie durch die positive Verschiebung um 40 mV sowohl des Spitzenwerts der I-V-Beziehung (8C) als auch der isochronalen Aktivierungskurve (8D) angezeigt wurde. HERG wurde auch z.T. blockiert (52%) durch 2 mM Co2+ (n = 2). Jedoch blockierten weder E-4031 noch MK-499 bei einer Konzentration von 1 &mgr;M den HERG Strom, selbst nicht nach Inkubieren der Oocyten in diesen Medikamenten für bis zu 4 Stunden.

Der HERG Kanal enthält ein Segment, das homolog zu einer cyclischen Nukleotidbindungsdömane nahe dem Carboxylterminus ist (Warmke und Ganetzky, 1994). Um zu klären, ob HERG sensitiv gegenüber cyclischen Nukleotiden ist, wurden der Einfluss von 8-Br-cAMP und 8-Br-cGMP auf exprimierten HERG Strom untersucht. Es ist gezeigt worden, dass diese Membran durchdringenden Analoga von endogenen cyclischen Nukleotiden das Ausmaß (magnitude) an anderen in Oocyten von Xenopus exprimierten Kanälen steigert (Blumenthal und Kaczmarek, 1992; Bruggemann et al., 1993). Keine Verbindung hatte einen signifikanten Effekt auf das Ausmaß der Stromstärke (current magnitude) oder die Spannungsabhängigkeit der Kanalaktivierung bei einer Konzentration von 1 mM während einer Anwendung innerhalb von 30 Minuten (Daten nicht dargestellt).

HERG kodiert für Untereinheiten von IKr-Kanälen des Herzens. Die obigen Resultate zeigen, dass HERG für die bedeutendste Untereinheit des IKr-Kanals des Herzens kodiert. In Oocyten exprimiertes HERG induziert einen Strom, der die meisten hervorragenden, IKr in Herzmyozyten definierenden Eigenschaften besitzt (Tabelle 1). Dazu zählen: 1) einwärts gerichtete Rektifikation der I-V-Beziehung, mit einem Spitzenwert in der Nähe von 0 mV; 2) Spannungabhängigkeit der Aktivierung; 3) paradoxe Modulation des Stromes [K+]e und 4) Blockierung durch La3+ und Co2+. Die Kinetiken der Aktivierung und Deaktivierung von HERG Strömen sind viel langsamer als IKr in AT-1-Zellen der Maus, gemessen bei Raumtemperatur (Yang et al., 1994). Dieser Unterschied kann anzeigen, dass ein anderer endogener Faktor oder eine weitere Kanaluntereinheit die Durchgängigkeit (gating) von IKr-Kanälen in Herzzellen moduliert. Weiterhin wird HERG nicht durch 8-Br-cAMP aktiviert, was mit dem Befund übereinstimmt, dass Isoproterenol IKr in Herzmyozyten nicht erhöht (Sanguinetti et al., 1991). Daher kann ein Zusammenfügen (co-assembly) von Untereinheiten von HERG in Oocyten, vermutlich als Homotetramere (MacKinnon, 1991), die wichtigen biophysikylischen Eigenschaften von IKr des Herzens wiederherstellen. Kein anderer Kanal zeigt all diese Eigenschaften.

Der einzige bedeutende Unterschied zwischen HERG Strom und IKr besteht darin, dass HERG durch Methansulfonanilide (E-4031, MK-499) nicht blockiert wird, die potente und spezifische Blocker von IKr in isolierten Herzmyocyten sind (Lynch et al., 1994; Sanguinetti und Jurkiewicz, 1990). Dies lässt vermuten, dass der IKr-Kanal und der Rezeptor für Methansulfoanilide verschiedene, aber zusammen wirkende Proteine sind. Ein ähnliches Phänomen ist für den KATP-Kanal beschrieben worden, der kürzlich aus dem Herz von Säugern isoliert wurde (Ashford et al., 1994). Wenn dieser Kanal (rcKATP-1) in HEK293 Zellen exprimiert wird, zeigt er alle biophysikalischen Eigenschaften des normalen Kanals (Ashford et al., 1994), mit Einschluss der Modulation durch intrazelluläre Nukleotide. Der Kanal wird jeoch nicht durch Glibenclamide blockiert, ein Medikament, welches KATP-Kanäle in Herzmyocyten inhibiert (Ashford et al., 1994). Es mag möglich sein, dass man den Rezeptor für Methansulfonanilide unter Verwendung von Sonden mit hoher Affinität, wie z.B. Dofetilide oder MK-499, biochemisch isoliert. Eine Co-expression von HERG-Kanälen mit einem Rezeptor für Methansulfonanilide wird detaillierte Studien über die Wechselwirkung zwischen diesen beiden Molekülen ermöglichen.

Der Mechanismus der HERG Rektifikation ist schnelle Kanalinaktivierung. Ein hervorragendes Merkmal von IKr ist die einwärts gerichtete Rektifikation der I-V-Beziehung. Der einwärts gerichtete Rektifizierer des Herzens, IK1, zeigt auch intensive einwärts gerichtete Rektifikation, aber diese findet über einen viel stärker negativen Spannungsbereich statt. Unter normalen physiologischen Bedingungen liegt der Spitzenwert von IK1 bei –60 mV, während der Spitzenwert von IKr bei 0 mV liegt. Der Mechanismus der IK1-Rektifikation resultiert sowohl aus einem spannungsabhängigen Durchgängigkeitsmechanismus (gating mechanism) als auch aus der Blockierung von auswärts gerichtetem Strom durch intrazelluläres Mg2+ (Vandenberg, 1987) und Spermine (Fakler et al., 1995). Im Gegensatz dazu wurde postuliert, dass die einwärts gerichtete Rektifikation von IKr von der spannungsabhängigen Inaktivierung herrührt, die viel schneller als die Aktivierung erfolgt (Shibasaki, 1987). Die Kinetik der schnellen Inaktivierung ist mittels makroskopischer Aufzeichnung von Strömen in Myozyten schwierig zu bestimmen und wurde daher auf der Basis der Kinetik von Einzelkanalaktivität berechnet (Shibasaki, 1987). In dieser Studie war es möglich, den zeitlichen Ablauf der Erholung von der Inaktivierung des makroskopischen HERG Stromes aufgrund des großen Abstandes des Signals vom Hintergrund und der relativ langsamen Kinetik der Kanaldurchgängigkeit (channel gating) zu bestimmen. Das schnelle Einsetzen der schnellen Aktivierung, und die Erholung von der schnellen Aktivierung, erklärt die ausgeprägte einwärts gerichtete Rektifikation der I-V-Beziehung fbei HERG. Beispielsweise aktiviert HERG bei einem Versuchspotential von +20 mV mit einer Zeitkonstanten von 230 msek, inaktiviert aber gleichzeitig mit einer Zeitkonstanten von 12 msek. Somit ist die Inaktivierung vollständig, bevor die Aktivierung ein signifikantes Ausmaß erreicht hat, was zu einer erheblich verminderten Stromamplitude führt. Die Erholung von der Inaktivierung erfolgt im Vergleich zur Deaktivierung so schnell, dass die Amplituden des Tailcurrent nach der Repolarisierung nicht in erheblichem Ausmaß beeinflusst werden. Unsere Befunde stützen Shibasakis Hypothese, dass der Mechanismus der Rektifikation für IKr (und HERG) eine schnelle, spannungsabhängige Inaktivierung ist.

Die Rektifikation des HERG Stromes erreichte ihr halbes Maximum (V1/2) bei –49 mV und hatte einen Neigungsfaktor von 28 mV. Der Neigungsfaktor der Rektifikation von HERG war ähnlich wie der von IKr, gemessen in Myozyten von Meerschweinchen (22 mV). Der Halbwert V1/2 der HERG Rektifikation war stärker negativ als der für Meerschweinchen geschätzte Wert (Tabelle 1). Die Spannungsabhängigkeit der IKr-Rektifikation in Meerschweinchen war jedoch wegen der Überlappung mit einem viel größeren IK1 bei negativen Testpotentialen schwierig zu messen. Da es einen Überlappungsstrom in Knotenzellen des Kaninchens sowie in HERG exprimierenden Oocyten nicht gibt, lässt sich die Spannungsabhängigkeit der Kanalrektifikation darin viel genauer messen, und die Ergebnisse dieser Messungenwaren ähnlich (Tabelle 1). Einzalkanalanalysen von exprimierten HERG werden noch eine genauere Beschreibung der spannungsabhängigen Durchgängigkeit und der schnellen Inaktivierung möglich machen.

Die [K+]e-Abhängigkeit des HERG Stromes kann die Dauer der Aktionspotentiale des Herzens modulieren. Eine Erhöhung von [K+]e verursachte eine Verstärkung des auswärts gerichteten HERG Stromes. Dies ist ein paradoxer Effekt, weil eine Erhöhung von [K+]e die chemische Triebkraft (driving force) für einen auswärts gerichteten Fluss von K+ vermindert, und man sollte daher erwarten, dass der auswärts gerichtete Strom schwächer und nicht stärker wird. Die selbe Erscheinung ist für IKr beschrieben worden (Sanguinetti und Jurkiewicz, 1992; Scamps und Carmeliet, 1989), aber nicht für irgendwelche anderen Herzkanäle außer IK1. IK1 wird jedoch fast sofort mit Hyperpolarisation aktiviert, während HERG, wie IKr, durch Depolarisation relativ langsam aktiviert wird und nicht durch Hyperpolarisation aktiviert wird.

Die Modulation von HERG (und von IKr) durch [K+]e kann von physiologischer Bedeutung sein. Während schneller Herzfrequenzen und Ischämie reichert sich K+ in Zellspalten an (Ginant et al., 1992). Diese Erhöhung von [K+]e würde den Anteil von HERG (IKr) zum Nettorepolarisierungsstrom (net repolarization current) erhöhen. HERG (IKr) kann daher in Phasen von schneller Herzfrequenz oder in der frühen Phase einer Ischämie wichtiger für die Modulation des Herzaktionspotentials sein.

Der Mechanismus der HERG Modulation durch [K+]e ist noch nicht bekannt, kann jedoch ähnlich demjenigen für einen anderen klonierten K+-Kanal, RCK4, sein. Die Amplitude von RCK4 wird ebenfalls bei höherer [K+]e größer (Pardo et al. 1992). Einzelkanalanalysen haben gezeigt, dass eine Erhöhung von [K+]e die Zahl der für eine Öffnung verfügbaren Kanäle steigerte, aber keinen Einfluss auf die Leitfähigkeit der einzelnen Kanäl, die mittlere Öffnungsdauer und die Durchgängigkeit (gating charge) hatte (Pardo et al., 1992). Überdies wurde gezeigt, dass die Substitution eines einzelnen Lysins, das in der Nähe der Pore des Kanals lokalisiert war, durch ein Tyrosinmolekül (K533Y) diesen Effekt aufhob. Eine ähnliche von [K+]e abhängige Verstärkung des Stromes wurde auch durch eine Substitution einer einzelnen Aminosäure in der Nähe der Porendomäne von Shaker B Kanälen erreicht (Lopez-Barneo et al., 1993). Zukünftige Experimente werden klären, ob K+ einzelne HERG Kanäle nach einem ähnlichen Mechanismus moduliert.

Mutation von HERG und durch Medikamente induzierte Blockierung von IKr: Eine mechanistische Verbindung zwischen erblichem und erworbenem LQT. Erbliches LQT und die häufigere durch Medikamente induzierten (erworbenen) Formen von LQT gehen mit Torsades de pointes, einer polymorphen ventrikulären Tachyarrhythmie einher. Es ist kürzlich gezeigt worden, dass Mutationen in HERG mit dem Chromosom 7 zusammenhängendes LQT auslösen, wahrscheinlich durch eine dominant-negative Inhibierung der oder einer HERG-Funktion (Curran et al., 1995). Es sollte bemerkt werden, dass es wahrscheinlich mehrere verschiedene Mechanismen gibt, die für erworbenes und erbliches LQT verantwortlich sind. Beispielsweise ist kürzlich gezeigt worden, dass Mutationen in SCN5A, dem Gen für den Natriumkanal des Herzens, mit dem Chromosom 3 zusammenhaängendes LQT verursachen (Wang et al., 1995). Die Entdeckung, dass HERG den IKr-Kanal bildet, gibt eine logische Erklärung für die Beobachtung, dass die Blockierung von IKr durch bestimmte Wirkstoffe die selben Arrhythmien hervor rufen kann (Torsades de pointes) wie sie bei erblichem LQT beobachtet werden.

Die gegenwärtigen Befunde können wichtige klinische Implikationen haben. Es wurde gefunden, dass Veränderungen in [K+]e von einem Spiegel von 2 mM bis zu einem neuen Spiegel von 5 mM den HERG Strom um 40% erhöhen. Mäßige Hypokaliämie, ein übliches klinisches Problem, würde eine signifikante Wirkung auf den HERG Strom haben. Dies kann die Verbindung von Hypokaliämie mit erworbenem LQT erklären (Roden, 1988). Weiterhin besteht per se ein Zusammenhang von Hypokaliämie und ventrikulären Arrhythmien (Curry et al., 1976). Medikamente, wie z.B. Sotalol und Dofetilide, welche IKr herabsetzen, können wirksame antiarrhythmische Wirkstoffe sein, weil sie die Aktionspotentiale des Herzens maßvoll verlängern und dadurch sich wiederholende (reentrant) Arrhythmien inhibieren. Bei Hypokaliämie würde dieser Effekt übertrieben sein und zu einem exzessiven Aktionspotential sowie zur Induzierung von Torsades de pointes führen. Eine mäßige Erhöhung von [K+]e im Serum von Patienten, die diese Antiarrhythmika erhalten, oder von Patienten, die andere Medikamente erhalten, die zu erworbenem LQT führen, wie z.B. Antihistaminika oder Antibiotika, wie z.B. Erythromycin, oder von Individuen mit LQT, welches mit dem Chromosom 7 zusammen hängt, sollte helfen, LQT und Torsades de pointes zu verhindern.

Zusammenfassend lässt sich sagen, dass gezeigt worden ist, dass HERG für die wesentliche Untereinheit kodiert, die IKr-Kanäle bildet. Diese Entdeckung legt nahe, dass der molekulare Mehanismus des mit dem Chromosom 7 zusammen hängenden LQT sowie bestimmte erworbene Formen der Krankheit von einer gestörten Funktion des selben Ionenkanals herrühren können.

Die vorliegende Erfindung wird in den folgenden Beispielen im einzelnen beschrieben, die die Erfindung erläutern und nicht in irgendeiner Weise begrenzen sollen. In den Beispielen sind übliche Methoden, die in der Technik gut bekannt sind, sowie die in der Folge speziell beschriebenen Methoden angewandt worden.

BEISPIEL 1 Methoden zur phänotypischen Bewertung

Die Studien an und mit SCN5A wurden in drei zuvor beschriebenen Sippen mit Vorkommen von LQT (K2171, K2321 und K2322) durchgeführt (Jiang et al., 1994). Für die Studien an und mit HERG wurden Sippen mit LQT in medizinischen Kliniken in Nordamerika ausfindig gemacht. Die phänotypischen Kriterien waren identisch mit denen in früheren Studien (Keating et al., 1991a; Keating, 1992). Individuen wurden als von LQT betroffen oder LQT-verdächtig anhand der für die Herzfrequenz korrigierten QT Intervalle (QTc; Bazette, 1920) sowie des Vorkommens von Synkopen, Schlaganfällen oder drohendem plötzlichen Herztod (aborted sudden death) evaluiert. Alle Individuen wurden informiert, und von jedem Individuum oder dessen Betreuer (guardian) wurde die Zustimmung eingeholt, in Übereinstimmung mit den Richtlinien der örtlichen institutionellen Aufsichtskörperschaften. Die phänotypischen Daten wurden ohne Kenntnis der genotypischen Information interpretiert. Individuen mit Symptomen und einem korrigierten QT Intervall (cQT) von 0,45 sek oder mehr und symptomlose Individuen mit einem cQT von 0,47 sek oder mehr wurden als betroffen (affected) klassifiziert. Symptomlose Individuen mit einem cQT von 0,41 sek oder weniger wurden als nicht betroffen klassifiziert. Symptomlose Individuen mit einem cQT zwischen 0,41 und 0,47 sek und Individuen mit Symptomen und einem cQT von 0,44 sek oder weniger wurden als „unsicher" klassifiziert.

BEISPIEL 2 Linkage-Analyse (linkage analysis)

Paarweise Linkage-Analysen wurden unter Verwendung von MLINK in LINKAGE v5.1 (Lathrop et al., 1985) durchgeführt. Dabei wurden angenommene Werte von 0,90 für die Durchdringung (penetrance) und 0,00 für die Häufigkeit des jeweiligen LQT-Gens verwendet. Es wurde unterstellt, dass die Genhäufigkeit bei Männern und Frauen gleich ist.

BEISPIEL 3 Isolierung von genomischen SCN5A Klonen und teilweise Charakterisierung der genomischen Struktur

Es wurden SCN5A Sonden hergestellt, wobei die Produkte einer PCR Reaktion mit humaner genomischer DNS und Primerpaare verwendet wurden, die sich von cDNS Sequenzen von SCN5A ableiteten, ein Primerpaar,

5'ACTTTCATCGTACTGAATAAAGGCAA3' (SEQ ID NO:1) und

5'GAGTGAACCAGAATCTTCACAGC3' (SEQ ID NO:2) wurde ausgehend von 5'-kodierenden Sequenzen konstruiert und ergab das vorhergesagte Produkt mit 118 bp.

Das zweite Primerpaar,

5'GGACCGTGAGTCCATCGTGTGA3' (SEQ ID NO:3) und

5'AGCCCATTCACAACATATACAGTCT3' (SEQ ID NO: 4) wurde ausgehend von den nicht kodierenden 3'-Sequenzen abgeleitet und ergab ein Produkt mit 336 bp.

Das dritte Primerpaar,

5'AGCAACTTCATCCCAGCTGCTGAG3' (SEQ ID NO:5) und

50 CTCCCAGCATCTCAGGTCAAGTG3' (SEQ ID NO:6) gründete sich auf nicht kodierende 3'-Sequenzen und ergab ein Produkt mit 297 bp.

Diese PCR Produkte wurden aus 2% Agarosegel gereinigt, mit hoher spezifischen Aktivität radioaktiv markiert und verwendet, um eine humane genomische P1-Bibliothek zu durchsuchen (Sternberg, 1990).

Um die genomische Struktur der Exons in SCN5A zu charakterisieren, die für die cytoplasmatische Verbindung zwischen DIII und DIV kodieren, wurden sequenzierende Primer konstruiert, die sich auf cDNS-Sequenzen und eine vorhergesagte genomische Struktur gründeten (McClatchey et al., 1992a; Gellens et al., 1992). Das Primerpaar für das vermutete Exon 21(abgeleitet von der Struktur von SCN5A) hatte die Sequenzen

5'TATGAAGAGCACCCTCAGTGGGAA3' (SEQ ID NO:7) und

5'CTTTTTCTTCTGTTGGTTGAAGTTG3' (SEQ ID NO:8).

Die Primer für das vermutete Exon 22 waren

5'TTAGGGGGCCAGGACATCTTC3' (SEQ ID NO:9) und

5'CAGGGGCCGTGGGATGGGCTTCTGG3' (SEQ ID NO:10).

Die Primer für das vermutete Exon 23 waren

5'CACCATATTCAAGCAGATCAG3' (SEQ ID NO:11) und

5'CTGCGCCACTACTACTTCACC3' (SEQ ID NO:12).

Diese Primer wurden benutzt, um die intronischen Sequenzen der SCN5A Klone zu bestimmen, wie beschrieben (Wang und Keating, 1994).

BEISPIEL 4 Isolierung von genomischen und cDNS Klonen von HERG

HERG Sonden wurden konstruiert unter Verwendung der Produkte von PCR Reaktionen mit humaner genomischer DNS und den Primerpaaren 1-10, 6-13, und 15-17 (siehe Tabelle 2). Diese Produkte wurden kloniert, mit hoher spezifischer Aktivität radioaktiv markiert und verwendet, um eine humane genomische P1 Bibliothek zu durchsuchen (Sternberg, 1990). Positive Klone wurden gereinigt, charakterisiert und für FISH- und DNS-Sequenzanalysen verwendet. Ein genomischer HERG Klon, der die Domänen S1 bis S3 sowie das Intron 1 enthielt (Curran et al., 1995) wurde verwendet, um etwa 106 Recombinanten einer humanen cDNS-Bibliothek aus dem Hippocampus (Stratagene, Bibliothek #936205) zu durchsuchen. Ein einzelner, teilweise verarbeiteter (processed) cDNS Klon, der die Nukleotide 32-2398 der kodierenden Sequenz von HERG enthielt, wurde identifiziert. Die Bibliothek wurde ein zweites Mal durchsucht, wobei der kodierende Anteil dieser cDNS verwendet wurde. Dieser Durchlauf ergab einen zweiten Klon, der die kodierenden Sequenzen von HERG von dem Nukleotid 1216 bis zu der nicht translatierten 3'-Region (UTR) enthielt und eine PolyA+-Region einschloss. Diese beiden Klone wurden unter Verwendung einer Xhol-Stelle in der Position 2089 ligiert. Um die 5'-Region von HERG zu erhalten, wurden etwa 106 Klone einer cDNS-Bibliothek des menschlichen Herzens (Stratagene, Bibliothek #936207) mit der zusammengesetzten cDNS aus dem Hippocampus durchsucht. Ein einzelner Klon wurde isoliert, der die 5'-UTR bis zum Nukleotid 2133 enthielt. Dieser Klon wurde mit der zusammengesetzten hippocampalen DNS an einer BglII-Schnittstelle (Nukleotid 1913) kombiniert, um HERG-cDNS von voller Länge zu produzieren.

BEISPIEL 5 Kartieren von HERG auf Basis von YAC

Ein PCR Assay, der spezifisch für die nicht translatierte 3'-Region von HERG war und bei dem die Primer

5'GCTGGGCCGCTCCCCTTGGA3' (SEQ ID NO:13) und

5'GCATCTTCATTAATTATTCA3' (SEQ ID NO:14)

ergab ein Produkt mit 309 bp. Dieses wurde verwendet, um eine Kollektion von YAC-Klonen zu durchsuchen, die in Bezug auf das humane Chromosom 7 stark angereichert waren (Green et al, im Druck). Zwei positive YAC Klone wurden identifiziert, nämlich yWSS2193 und yWSS17S9, die beide in einem größeren Segment (contig) enthalten waren, das YAC Positiva für den genetischen Marker D7S505 enthielt (Green et al., 1994).

BEISPIEL 6 Fluoreszente in situ Hybridisierung

Chromosomale Spreizpräparate („chromosome spreads") wurden aus normalen kultivierten Lymphozyten (46 X,Y) nach üblichen Methoden mittels Colcemid-Arrest, hypotonischer Behandlung und Fixierung mittels Essigsäure und Methanol hergestellt. Der HERG P1-Klon 16B4 wurde durch Einbau von Biotin-l4-dATP (BioNick System, Gibco-BRL9 markiert, zu einem Metaphase Spreizpräparat hybridisiert und mit Streptavidin-Cy3 nach Standardmethoden nachgewiesen (Lichter et al., 1988). Um das Chromosom 7 zu identifizieren, wurde eine mit Digoxenin markierte, zentromerspezifische &agr;-Satellitensonde (Oncor) co-hybridisiert und mit Antidigoxigenin-FITC nachgewiesen. Die Chromosomen wurden gegengefärbt mit DAPI und direkt unter dem Fotomikroskop sichtbar gemacht.

BEISPIEL 7 SSCP Analyse

Genomische DNS Proben wurden mittels PCR amplifiziert und in SSCP Analysen verwendet, wie aus dem Stand der Technik bekannt (Orita et al., 1989; Ptacek et al., 1991). Die in dieser Studie verwendeten Primerpaare sind in den Tabellen 2 und 3 aufgeführt. Die Renaturierungstemperatur (annealing temperature) betrug für alle PCR Reaktionen 62°C (für die Studien mit SCN5A) bzw. 58°C (für die Studien mit HERG). Für Studien mit SCN5A wurden die Reaktionsgemische (10 &mgr;l) mit 50 &mgr;l 0,1% SDS/1mM EDTA und 50 &mgr;l 95% Formamidfarbstoff verdünnt. Für Studien mit HERG wurden die Reaktionen (10 &mgr;l) mit 40 &mgr;l 0,1% SDS/1mM EDTA und 30 &mgr;l 95% Formamidfarbstoff verdünnt. Die verdünnten Produkte wurden durch Erhitzen auf 94°C oder 100°C für 5 oder 10 Minuten denaturiert, und 3 bis 5 &mgr;l von jedem Ansatz wurden durch Elektrophorese, entweder an 7,5% oder 10% nicht denaturierendem Polyacrylamidgel (Acrylamid zu Bis-acrylamid = 50:1)) bei 4°C getrennt. Die Elektrophorese wurde bei 40 bis 50 Watt durchgeführt und nahm 2 bis 5 Stunden in Anspruch. Die Gele wurden auf 3 MM Filterpapier übertragen, getrocknet und bei –80°C für 12 bis 36 Stunden auf einen Röntgenfilm gelegt.

Alle Primer sind in Richtung von 5' zu 3' dargestellt. „Kodierender Strang" Oligonukleotide sind durch ein „L" gekennzeichnet, und „Template-Strang" Oligonukleotide sind durch ein „R" markiert. Die cDNS-Sequenz wurde von der Datenbank Genbank erhalten, die Zählung der Nukleotide beginnt mit dem Initiator Methionin.

Alle Primer sind in Richtung von 5' zu 3' dargestellt. „Kodierender Strang" Oligonukleotide sind durch ein „L" gekennzeichnet, und „Template Strang" Oligonukleotide sind durch ein „R" markiert.

  • D = Domäne, ID = Interdomäne; S = Membran spannendes Segment

BEISPIEL 8 Sequenzanalyse von SSCP Konformeren

Normale und anomale SSCP-Konformere wurden direkt von getrockneten Gelen geschnitten und in 75-100 &mgr;l destillierten Wassers entweder bei 37°C oder bei 65°C für 30 Minuten eluiert. 10 &mgr;l der eluierten DNS wurden als Templat für eine zweite PCR-Reaktion verwendet, wofür das originale Primerpaar eingesetzt wurde. Die Produkte wurden in 2% niedrig schmelzendem Agarosegel (FMC) fraktioniert, und die DNS-Fragmente wurden direkt mittels Zyklus-Sequenzierung (Wang und Keating, 1994) sequenziert. Alternativ wurden die gereinigten Produkte in Blueskript II SK+ (Stratagene) unter Verwendung der T-Vektormethode, wie beschrieben von Marchuk et al., 1990, kloniert. Proben von Plasmid-DNS wurden gereinigt und mittels der Dideoxy-Kettenterminierungsmethode unter Verwendung der Polymerase SequiTherm (Epicentre Technologies) oder wie zuvor beschrieben (Curran et al., 1993a) sequenziert.

BEISPIEL 9 Northern Analyse

Ein Northern Blot mit mehreren Gewebenproben, das etwa 2 &mgr;g/Spur an PolyA+ mRNS enthielt, wurde von Clonetech (Humaner MTN Blot 1) bezogen. Ein radioaktiv markiertes cDNS-Fragment von HERG mit hochspezifischer Aktivität (>1,5 × 109 cpm/&mgr;g DNS), das die Nukleotide 679 bis 2239 der kodierenden Sequenz enthielt, wurde durch statistisches Hexamerpriming wie beschrieben (Feinberg und Vogelstein, 1983) hergestellt. Eine Sonde wurde der Hybridisierungslösung bei einer Endkonzentration von von 5 × 106 cpm/ml zugesetzt. Die Hybridisierung wurde bei 42°C über 24 Stunden in 20 ml Quickhyb Lösung (Stratagene) durchgeführt. Die Endwäsche erfolgte bei 65°C über 30 Minuten in einer Lösung von 0,1% SDS/0,1X SSC.

BEISPIEL 10 Linkage-Analyse von SCN5A

Um die chromosomale Lage eines LQT-Gens zu bestimmen, wurde eine Linkage-Analyse vorgenommen. Zuvor war in drei LQT-Familien eine Verbindung von LQT mit dem Chromosom 3p festgestellt worden (Jiang et al., 1994). In dieser Studie zeigten zwei Familien, K2171 und K2321, eine vollständige Verbindung zu Markern bei D3S1100 und D3S1298. Die kombinierten paarweisen Lodscoresder drei verbundenen Familien waren 6,72 zw. 6,39 bei &THgr; = 0,001. In den Familien K2171, K2321 und K2322 durchgeführte Haplotyp Analysen hatten die Position dieses Locus präzisiert. Obligate Rekombinante wurden bei D3S1211 und D3SI767 identifiziert, wodurch die Telometrie bzw. zentromere flankierende Marker definiert wurden. Der Zwischenraum zwischen diesen flankierenden Loci wird auf 17,6 centiMorgan geschätzt (Jiang et al., 1994).

1995 wurde SCN5A auf dem Chromosom 3p21 kartiert (George et al., 1995). Um zu testen, ob SCN5A ein Kandidat für LQT ist, wurden einsträngige Konformationspolymorphismus-Analysen (SSCP) verwendet, um Polymorphismus innerhalb dieses Gens zu identifizieren, und dann wurden Linkage-Analysen in mit Chromosom 3 verknüpften Familien durchgeführt. Da die genomische Struktur von SCN5A unbekannt war, wurden Oligonukleotidprimer aus aus veröffentlichten SCN5A Sequenzen (Gellens et al., 1992) konstruiert, auf der Grundlage der Annahme, dass die genomische Struktur von SCN5A derjenigen von SCN4A, dem Gen für den Natriumkanal der Skelettmuskeln (MacClatchey et al., 1992a), ähnlich sein würde. Um diese Arbeit zu erleichtern, wurden zwei genomische P1 Klone identifiziert und zum Teil charakterisiert. Diese Klone schlossen das gesamte SCN5A Gen ein. Auf der Grundlage von Sequenzen, von denen vorhergesagt wurde, dass sie für die cytoplasmatische Region zwischen DIII und DIV kodieren, wurden Primer synthetisiert. Diese Region entspricht den Exons 21 bis 23 von SCN4A und ist dafür bekannt, dass sie kritisch für die Kanalinaktivierung ist. Diese Primer wurden verwendet, um die flankierenden Introns durch Zyklussequenzierung zu charakterisieren. Für SSCP Analysen wurden weitere Primer zu diesen intronischen Sequenzen konstruiert (Tabelle 3). Primerpaare, die von genomischer DNS Produkte von angemessener Größe ergaben, wurden verwendet, um DNS Proben von Patienten zu durchsuchen. Bei Verwendung des Primerpaares 7-8 (Tabelle 3) wurde ein anomales SSCP Konformer identifiziert. Die normalen und die anomalen Banden wurden kloniert und sequenziert. Das anomale Konformer resultierte aus einer Substitution von C durch T in der Position 3 des Codons 1819 (cDNS Nukleotid 5607, Gellens et al., 1992). Diese Substitution hatte keinen Effekt auf die vorhergesagte Aminosäuresequenz von SCN5A. Die beobachtete Heterozygosität für diesen Polymorphismus betrug 0,50. Der SCN5A Polymorphismus wurde benutzt für genotypische Analysen in Familien, bei denen ein Zusammenhang mit dem Chromosom 3 bestand (1). In diesen Familien wurden keine Rekombinationsvorkommnisse zwischen SCN5A und LQT identifiziert. Der maximal kombinierte Lod Score für alle Familien mit Verbindung zum Chromosom 3 betrug 2,74 bei einer Rekombinationsfraktion von 0,0 (Tabelle 4).

Bei der Berechnung der Lod Scores wurde für alle Sippen eine autosomal-dominamte Vererbung mit einer Penetranz von 0,90 unterstellt, wie durch Segregationsanalyse dieser und anderer LQT-Sippen angezeigt war. Weiterhin wurde eine Krankheitsallelfrequenz von 0,001 angenommen und vorausgesetzt, dass die Rekombinationsfrequenzen bei Männern und Frauen gleich waren. &thgr; zeigt die geschätzte Rekombinationsfraktion bei Zmax an.

Wenn das Primerpaar 3-4 für SSCP Analysen benutzt wurde, wurde ein anomales Konformer in DNS-Proben von betroffenen Mitgliedern der Sippen 2321 und 2322 gefunden (1). Im Gegensatz dazu wurde in DNS-Proben von nicht betroffenen Mitgliedern dieser Familien nur das normale Konformer identifiziert. Der kombinierte Zweipunkt-Lod Score für eine Verbindung zwischen dieser Anomalie und LQT3 betrug 5,54 (Tabelle 4). Wiederum wurde keine Rekombination zwischen SCN5A und LQT3 gefunden, was dafür spricht, dass diese Loci eng miteinander verbunden sind.

Die Mobilitätsverschiebung zwischen anomalen und normalen SSCP Konformeren, die in den Sippen 2321 und 2322 identifiziert wurden, ist groß, was die Vermutung nahe legt, dass die Möglichkeit einer kleinen Deletion besteht. Um diese Hypothese zu untersuchen, wurden die Konformere durch Elektrophorese auf denaturierendem Polyacrylamidgelen getrennt (9 und 10). Diese Daten zeigten, dass zwei Produkte mit 235 bp und 244 bp vorliegen. Das Produkt mit 235 bp wurde nur bei betroffenen Individuen gefunden. Weiterhin wurde dieser anomale Konformer bei mehr als 500 Kontrollpersonen nicht beobachtet. Diese Daten zeigen eine mit der Krankheit verbundene Deletion innerhalb von SCN5A an.

Um den Effekt der mit LQT verbundenen Deletion auf die Struktur von SCN5A zu untersuchen, wurden das normale und das anomale Konformer amplifiziert, und Zyklussequenzierungen wurden durchgeführt. Diese Experimente ergaben, dass eine Deletion von 9 bp vorliegt, beginnend bei dem Nukleotid 4661 der cDNS (11). Das anomale und das normale Konformer wurden auch kloniert und sequenziert. Diese Experimente bestätigten die Größe und den Ort der Deletion. Diese Deletion unterbricht die kodierende Sequenz und führt zu einem Ausfall von drei konservierten Aminosäuren, K1505-P1506-Q1507 (KPQ), in dem cytoplasmatischen Linker zwischen DIII und DIV (2 und 12).

Eine DNS-Sequenzanalyse des anomalen Konformers in der Sippe 2321 zeigte, dass die intragenische Deletion identisch mit der in der Sippe 2322 gefundenen Deletion war. Eine mögliche Erklärung für die identischen Deletionen ist die, dass diese beiden Sippen entfernt miteinander verwandt sind. Beide Familien waren nordamerikanisch und von europäischer Abstammung, die eine deutsch, die andere englisch. Eine Überprüfung in einer genealogischen Datenbank ergab keine Verwandtschaft zwischen diesen Familien über mehr als acht Generationen. Weiterhin zeigten genotypische Analysen dieser Sippen unterschiedliche Haplotypen auf den Krankheitschromosomen (1). Das Vorkommen von identischen Deletionen in zwei anscheinend nicht miteinander verwandten LQT-Familien spricht dafür, dass SCN5A gleich LQT3 ist.

BEISPIEL 11 Linkage-Analyse von HERG

LQT2 ist mit Markern auf dem Chromosom 7q35-36 verbunden. Um die relative Häufigkeit der drei bekannten LQT-Loci (LQT1, LQT2, LQT3) zu bestimmen, wurden Linkage-Analysen in Familien mit dieser Krankheit durchgeführt. Fünf LQT Familien wurden identifiziert und phänotypisch charakterisiert (13). Diese Familien waren nicht miteinander verwandt und verschiedenen Ursprungs, einschließlich von mexikanisch (spanisch), deutsch, englisch und dänisch. In jedem Fall wurde durch Überprüfung des Stammbaums ein autosomal-dominantes Vererbungsmuster nahe gelegt. Betroffene Individuen wurden anhand einer QT Verlängerung im Elektrokardiogramm und, in manchen Fällen, durch eine Vorgeschichte von Synkopen oder drohendem plötzlichem Herztod identifiziert. Keine Patienten hatten Anzeichen von angeborenem nervlich bedingtem Hörverlust, ein Befund, der mit der seltenen autosomal-rezessiven Form von LQT einher geht, oder zeigten andere phänotypischen Anomalien. Genotypische Analysen mit polymorphen Markern, die mit den bekannten LQT-Loci in Beziehung stehen, legten nahe, dass der Phänotypus der Krankheit in diesen Familien mit polymorphen Markern auf dem Chromosom 7q35-36 (14) verknüpft ist. Das Maximum des kombinierten Zweipunkt Lod Scores für diese fünf Familien betrug 5,13 bei D7S636 (&thgr; = 0,0; Tabelle 5). Wenn man eine frühere Studie einbezieht (Jiang et al., 1994; Wang et al., 1995), beträgt der maximale Zweipunkt Lod Score für die 14 Familien mit einer Verbindung zum Chromosom 7 26,14, ebenfalls bei D7S636 (&thgr; = 0,0; Tabelle 5). Haplotyp- Analysen stimmten mit früheren Studien überein und platzierten LQT2 zwischen D7S505 und D7S483 (14; Wang et al., 1995), wodurch dieses Gen als auf dem Chromosom 7q35-36 lokalisiert erkannt wird.

HERG ist auf dem Chromosom 7q35-36 kartiert. HERG war zuvor auf dem Chromosom 7 kartiert (Warmke und Ganetzky, 1994). Um den Kandidatenstatus dieses Gens zu prüfen, wurde die Lokalisierung von HERG mittels zweier physikalischer Kartierungstechniken näher bestimmt. Einerseits wurde HERG auf einem Satz von künstlichen Hefechromosomen (YAC) kartiert, die für das Chromosom 7 konstruiert wurden (Green et al., 1994). HERG wurde auf dem selben YAC lokalisiert wie D7S505, einem polymorphen Marker, der eng mit LQT2 verbunden war. Andererseits wurde HERG mittels einer fluorescenten in situ Hybridisierung (FISH) mit einem HERG enthaltenden P1 genomischen Klon auf dem Chromosom 7q35-36 kartiert.

Die Marker sind in chromosomaler Ordnung gezeigt (Zentromere zu Telomeren; Gyapay et al., 1994). Die erste Kolumne (Familien der jetzigen Studie) zeigt kombinierte Lod Scores für die fünf in dieser Studie beschriebenen Familien. Die zweite Kolumne (alle bisher studierten Familien) die kombinierten Lod Scores der fünf Familien der jetzigen Studie und von neun Familien einer früheren Studie (Jiang et al., 1994). Zmax bedeutet den maximalen Lod Score, &thgr; gibt die geschätzte Rekombinationsfraktion bei Zmax an.

Um zu entscheiden, ob HERG genetisch mit dem Locus von LQT verbunden ist, wurden SSCP-Analysen durchgeführt, um Polymorphismus innerhalb von HERG zu identifizieren, und Linkage-Analysen wurden in den mit dem Chromosom 7 verbundenen Familien durchgeführt. Bei Verwendung der Primerpaare 5-11 und 3-8 (15) wurden zwei anomale SSCP Konformere in DNS Proben von Patienten und von Kontrollpersonen identifiziert. Diese Konformere wurden kloniert und sequenziert. Das anomale Konformer resultierte aus einer Substitution von C durch T in Position 3 des Kodons 489 (cDNS Nukleotid 1467, beobachtete Heterozygosität = 0,37). Das zweite anomale Konformer resultierte aus einer Substitution von A durch G in Position 3 des Kodons 564 (cDNS Nukleotid 1692, beobachtete Heterozygosität = 0,44). Keine Substitution beeinflusste die Aminosäuresequenz des Genprodukts von HERG. Der Polymorphismus von HERG wurde für genotypische Analysen in Familien mit Verbindung zum Chromosom 7 benutzt (13). In keiner dieser Familien wurden Rekombinationsereignisse zwischen HERG und LQT identifiziert. Der maximale kombinierte Lod Score für die 14 Familien betrug 9,64 (&thgr; = 0,0; Tabelle 5). Diese Daten zeigen an, dass HERG vollständig mit LQT2 verbunden ist.

Intragenische Deletionen in HERG sind in zwei Familien mit LQT verbunden. Um die Hypothese zu prüfen, dass HERG gleich LQT2 ist, wurden SSCP Analysen durchgeführt, um in betroffenen Individuen nach Mutationen zu suchen. Da die genomische Struktur von HERG unbekannt war, wurden Paare von Nukleotid Primern von veröffentlichten cDNS-Sequenzen (Warmke und Ganetzky, 1994) abgeleitet (15, Tabelle 2). In den meisten Fällen wurden einzelne Produkte von der erwarteten Größe erzeugt. Bei Verwendung der Primerpaare 1-10, 6-13 und 15-17 wurden jedoch Produkte erhalten, die größer als die erwarteten waren, was das Vorhandensein von intronischen Sequenzen nahe legt. Um diese Möglichkeit zu prüfen, wurden diese größeren Produkte kloniert und sequenziert. DNS Sequenzanalysen identifizierten drei Introns in den Positionen 1557/1558, 1945/1946 und 2398/2399 der cDNS Sequenz (15). Diese Grenzen wurden durch direkte DNS Sequenzierung von genomischen, HERG enthaltenden Klonen bestätigt (Daten nicht angegeben). Um die SSCP-Analysen zu erleichtern, wurden zusätzliche Primer für intronische Sequenzen konstruiert.

Wie zuvor erklärt, identifizierten SSCP-Analysen mittels des Primerpaares 3-8 innerhalb von HERG einen Polymorphismus von A zu G (cDNS Nukleotid 1692). Analysen der Sippe 2287 (K2287) unter Verwendung dieses SSCP-Polymorphismus definierten ein Genotypmuster, das mit einem Nullallel (13) verträglich war. Zu den möglichen Erklärungen für diese Befunde zählten multiple Vererbungsfehler (misinheritances), eine Möglichkeit, die keine Stütze in vorhergehenden phänotypischen Analysen findet, Irrtümer im Zusammenhang mit den DNS-Proben, Substitutionen von Basenpaaren oder eine Deletion. Um die Hypothese zu überprüfen, dass die genotypischen Daten einer kleinen Deletion entsprechen, wurden PCR Analysen von K2287 unter Verwendung eines neuen Primerpaares (3-9) wiederholt, das das zuvor verwendete Primerpaar flankiert. Diese Experimente identifizierten zwei Produkte von 170 bp und 143 bp in betroffenen Mitgliedern von K2287 (16A und 16B). Im Gegegnsatz dazu wurde bei nicht betroffenen Mitgliedern der Sippe nur ein einzelnes Produkt von 170 bp gefunden. Weiterhin wurde in DNS Proben von mehr als 200 nicht betroffenen Individuen nur die 170 bp Bande gesehen. Die von dem betroffenen Individuum II-2 stammenden Produkte von 143 bp und 170 bp wurden kloniert. Direkte Sequenzanalysen des anomalen PCR Produkts ergaben eine Deletion von 27 bp, beginnend bei der Position 1498 (&Dgr;1500 – F508). Diese Deletion unterbricht die dritte Membran spannende Domäne (S3) von HERG.

Um die Hypothese, dass HERG gleich LQT2 ist, zu überprüfen, wurden weitere SSCP Analysen in weiteren Sippen durchgeführt. SSCP Analysen unter Verwendung des Primerpaares 1-9 identifizierten ein anomales Konformer in betroffenen Mitgliedern von K2595 (17A). Analysen der DNS von mehr als 200 nicht betroffenen Mitgliedern zeigten diese Anomalie nicht. Die normalen und die anomalen Konformere wurden kloniert und sequenziert, wobei die Deletion einer Base in der Position 1261 (&Dgr;1261) gefunden wurde.

Diese Deletion resultiert in einer Verschiebung des Leserasters in den Sequenzen, die für die erste Membran spannende Domäne (S1) kodieren und führt zu einem neuen Stopkodon innerhalb von 12 Aminosäuren (17B). Die Identifizierung von zwei intragenischen Deletionen in HERG bei zwei LQT-Familien legt nahe, dass Mutationen von HERG LQT auslösen.

Drei mit HERG in Zusammenhang stehende Punktmutationen. Um weitere Mutationen von HERG in LQT2 zu identifizieren, wurden weitere SSCP Analysen in verbundenen Sippen und sporadischen Fällen durchgeführt. Drei anomale SSCP Konformere wurden in betroffenen Mitgliedern der Sippen K1956, K2596 und K2015 festgestellt (18A). In jedem Fall wurden das normale und das anomale Konformer kloniert und sequenziert. In K1956 wurde eine Substitution von C durch T in der Position 1682 identifiziert. Diese Mutation führt zu einer Substitution von Valin durch ein hoch konserviertes Alanin im Kodon 561 (A561V), wodurch die fünfte Membran spannende Domäne (S5) des HERG Proteins verändert wird (18B). In K2596 wurde eine Substitution von A durch G in der Position 1408 identifiziert. Diese Mutation führt zu einer Substitution von Asparaginsäure durch ein konserviertes Asparagin im Kodon 470 (N470D), das in der zweiten Membran spannenden Domäne (S2; 18B) liegt. In K2015 wurde eine Substitution von G durch C identifiziert. Diese Substitution unterbricht die Spleißdonor-Sequenz des Introns III, wodurch die cyclische Nukleotide bindende Domäne (18B) beeinflusst wird. In DNS-Proben von mehr als 200 nicht betroffenen Individuen wurde keines der anomalen Konformere identifiziert.

De novo-Mutation von HERG in einem sporadischen Fall von LOT. Um sicher zu stellen, dass Mutationen von HERG LQT auslösen, wurde SSCP angewandt, um in sporadischen Fällen nach Mutationen zu suchen. Das Primerpaar 4-12 identifizierte ein anomales Konformer in dem betroffenen Individuum II-1 von K2269 (19A). Dieses Konformer wurde weder bei den Eltern noch bei mehr als 200 nicht betroffenen Individuen identifiziert. Eine direkte DNS-Sequenzierung des anomalen Konformers ergab eine Substitution von G durch A in der Position 1882. Diese Mutation führt zu einer Substitution von Serin durch ein hoch konserviertes Glycin im Kodon 628 (G628S) (19B), wodurch die Poren bildende Domäne verändert wird. Eine genotypische Analyse dieser Sippe unter Verwendung von neun informativen STR-Polymorphismen bestätigte Mutterschaft und Vaterschaft. Die Identifizierung einer de novo Mutation in einem sporadischen Fall zeigt, dass HERG gleich LQT2 ist.

HERG wird im Herzen exprimiert. HERG wurde ursprünglich in einer aus dem Hippocampus stammenden cDNS-Bibliothek entdeckt (Warmke und Ganetzky, 1994). Um die Verbreitung der mRNS von HERG in Geweben zu bestimmen, wurden partielle cDNS-Klone isoliert und in Northern Analysen verwendet. Northern Analysen zeigten die stärkste Hybridisierung mit mRNA im Herz, mit schwachen Signalen im Gehirn, in Leber und im Pankreas (20). Eine nicht spezifische Hybridisierung wurde auch in der Lunge beobachtet, möglicherweise infolge von Verunreinigung mit genomischer DNS. Die Größe der Banden, die mit mRNS des Herzens beobachtet wurden, stimmte mit der vorhergesagten Größe von HERG überein. Zwei Banden von etwa 4,1 und 4,4 kB wurden identifiziert, möglicherweise infolge von alternativer Verknüpfung oder der Anwesenheit einer zweiten, verwandten mRNS. Diese Daten belegen, dass HERG im Herzen stark exprimiert wird, in Übereinstimmung mit seiner Beteiligung am Zustandekommen von LQT.

Mutationen in HERG sind einer der Gründe für LOT. Es kann der Schluss gezogen werden, dass Mutationen in HERG die mit dem Chromosom 7 verbundene Form von LQT auslösen. Verschiedene Beweislinien stützen diese Schlussfolgerung. Erstens wurden Linkage-Analysen verwendet, um in 14 Familien einen Locus für LQT (LQT2) auf dem Chromosom 7q35-36 zu kartieren. Zweitens wurden physische (physical) und genetische Kartierung benutzt, um HERG in der selben chromosomalen Region wie LQT2 zu platzieren. Drittens wurde gezeigt, dass HERG im Herz exprimiert wird. Viertens wurden in zwei Familien Deletionen in HERG identifiziert, die mit LQT in Zusammenhang stehen. Fünftens wurden vier Punktmutationen in von LQT betroffenen Individuen identifiziert. Und schließlich trat eine der Punktmutationen neu auf, und zwar in einer hoch konservierten Region, die für die Kalium-selektive Porendomäne kodiert.

Die Daten legen einen wahrscheinlich molekularen Mechanismus für mit dem Chromosom 7 verbundenes LQT nahe. Obwohl die Funktion von HERG nicht bekannt war, zeigten Analysen seiner vorhergesagten Aminosäuresequenz an, dass es für eine &agr;-Untereinheit eines Kaliumkanals kodiert. Kaliumkanäle bestehen aus vier Untereinheiten (MacKinnon, 1991), entweder als Homo oder als Heterotetramere (Covarrubias et al., 1991). Diese biophysikalischen Beobachtungen legen nahe, dass Kombinationen von normalen und mutierten &agr;-Untereinheiten von HERG anomale HERG Kanäle bilden. Dies eröffnet die Möglichkeit, dass Mutationen von HERG einen dominant-negativen Effekt auf die Funktion von Kaliumkanälen haben.

Die Mutationen, welche identifiziert wurden, sind mit einem dominant-negativen Mechanismus verträglich (21). Zwei Mutationen resultieren in vorzeitigen Stopkodons und verkürzten (truncated) Proteinen (&Dgr;1261 und die Mutation in der Spleißdonor Region). Im ersten Fall verbleiben nur der Aminoterminus und ein Teil der ersten Membran spannenden Domäne (S1). Im zweiten Fall ist das Carboxylende des Proteins verkürzt (truncated), und alle Membran spannenden Domänen bleiben intakt. HERG enthält eine cyclische Nukleotid bindende Domäne in der Nähe des Carboxylterminus, und in beiden Mutationen wird diese Domäne deletiert. Bei einer anderen Mutation unterbricht eine Deletion von neun Aminosäuren die dritte Membran spannende Domäne (&Dgr;1500 – F508). Zwei Missense-Mutationen beeinflussen ebenfalls Membran spannende Domänen (A561 V in der Domäne S5 und N470D in S2. Beide Mutationen haben Einfluss auf Aminosäuren, die in der eag-Famile von Kaliumkanälen konserviert sind und wahrscheinlich die Sekundärstruktur des Proteins verändern. Die de novo Missense Mutation, G628S, liegt in der Poren bildenden Domäne. Diese Domäne ist in allen &agr;-Untereinheiten von Kaliumkanälen hoch konserviert. Diese Mutation beeinflusst eine konservierte Aminosäure, von der bekannt ist, dass sie für Ionenselektivität wichtig ist. Als diese Substitution in den Shaker H4 eingeführt wurde, ging die Selektivität für Kaliumionen verloren (Heginbotham et al., 1994). Wie zuvor diskutiert, könnten diese Mutationen den Verlust der HERG-Funktion induzieren.

Die Daten haben Implikationen für den Mechanismus von Arrhythmien in LQT. Zwei Hypothesen für LQT sind früher vorgeschlagen worden (Schwartz et al., 1994). Die eine legt nahe, dass ein Überwiegen von linker (left) autonomer Innervation eine anomale Repolarisation des Herzens und Arrhythmien verursacht. Diese Hypothese wird durch den Befund gestützt, dass in Hunden durch Entfernung des rechten Sternganglions (stellate ganglion) Arrhythmien induziert werden können. Weiterhin legt ein Einzelbericht nahe, dass einige LQT Patienten mit &bgr;-adrenergisch blockierenden Mitteln und Entfernung des linken Sternganglions erfolgreich behandelt worden sind (Schwartz et al., 1994). Die zweite Hypothese für mit LQT zusammenhängende Arrhythmien lässt vermuten, dass Mutationen in Genen für die Modulation von Herz-spefifischen Ionenkanälen eine verzögerte myozelluläre Depolarisation verursachen. Eine verzögerte myozelluläre Depolarisation könnte die Reaktivierung von Calciumkanälen vom L-Typ fördern, was zu sekundären Depolarisationen führt (January und Riddle, 1989). Diese sekundären Depolarisationen sind der wahrscheinliche zelluläre Mechanismus von Arrhythmien vom Typ Torsades de pointes (Surawicz, 1989). Diese Hypothese wird durch die Beobachtung gestützt, dass eine pharmakologische Blockierung von Kaliumkanälen eine QT Verlängerung und mit Repolarisation zusammenhängende Arrhythmien in Menschen und Tiermodellen induzieren kann (Antzelevich und Sicouri, 1994). Die Entdeckung, dass eine der Formen von LQT von Mutationen in einem Gen für einen Kaliumkanal des Herzens herrührt, stützt die myozelluläre Hypothese.

Die Anwesenheit einer cyclischen Nukleotid bindenden Domäne in HERG legt einen Mechanismus für die Verbindung zwischen einer veränderten Aktivität autonomer Nerven und Arrhythmien in LQT nahe. Eine Aktivierung &bgr;-adrenergischer Rezeptoren erhöht cAMP und steigert die Funktion von Ca2+-Kanälen vom L-Typ. Cyclische AMP kann ebenfalls HERG aktivieren, wodurch der nach auswärts gerichtete Nettostrom (net outward current) verstärkt und die Geschwindigkeit der myozellulären Repolarisation vergrößert wird. Dominant-negative Mutationen von HERG könnten die normale Modulation der HERG Funktion durch AMP unterbrechen, wodurch ein eine überwiegender Effekt auf die Funktion von Ca2+-Kanälen vom L-Typ möglich würde. Die resultierende Unausgeglichenheit würde die Wahrscheinlichkeit erhöhen, dass ein erhöhter sympathetischer Tonus sekundäre, von Ca2+-Kanälen abhängende Depolarisationen induzieren könnte, der wahrscheinliche zelluläre Mechanismus von Torsades de pointes. &bgr;-Adrenergische Blocker könnten wirken, indem sie die Wirkung von cAMP auf Ca2+-Kanäle vom L-Typ unterbrechen, was möglicherweise die günstigen Wirkungen von &bgr;-Blockern bei manchen LQT Patienten erklärt.

Die relative Häufigkeit der drei LQT Loci ist noch nicht bekannt. In dieser Studie wurden fünf Familien mit autosomal-dominantem LQT identifiziert, und bei allen bestand ein Zusammenhang mit dem Chromosom 7. Dies bringt die Gesamtzahl der Familien mit Verbindung zum Chromosom 7 auf 14. Bis heute sind sieben Familien mit dem Chromosom 11 (LQT1), 14 Familien mit Chromosom 7 (LQT2) und drei Familien mit Chromosom 3 (LQT3) in Verbindung gebracht worden, während für drei Familien keine Verbindung zu einem Chromosom festgestellt wurde (Keating et al., 1991a,b; Jiang et al., 1994). Wenn diese Daten auch vorläufig sind, so weisen sie doch darauf hin, dass LQT2 eine übliche Form von erblichem LQT ist.

Diese Arbeit kann wichtige klinische Anwendungen haben. Kürzlich ist eine präsymptomatische Diagnose in großen Familien mittels Linkage-Analyse möglich geworden. Die meisten Fälle von LQT sind sporadisch, und daher ist ein genetischer Test mittels Linkage-Analyse nicht praktikabel. Fortgesetzte Mutationsanalysen von LQT2 und LQT3 werden genetische Tests auf diese Formen von LQT erleichtern. Für die Entwicklung von generalisierten diagnostischen Tests wird es nötig sein, Gene zu identifizieren und zu charakterisieren, die für andere Formen von LQT verantwortlich sind. Eine verbesserte diagnostische Kapazität wird eine rationelle Therapie ermöglichen. Beispielsweise können mit dem Chromosom 7 verbundene LQT Patienten auf Aktivatoren für den Kaliumkanal ansprechen, z.B. auf Pinacidil.

BEISPIEL 12 Herstellung von polyklonalen Antikörpern gegen SCN5A oder HERG

Segmente von kodierenden Sequenzen von SCN5A oder HERG werden als Fusionsproteine in E.coli exprimiert. Das überexprimierte Protein wird durch Eluieren auf einem Gel gereinigt und verwendet, um Kaninchen und Mäuse nach einem Verfahren zu immunisieren, das dem von Harlow und Lane, 1988, beschriebenen Verfahren entspricht. Es ist gezeigt worden, dass dieses Verfahren Antikörper gegen verschiedene andere Antikörper generiert (siehe z.B. Kraemer et al., 1993).

Kurz gesagt wird ein Stück (stretch) einer kodierenden Sequenz von SCN5A oder HERG als Fusionsprotein in dem Plasmid PET5A (Novagen, Inc., Madison, WI) kloniert. Nach der Induzierung mit IPTG wird die Überexpression eines Fusionsproteins mit dem erwarteten Molekulargewicht mittels SDS/PAGE nachgewiesen. Das Fusionsprotein wird auf einem Gel mittels Elektroeluierung gereinigt. Das Protein wird als Fusionsprotein von SCN5A oder HERG durch Proteinsequenzierung vom N-Terminus an identifiziert. Danach wird das gereinigte Prote in zur Immunisierung von Kaninchen verwendet. Die Kaninchen werden mit 100 &mgr;g des Proteins in komplettem Freuds Adjuvans immunisiert, gefolgt von einer zweimaligen Verstärkung (boosted) in Intervallen von drei Wochen, zuerst mit 100 &mgr;g des Immunogens in komplettem Freuds Adjuvans und danach mit 100 &mgr;g Immunogen in PBS. Antikörper enthaltendes Serum wird zwei Wochen danach gewonnen.

Dieses Verfahren wird wiederholt, um Antikörper gegen die mutierten Formen des Gens SCN5A oder von HERG zu gewinnen. Diese Antikörper, in Verbindung mit Antikörpern gegen normales SCN5A oder HERG, werden verwendet, um die Anwesenheit der mutanten Formen in verschiedenen Geweben und biologischen Flüssigkeiten nachzuweisen und deren relativen Gehalt zu bestimmen.

BEISPIEL 13 Herstellung von monoklonalen, für SCN5A oder HERG spezifischen Antikörpern

Monoklonale Antikörper werden nach dem folgenden Protokoll hergestellt. Mäuse werden mit einem Immunogen immunisiert, das intakte SCN5A oder HERG Peptide oder SCN5A oder HERG Peptide (Wildtyp oder mutante) enthält, welche unter Verwendung von Glutaraldehyd oder EDC mit Hämocyanin der Schlüssellochnapfschnecke konjugiert ist, wie gut bekannt ist.

Das Immunogen wird mit einem Adjuvans gemischt. Jede Maus erhält vier Injektionen von 10 bis 100&mgr;g Immunogen, und nach der vierten Injektion werden der Maus Blutproben entnommen, um festzustellen, ob das Serum Antikörper gegen das Immunogen enthält. Der Serumtiter wurde mittels ELISA oder RIA bestimmt. Mäuse mit Seren, die einen Gehalt an Antikörper gegen das Immunogen enthalten, werden für die Herstellung von Hybridoma ausgewählt.

Den Mäusen wird die Milz entnommen, und eine Einzelzell-Suspension wird hergestellt (siehe Harlow et al., 1988). Die Zellfusionen werden im wesentlichen so durchgeführt, wie von Kohler und Milstein, 1975, beschrieben wurde. Kurz gesagt werden P3.65.3 Myelomzellen (American Type Culture Collection, Rockville, MD) mit immunisierten Milzzellen unter Verwendung von Polyethylenglykol fusioniert, wie von Harlow et al., 1988 beschrieben wurde. Die Zellen werden mit einer Dichte von 2 × 105 Zellen/Well in Gewebekulturplatten mit 96 Wells plattiert. Die einzelnen Wells werden auf Wachstum überprüft, und die Überstände in den Wells mit Wachstum werden mittels ELISA oder RIA auf einen Gehalt an gegen SCN5A oder HERG spezifischen Antikörpern getestet, wobei natürliches oder mutantes SCN5A oder HERG Zielprotein verwendet wird. Zellen in positiven Wells werden expandiert und subkloniert, um sicher zu stellen, dass die Antikörper monoklonal sind.

Klone mit der gewünschten Spezifität werden vermehrt und als Ascites in Mäusen oder einem Hohlfasersystem kultiviert, um genügende Mengen an Antikörper zur Charakterisierung und für die Entwicklung von Assays zur Verfügung zu haben.

BEISPIEL 14 Sandwich-Assay für SCN5A und HERG

Ein monoklonaler Antikörper wird auf eine feste Oberfläche, wie z.B. eine Platte, ein Rohr, eine Perle oder ein anderes Partikel, aufgebracht. Vorzugsweise wird der Antikörper auf die Oberfläche von Wells einer ELISA Platte mit 96 Wells aufgebracht. Eine Probe von 100 &mgr;g (z.B. Serum, Urin, Gewebeflüssigkeit), die das SCN5A oder HERG Peptid/Protein (natürlich oder mutiert) enthält, wird dem in fester Phase vorliegenden Antikörper zugesetzt. Die Probe wird zwei Stunden bei Raumtemperatur inkubiert. Danach wird der fluide Anteil der Probe dekantiert, und die feste Phase wird mit Puffer gewaschen, um nicht gebundenes Material zu entfernen. 100 &mgr;l eines zweiten monoklonalen Antikörpers (gegen eine andere Determinante in dem SCN5A oder HERG Peptid/Protein) werden der festen Phase zugesetzt. Dieser Antikörper ist mit einem Detektormolekül (z.B. 125I, einem Enzym, Fluorophor oder Chromophor) markiert, und die feste Phase wird mit dem zweiten Antikörper wiederum für zwei Stunden bei Raumtemperatur inkubiert. Die flüssige Phase mit dem zweiten Antikörper wird dekantiert, und die feste Phase wird mit Puffer gewaschen, um nicht gebundenes Material zu entfernen.

Die Menge des gebundenen Markers, die der Menge des in den Proben enthaltenen SCN5A oder HERG Peptids/Proteins proportional ist, wird quantifiziert. Verschiedene Assays werden durchgeführt, wobei entweder monoklonale Antikörper verwendet werden, die spezifisch für natürliches SCN5A oder HERG sind, oder monoklonale Antikörper, die spezifisch für jede der Mutationen sind, die in SCN5A oder HERG identifiziert wurden.

BEISPIEL 15 Konstruktion eines HERG-Expressionsplasmids und Transkription von cRNS

Um die Expression von HERG in Oocyten von Xenopus zu erleichtern, wurde die HERG-cDNS in den Expressionsvektor Poly A+ subkloniert und die 5'- und 3'-UTRs (nicht translatierten Regionen) auf minimale Längen reduziert. Das endgültige HERG-Expressionskonstrukt enthält die cDNS-Sequenz von dem Nukleotid –6 bis zum Nukleotid 3513 in dem plasmidischen Vektor pSP64 (Promega). Vor seiner Verwendung in Expressionsexperimenten wurde das HERG-Konstrukt durch Restriktionskartierung und DNS-Sequenzanalyse charakterisiert. Nach der Linearisierung des Expressionskonstrukts mit EcoRI wurden mit dem mCAP RNA Capping Kit (Stratagene) komplementäre RNSs für die Injektion in Oocyten hergestellt.

BEISPIEL 16 Isolierung von Oocyten und Injektion von RNS

Xenopus Frösche wurden durch Eintauchen (15 bis 30 Minuten lang) in 0,2% Tricaine anaesthetisiert. Ovarlappen wurden 1,5 Stunden lang mit 2 mg/ml Kollagenase vom Typ 1A (Sigma) in Ca2+-freier ND96 Lösung verdaut, um Follikelzellen zu entfernen. Oocyten in den Stadien IV und V (Dumont, 1972) wurden mit mRNS von HERG (=,05 mg/ml, 50 nl) injiziert und dann bei 18°C kultiviert in Barths Lösung, die mit 50 &mgr;g/ml Gentamycin und 1 mM Pyruvat angereichert war. Barths Lösung enthielt (in mM): 88 NaCl, 1 KCl, 0,4 CaCl2, 0,33 Ca(NO3)2, 1 MgSO4, 2,4 NaHCO3, 10 HEPES, pH 7,4.

BEISPIEL 17 Voltage Clamp von Oocyten mit zwei Mikroelektroden

Soweit nicht anders angegeben, wurden Oocyten in ND96 Lösung gebadet. Diese Lösung enthielt (in mM): 96 NaCl, 2 KCl, 1 MgCl2, 1,8 CaCl2, 5 HEPES; pH 7,6. In einigen Experimenten wurde KCl variiert, indem es durch äquimolare Mengen NaCl ersetzt wurde. Die Ströme wurden bei Raumtemperatur (21 bis 23°C) gemessen und aufgezeichnet, wobei übliche Voltage Clamp Techniken mit zwei Mikroelektroden angewandt wurden. Die Mikroelektroden aus Glas wurden mit 3 M KCl gefüllt und ihre Spitzen abgebrochen, so dass ein Widerstand an den Spitzen von 1 bis 3 M&OHgr; für die die Spannung angebende Elektrode und von 0,6 bis 1 M&OHgr; für die den Strom durchleitende Elektrode eingestellt wurde. Die Oocyten wurden mittels eines Dagan TEV-200 Verstärkers unter Spannung gesetzt (voltage clamped). Die Spannungsvorgaben wurden unter Verwendung von pClamp Software (Version 6, Axon Instruments), eines 486DX2 Personalcomputers und eines TL-1 D/A Interface (Axon Instruments) generiert. Die Stromsignale wurden digital mit einer Rate abgenommen, die gleich 2-4 mal der low pass cut-off Frequenz (–3 db) eines Vierpol-Besselfilters war. Soweit nicht angegeben, wurden die Ströme mittels üblicher online P/3 Subtraktion korrigiert, um Verluststrom und Impedanz (capacitance) zu berücksichtigen. Das Potential an der Oocytenmembran wurde zwischen den Testimpulsen, die mit einer Rate von 1 bis 3 pro Minute erfolgten, bei –70 mV gehalten. Die Analyse der Daten, einschließlich der exponentiellen Extrapolation der Stromkurven, erfolgte unter Verwendung von pCLAMP. Die Anpassung der Daten an eine Boltzmann-Funktion oder an eine konstante Feldgleichung nach Goldman-Hodgkin-Katz (Goldman, 1943; Goldman und Katz, 1949) erfolgte unter Verwendung von Kaleidagraph (Synergy Software). Die Daten sind als Mittelwert ± SEM angegeben (n = Anzahl der Oocyten).

LISTE DER REFERENZEN

  • Anderson, et al. (1980). Proc. Natl. Acad. Sci. USA 77, 5399-5403.
  • Antzelevitch, C. and Sicouri, S. (1994). J. Am. Col. Card. 23, 259-277.
  • Ashford, M. L. J., et al. (1994). Nature 370, 456-459.
  • Attwell, D., et al. (1979). Pflugers Arch. 379, 137-142.
  • Ausubel, F.M., et al. (1992). Current Protocols in Molecular Biology, (J. Wiley and Sons, N.Y.)
  • Balser, J. R., et al. (1990). J. Gen. Physiol. 96, 835-863.
  • Bazette, H. C. (1920). Heart 7, 353-370.
  • Beaucage & Carruthers (1981). Tetra. Letts. 22, 1859-1862.
  • Benhorin, J., et al. (1993). Science 260, 1960-1962.
  • Berkner, et al. (1988). BioTechniques 6, 616-629.
  • Berkner (1992). Curr. Top. Microbiol. Immunol. 158, 39-61.
  • Blumenthal, E. M. and Kaczmarek, L. K. (1992). J. Neuroscience 12, 290-296.
  • Bonner, T. I., et al. (1987). Science 237, 527-532.
  • Brandyopadhyay and Temin (1984). Mol. Cell. Biol. 4, 749-754.
  • Breakfield and Geller (1987). Mol. Neurobiol. 1, 337-311.
  • Brinster, et al. (1981). Cell 27, 223-231.
  • Bruggemann, A., et al. (1993). Nature 365, 445-448.
  • Buchschacher and Panganiban (1992). J. Virol. 66, 2131-2739.
  • Capecchi, M.R. (1989). Science 244,1288.
  • Cariello (1988). Human Genetics 42, 726.
  • Carmeliet, E. (1992). J. Pharm. Exp. Ther. 262, 809-817.
  • Chin, H., et al. (1991). Genomics 11, 914-919.
  • Chinn, K. (1993). J. Pharmacol. Exp. Therap. 264, 553-560.
  • Conner, B.J., et al. (1983). Proc. Natl. Acad Sci. USA 80, 278-282.
  • Constantini and Lacy (1981). Nature 194, 92-94.
  • Cotten, et al. (1990). Proc. Natl. Acad. Sci. USA 87, 4033-4037.
  • Cotton, et al. (1988). Proc. Natl. Acad. Sci. USA 85, 4397.
  • Covarrubias, M., et al. (1991). Neuron 7, 763-773.
  • Curiel, et al. (1991a). Hum. Gene Ther. 3, 147-154.
  • Curiel, et al. (19916). Proc. Natl. Acad. Sci. USA 88, 8850-8854.
  • Curran, M. E., et al. (1993a). Cell 73, 159-168.
  • Curran, M. E., et al. (1993b). J. Clin. Invest. 92, 799-803.
  • Curran, M. E., et al. (1995). Cell 80, 795-804.
  • Curry, P., et al. (1976). Lancet II, 231-233..
  • Donehower, L.A., et al. (1992). Nature 356, 215.
  • Dumont. J. N. (1972). J. Morphol. 136, 153-180.
  • Ebers, G. C., et al. (1991). Ann. Neurol. 30, 810-816.
  • Enhancers and Eukaryotic Gene Expression, Cold Spring Harbor Press, Cold Spring Harbor, New York (1983).
  • Fakler, B., et al. (1995). Cell 80, 149-154.
  • Feinberg, A. P. and Vogelstein, B. A. (1983). Anal. Biochem. 132, 6-13.
  • Felgner, et al. (1987). Proc. Natl. Acad. Sci. USA 84, 7413-7417.
  • Fiers, et al. (1978). Nature 273, 113.
  • Fink, et al. (1992). Hum. Gene Ther. 3, 11-19.
  • Finkelstein, J., et al. (1990). Genomics 7, 167-172.
  • Follmer, C. H., et al. (1992). Am. J. Physiol. 262, C75-C83.
  • Fontaine, B., et al. (1990). Science 250, 1000-1002.
  • Freese, et al. (1990). Biochem. Pharmacol. 40, 2189-2199.
  • Friedman, T. (1991). In Therapy for Genetic Diseases, T. Friedman, ed., Oxford University Press, pp. 105-121.
  • Gellens, M., et al. (1992). Proc. Natl. Acad. Sci. USA 89, 554-558.
  • George, A.L., et al. (1995). Cytogenet. Cell. Genet. 68, 67-70.
  • Gintant, G.A., et al. (1992). Time-dependent Outward Currents in the Heart. In The Heart and Cardiovascular System, H.A. Fozzard, R.B. Jennings, E. Haber, A.M. Katz and H.E. Morgan (eds.). New York, Raven Press, pp. 1121-1169.
  • Goldman, D. E. (1943). J. Gen. Physiol. 27, 37-60.
  • Gordon, et al. (1980). Proc. Natl. Acad. Sci. USA 77, 7380-7384.
  • Gorziglia and Kapikian (1992). J. Virol. 66, 4407-4412.
  • Graham and van der Eh (1973). Virology 52, 456-467.
  • Green, E. D., et al. (1994). Hum. Mol. Genet. 3, 489-501.
  • Green, E. D., et al. Genomics, in press.
  • Grompe, M., 1993. Nature Genetics 5, 111-117.
  • Grompe, M., et al., 1989. Proc. Natl. Acad. Sci. USA 86, 5855-5892.
  • Gyapay, G., et al. (1994). Nat. Genet. 7, 246-339.
  • Harlow & Lane (1988). Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).
  • Hasty, P., K., et al. (1991). Nature 350, 243.
  • Heginbotham, L., et al. (1994). Biophys. J. 66, 1061-1067
  • Helseth, et al. (1990). J. Virol. 64, 2416-2420.
  • Hodgkin, A. L. and Katz. B. (1949). J. Physiol (Lond.) 108, 37-77.
  • Honerjager, P. (1982). Rev. Physiol. Biochem. Pharmacol. 92, 1-74.
  • Innis et al. (1990). PCR Protocols: A Guide zu Methods and Applications, (Academic Press, San Diego, Cal.).
  • Jablonski, E., et al. (1986). Nuc. Acids Res. 14, 6115-6128.
  • Jakoby, W.B. and Pastan, I.H. (eds.) (1979). Cell Culture. Methods in Enzymology, volume 58 (Academic Press, Inc., Harcourt Brace Jovanovich (New York)).
  • January, C. T. and Riddle, J. M. (1989). Circ. Res. 64, 977-990.
  • Jervell, A. and Lange-Nielson, F. (1957). Am. Heart J. 54, 59-78.
  • Jiang, C., et al. (1994). Nat. Genet. 8, 141-147.
  • Johnson, et al. (1992). J. Virol. 66, 2952-2965.
  • Jurkiewicz, N. K and Sanguinetti, M. C. (1993). Circ. Res. 72, 75-83.
  • Kaneda, et al. (1989). J. Biol. Chem. 264, 12126-12129.
  • Kanehisa (1984). Nucl. Acids Res. 12, 203-213.
  • Kannel, W. B., et al. (1987). Am. Heart J. 113, 799-804.
  • Keating, M. T., et al. (1991a). Science 252, 704-706.
  • Keating, M. T., et al. (19916). Am. J. Hum. Genet. 49, 1335-1339.
  • Keating, M. T. (1992). Circulation 85, 1973-1986.
  • Kinszler, K.W., et al. (1991). Science 251, 1366-1310.
  • Koch, M. C., et al. (1992). Science 257, 797-800.
  • Kohler, G. and Milstein, C. (1975). Nature 256, 495-497.
  • Kraemer, F.B. et al. (1993). J. Lipid Res. 34, 663-672.
  • Kubo, T., et al. (1988). FEBS Letts. 241, 119.
  • Landegren, et al. (1988). Science 142, 229.
  • Lathrop. G. M., et al. (1985). Am. J. Hum. Genet. 37, 482-498.
  • Lerche, H., et al. (1993). J. Physiol. 470, 13-22.
  • Lichter, P., et al. (1988). Hum. Genet. 80, 224-234.
  • Lim, et al. (1992). Circulation 83, 2007-2011.
  • Lopez-Barneo, J., et al. (1993). Receptors and Channels 1, 61-71.
  • Ludwig, J., et al. (1994). EMBO J. 13, 4451-4458.
  • Lynch, J. J., et al. (1994). J. Pharmacol. Exp. Ther. 269, 541-554.
  • MacKinnon, R. (1991). Nature 350, 232-235.
  • MacKinnon, R., et al. (1993). Science 262, 757-759.
  • Madzak, et al. (1992). J. Gen. Virol. 73, 1533-1536.
  • Magovcevic, I., et al. (1992). Genomics 12, 125-129.
  • Maniatis, T. et al. (1982). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).
  • Mann and Baltimore (1985). J. Virol. 54, 401-407.
  • Marchuk, D., et al. (1990). Nucl. Acids Res. 19, 1154.
  • Margolskee (1992). Curr. Top. Microbiol. Immunol. 158, 67-90.
  • Martin, R., et al. (1990). BioTechniques 9, 762-768.
  • Matteucci, M.D. and Caruthers, M.H. (1981). J. Am. Chem. Soc. 103, 3185.
  • Matthews & Kricka (1988). Anal. Biochem. 169, 1.
  • McClatchey, A., et al. (1992a). Hum. Mol. Genet. 1, 521-527.
  • McClatchey, A., et al. (1992b). Cell 68, 769-774.
  • McClatchey, A., et al. (1992c). Nature Genet. 2, 148-152.
  • Mettlin, C., et al. ((990). American Journal of Epidemiology 131, 973-983.
  • Metzger. et al. (1988). Nature 334. 31-36.
  • Miller (1992). Curr. Top. Microbiol. Immunol. 158, 1-24.
  • Miller, et al. (1985). Mol. Cell. Biol. 5, 431-437.
  • Millier, et al. (1988). J. Virol. 62, 4337-4345.
  • Modrich, P. (1991). Ann. Rev. Genet. 25, 229-253.
  • Mombaerts, P., et al. (1992). Cell 68, 869.
  • Moss, A.J., et al. (1991). Circulation 84, 1136-1144.
  • Moss (1992). Curr. Top. Microbiol. Immunol. 158, 25-38.
  • Muzyczka (1992). Curr. Top. Microbiol. Immunol. 158, 97-123.
  • Nabel, et al. (1990). Science 249, 1285-1288.
  • Nabel (1992). Hum. Gene Ther. 3, 399-410.
  • Newton, C.R., et al. (1989). Nucl. Acids Res. l7, 2503-2516.
  • Nguyen, Q., et al. (1992). BioTechniques 13, 116-123.
  • Novack, et al. (1986). Proc. Natl. Acad. Sci. USA 83, 586.
  • Ohi, et al. (1990). Gene 89, 279-282.
  • Orita, M., et al. (1989). Proc. Natl. Acad. Sci. USA 86, 2766-2770.
  • Page, et al. (1990). J. Virol. 64, 5370-5276.
  • Pardo, L. A., et al. (1992). Proc. Natl. Acad. Sci. USA 89, 2466-2470.
  • Pellicer, et al. (1980). Science 209, 1414-1422.
  • Petropoulos, et al. (1992). J. Virol. 66, 3391-3397.
  • Philpott, K.L., et al. (1992). Science 136,1448.
  • Ptacek, L. J., et al. (1991). Cell 67, 1021-1027.
  • Ptacek, L.J., et al. (1992). Neuron 8, 891-897.
  • Quantin. et al. (1993). Proc. Natl. Acad. Sci. USA 89, 2581-2584.
  • Rano & Kidd (1989). Nucl. Acids Res. 17, 8392.
  • Rigby, P.W.J., et al. (1977). J. Mol. Biol. 113, 237-251.
  • Roden, D.M. (1988). Arrhythmogenic Potential of Class III Antiarrhythmic Agents: Comparison with Class I Agents. In Control of Cardiac Arrhythmias by Lengthening Repolarization, B.N. Singh (ed.). Mt. Kisco, NY, Futura Publishing Co., pp. 559-576.
  • Rojas, C., et al. (1991). Natur 354, 387-389.
  • Romano, C. (1965). Congenital cardiac arrhythmia. Lancet 1658-659.
  • Rosenfeld, et al. (1992). Cell 68, 143-155.
  • Roy, N., et al. (1994). Nat. Genet. 8, 113-114.
  • Rudolph, J. A., et al. (1992). Nature Genet. 2, 144-147.
  • Sambrook, J., et al. (1989). Molecular Cloning: A Laboratory Manual, 2nd Ed. (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).
  • Sanguinetti, M. C, and Jurkiewicz, N. K. (1990). Am. J. Physiol. 259, H1881-H1889.
  • Sanguinetti, M. C. and Jurkiewicz, N. K. (1990). J. Gen. Physiol. 96, 195-215.
  • Sanguinetti, M. C. and Jurkiewicz, N. K. (1991). Am. J. Physiol. 260, H393-H399.
  • Sanguinetti, M. C. and Jurkiewicz, N. K. (1992). Pflugers Archiv 420, 180-186.
  • Sanguinetti, M. C., et al. (1991). Circ. Res. 68, 77-84.
  • Scamps, F. and Carmeliet, E. (1989). Am. J. Physiol. 257, C1086-C1092.
  • Schwartz, P. J., et al. (1975). Am. Heart J. 109, 378-390.
  • Schwartz, P. J., et al. (1994). The long QT syndrome. In Cardiac Electrophysiology: from cell zu bedside. D. P. Zipes and J. Jalife eds. (W.B. Sanden Company) pp.788-811.
  • Seino, S., et al. (1992). Genomics 13, 1375-1377.
  • Sheffield, V.C., et al. (1989). Proc. Natl. Acad. Sci. USA 86, 232-236.
  • Sheffield, V.C., et al., 1991. Am. J. Hum. Genet. 49, 694-706.
  • Shibasaki, T. (1987). J. Physiol. 387, 227-250.
  • Shimada, et al. (1991). J. Clin. Invest. 88, 1043-1047.
  • Shinkai, Y., et al. (1992). Cell 68, 855.
  • Snouwaert, J.N., et al. (1992). Science 257,1083.
  • Sorge, et al. (1984). Mol. Cell. Biol. 4, 1730-1737.
  • Sternberg, N. (1990). Proc. Natl. Acad. Sci. USA 87, 103-107.
  • Stewart, et al. (1992). Hum. Gene Ther. 3, 267-275.
  • Stratford-Perricaudet, et al. (1990). Hum. Gene Ther. 1, 241-256.
  • Stuhmer, W., et al. (1989). Nature 339, 597-603.
  • Surawicz, B. (1989). J. Am. Coll. Cardiol. 14, 172-184.
  • Towbin, J. A., et al. (1994). Circulation 90, 2635-2644.
  • Temple, B. L., et al. (1987). Science 237, 170-775.
  • Valancius, V. & Smithies, O. (1991). Mol. Cell Biol. 11, 1402.
  • Vandenberg, C. A. (1987). Proc. Natl. Acad. Sci. USA 84, 2560-2564.
  • Vincent, G. M., et al. (1992). N. Engl. J. Med. 327, 846-852.
  • Wagner, et al. (1991). Proc. Natl. Acad. Sci. USA 88, 4255-4259.
  • Wagner, et al. (1990). Proc. Natl. Acad. Sci. USA 87, 3410-3414.
  • Wang and Huang (1989). Biochemistry 28, 9508-9514.
  • Wang, Q. and Keating, M. T. (1994). BioTechniques 17, 282-284.
  • Wang, Q., et al. (1995). Cell 80, 805-811.
  • Ward, O. C. (1964). J. Ir. Med. Assoc. 54, 103-106.
  • Warmke, J. E. and Ganetzky, B. (1994). Proc. Natl. Acad. Sci. 91, 3438-3442.
  • Wartell. R. M., et al. (1990). Nucl. Acids Res. 18, 2649-2705.
  • Weinstein. L. S., et al. (1988). FEBS Letters 232, 333-340.
  • West, J., et al. (1992). Proc. Natl. Acad. Sci. USA 89, 10910-10914.
  • Wetmur & Davidson (1968). J. Mol. Biol. 31, 349-370.
  • White, M. B., et al. (1992). Genomics 12, 301-306.
  • Wilkinson, et al. (1992). Nucleic Acids Res. 20, 2233-2239.
  • Willich, S. N., et al. (1987). Am. J. Cardiol: 60, 801-806.
  • Wolff, et al. (1990). Science 247, 1465-1468.
  • Wolff, et al. (1991). BioTechiques 11, 474-485.
  • Wu, et al. (1989). J. Biol. Chem. 264, 16985-16987.
  • Wu; et al. (1991). J. Biol. Chem. 266, 14338-14342.
  • Yang, N., et al. (1994). Proc. Natl. Acad. Sci. USA 91, 12785-12789.
  • Yang, T., et al. (1994). Circ. Res. 75, 870-878.
  • Zenke, et al. (1990). Proc. Natl. Acad. Sci. USA 87, 3655-3659.
  • Zipes, D. P. (1987). Am. J. Cardiol. 59, 26E-31E.

Patente und Patentanmeldungen

  • European Patent Application Publication No. 0332435.
  • EPO Publication No. 225,807.
  • Hitzeman et al., EP 73,675A.
  • PCT published application WO 93/07282.
  • U.S. Patent 4,376,110.
  • U.S. Patent 4,486,530.
  • U.S. Patent 4,868,105.
  • U.S. Patent 5,252.479.


Anspruch[de]
Eine isolierte DNA, die im wesentlichen aus DNA besteht, die für ein mutiertes SCN5A Polypeptid kodiert, welches verlängertes QT Syndrom (long QT syndrome) auslöst, wobei besagtes mutiertes SCN5A Polypeptid eine Mutation beinhaltet, bei der es sich um die Änderung eines oder mehrerer beliebiger Nukleotide handelt, die die Aminosäurereste 1505, 1506 oder 1507 des SCN5A Polypeptides kodieren, wobei die Änderung ausgewählt ist aus Deletion, Insertion und Punktmutation. Eine isolierte DNA gemäß Anspruch 1, wobei besagte Mutation die Deletion der Aminosäurereste 1505-1507 des SCN5A Polypeptides ist. Eine isolierte DNA, die im wesentlichen aus DNA besteht, die für ein mutiertes HERG Polypeptid kodiert, welches verlängertes QT Syndrom (long QT syndrome) auslöst, wobei besagtes mutiertes HERG Polypeptid durch eine Mutation in einem HERG Gen entsteht, welches mindestens eine der Mutationen aus der folgenden Gruppe umfasst: eine Deletion der Basen 1498-1524, eine Deletion der Base 1261, die Anwesenheit eines T anstelle eines C an Basenposition 1682, die Anwesenheit eines G anstelle eines A an Basenposition 1408, die Anwesenheit eines A anstelle eines G an Basenposition 1882 und die Anwesenheit eines C anstelle eines G am Anfang der Spleißdonorstelle von Intron III. Eine Nukleinsäureprobe, die an die DNA gemäß Anspruch 1 oder Anspruch 2 hybridisieren wird, aber nicht an DNA, die ein Wildtyp-SCN5A kodiert, hybridisieren wird. Eine Nukleinsäureprobe, die an die DNA gemäß Anspruch 3, welche für ein mutiertes HERG Polypeptid kodiert, hybridisieren wird, aber nicht an DNA, die ein Wildtyp-HERG kodiert, hybridisieren wird. Ein Verfahren zur Diagnose eines Polymorphismus, der verlängertes QT Syndrom (long QT syndrome) auslöst, das die Hybridisierung der Probe nach einem der Ansprüche 4 oder 5 an eine Patientenprobe aus DNA oder RNA umfasst, unter Bedingungen, die nur Hybridisierungsprodukte ermöglichen, die vollständig komplementär sind in dem Bereich, in dem die Mutation sich bildet, und die Bestimmung der Anwesenheit oder Abwesenheit eines Signals, welches auf ein Hybridisierungsprodukt hinweist, wobei die Anwesenheit eines Hybridisierungssignals auf das Vorliegen von verlängertem QT Syndrom (long QT syndrome) hinweist. Ein Verfahren gemäß Anspruch 6, wobei die DNA oder RNA des Patienten amplifiziert wurde und besagte amplifizierte DNA oder RNA mit besagter Probe hybridisiert wird. Ein Verfahren gemäß Anspruch 7, wobei die Hybridisierung an situ stattfindet. Ein Verfahren zur Diagnose eines Polymorphismus, der verlängertes QT Syndrom (long QT syndrome) auslöst, das die Amplifizierung eines Bereichs eines SCN5A Gens oder einer SCN5A RNA, welcher Aminosäuren 1505-1507 kodiert, die Größenerfassung des amplifizierten Bereichs und die Bestimmung, ob eine Deletion aufgetreten ist, umfasst, wobei besagte Deletion auf verlängertes QT Syndrom (long QT syndrome) hinweist. Das Verfahren gemäß Anspruch 9, wobei Primer, die den SEQ ID Nr. 40 und 41 entsprechen, zur Amplifikation besagten Bereichs des SCN5A Gens verwendet werden. Ein Verfahren zur Diagnose einer Mutation, die verlängertes QT Syndrom (long QT syndrome) auslöst, das die Amplifikation eines Bereichs eines HERG Gens oder einer HERG RNA, welcher Aminosäurereste 500-508 kodiert, die Größenerfassung des amplifizierten Bereichs und die Bestimmung, ob eine Deletion aufgetreten ist, umfasst, wobei besagte Deletion auf das verlängerte QT Syndrom (long QT syndrome) hinweist. Das Verfahren gemäß Anspruch 11, wobei Primer, die den SEQ ID Nr. 23 und 28 entsprechen, zur Amplifikation besagten Bereichs des HERG Gens verwendet werden. Ein Verfahren zur Diagnose eines Polymorphismus, der verlängertes QT Syndrom (long QT syndrome) auslöst, das die Amplifizierung eines Bereichs eines HERG Gens oder einer HERG RNA, welcher die Basenposition 1261 umgibt, und die Bestimmung, ob eine Deletion aufgetreten ist, umfasst, wobei besagte Deletion auf verlängertes QT Syndrom (long QT syndrome) hinweist. Das Verfahren gemäß Anspruch 13, wobei Primer, die den SEQ ID Nr. 21 und 29 entsprechen, zur Amplifikation besagten Bereichs des HERG Gens verwendet werden. Ein Verfahren zur Diagnose eines Polymorphismus, der verlängertes QT Syndrom (long QT syndrome) auslöst, wobei besagter Polymorphismus ausgewählt ist aus einer Änderung ein oder mehrerer beliebiger Nukleotide, die Aminosäurereste 1505, 1506 oder 1507 des SCN5A Polypeptids kodieren, wobei die Änderung ausgewählt ist aus Deletion, Insertion und Punktmutation; einer Deletion der Basen 1498-1524 von HERG; einer Deletion der Base 1261 von HERG; einem T anstelle eines C an der Base 1682 von HERG; einem G anstelle eines A an der Base 1408 von HERG; einem A anstelle eines G an der Base 1882 von HERG; und einem C anstelle eines G am Anfang der Spleißdonorstelle von Intron III von HERG, wobei besagtes Verfahren die Detektion eines Polymorphismus unter Verwendung der Einzelstrang-Konformations-Polymorphismus-Technik (single-stranded conformation polymorphism technique) umfasst. Das Verfahren gemäß Anspruch 15, wobei Primer, die den SEQ ID Nr. 40 und 41 entsprechen, zur Diagnose eines Polymorphismus in SCN5A verwendet werden und ein Primerpaar ausgewählt aus der Gruppe bestehend aus (i) SEQ ID Nr. 23 und 29; (ii) SEQ ID Nr. 23 und 28; (iii) SEQ ID Nr. 21 und 29; (iv) SEQ ID Nr. 25 und 31; und (v) SEQ ID Nr. 24 und 32 zur Diagnose eines Polymorphismus in HERG verwendet wird. Das Verfahren gemäß Anspruch 16, wobei eine 9-Basenpaar Deletion in SCN5A erkannt wird, wobei besagte 9-Basenpaar Deletion auf verlängertes QT Syndrom (long QT syndrome) hinweist. Ein Verfahren zur Diagnose eines Polymorphismus, der verlängertes QT Syndrom (long QT syndrome) auslöst, das die Amplifikation eines Bereichs des SCN5A Gens oder der SCN5A RNA, welcher Aminosäuren 1505-1507 kodiert, und die Sequenzierung des amplifizierten Gens oder der amplifizierten RNA umfasst, wobei eine Änderung oder eine Deletion der DNA oder RNA, die zu einer Änderung oder Deletion einer oder mehrerer beliebiger Aminosäurereste 1505-1507 führt, auf verlängertes QT Syndrom (long QT syndrome) hinweist. Ein Verfahren zur Diagnose eine Mutation, die verlängertes QT Syndrom (long QT syndrome) auslöst, das die Amplifikation eines Bereichs des HERG Gens oder der HERG RNA und die Sequenzierung des amplifizierten Gens oder der amplifizierten RNA umfasst, wobei auf verlängertes QT Syndrom (long QT syndrome) hingewiesen wird durch eine oder mehrere beliebige Mutationen der folgenden Gruppe: eine Deletion der Basenpaare 1498-1524, eine Deletion, die aus dem Basenpaar 1261 besteht, ein T an der Basenposition 1682, ein G an der Basenposition 1408, ein C am Anfang der Spleißdonorstelle des Intron III und ein A an der Basenposition 1882. Ein Verfahren zur Diagnose eines Polymorphismus, der verlängertes QT Syndrom (long QT syndrome) auslöst, das die Identifizierung einer fehlerhaften Basenpaarung (mismatch) zwischen der DNA des SCN5A Gens oder RNA eines Patienten und einer Wildtyp-DNA- oder RNA-Probe umfasst, wobei besagte Probe an einen Bereich der DNA hybridisiert, der die Aminosäurereste 1505-1507 des SCN5A Polypeptides kodiert. Ein Verfahren zur Diagnose einer Mutation, die verlängertes QT Syndrom (long QT syndrome) auslöst, das die Identifizierung einer fehlerhaften Basenpaarung (mismatch) zwischen der DNA des HERG Gens oder HERG RNA eines Patienten und einer Wildtyp DNA- oder RNA-Probe umfasst, wobei besagte Probe an einen Bereich der DNA oder RNA hybridisiert, wobei besagter Bereich ein beliebiger aus der folgenden Gruppe ist: ein Bereich, der die Basen 1498-1524 umfasst, ein Bereich, der die Base 1261 umfasst, ein Bereich, der die Base 1682 umfasst, ein Bereich, der die Base 1408 umfasst, ein Bereich, der die Base 1882 umfasst, und ein Bereich, der eine Spleißdonorstelle von Intron III umfasst. Das Verfahren gemäß Anspruch 20 oder 21, wobei die fehlerhafte Basenpaarung (mismatch) durch einen RNase-Test bestimmt wird. Ein Verfahren zur Diagnose von verlängertem QT Syndrom (long QT syndrome), wobei besagtes Verfahren die Sequenzierung des SCN5A Polypeptids umfasst, wobei eine Mutation in besagtem Polypeptid auf verlängertes QT Syndrom (long QT syndrome) hinweist, wobei besagte Mutation in besagtem Polypeptid eine Deletion ist, die die Aminosäuren 1505-1507 umfasst. Ein Verfahren zur Diagnose von verlängertem QT Syndrom (long QT syndrome), wobei besagtes Verfahren die Sequenzierung eines HERG Polypeptids umfasst, wobei eine Mutation in besagtem Polypeptid auf verlängertes QT Syndrom (long QT syndrome) hinweist, wobei besagte Mutation in besagtem Polypeptid durch eine DNA Mutation hervorgerufen wird, wobei besagte DNA Mutation ausgewählt ist auf der Gruppe bestehend aus: Deletion der Basen 1498-1524, Deletion der Base 1261, Substitution eines C durch ein T an der Base 1682, Substitution eines A durch ein G an der Base 1408, Substitution eines G durch ein A an der Base 1882 und Substitution eines G durch ein C am Anfang der Spleißdonorstelle von Intron III. Ein Antikörper, der an ein mutiertes HERG Polypeptid aber nicht an ein Wildtyp-HERG Polypeptid bindet, wobei besagtes mutiertes HERG Polypeptid aus einer der Mutationen aus der folgenden Gruppe resultiert: Deletion der Basen 1498-1524, Deletion der Base 1261, Substitution eines C durch ein T an der Base 1682, Substitution eines A durch ein G an der Base 1408, Substitution eines G durch ein A an der Base 1882 und Substitution eines G durch ein C am Beginn der Spleißdonorstelle von Intron III. Ein Antikörper, der an ein mutiertes SCN5A Polypeptid, aber nicht an ein Wildtyp-SCN5A Polypeptid bindet, wobei besagtes mutiertes SCN5A Polypeptid aus der Deletion von DNA resultiert, die Aminosäuren 1505-1507 kodiert. Ein Antikörper gemäß Anspruch 25 oder 26, wobei besagter Antikörper ein monoklonaler Antikörper ist. Ein Verfahren zur Diagnose des verlängerten QT Syndroms (long QT syndrome), wobei besagtes Verfahren in einem Test auf das Vorliegen eines mutierten SCN5A oder HERG Polypeptides in einem Patienten besteht, bei dem man einen Antikörper gemäß einem der Ansprüche 25 bis 27 mit einer Patientenprobe reagieren läßt, wobei das Vorliegen einer positiven Reaktion auf verlängertes QT Syndrom (long QT syndrome) hinweist. Ein isoliertes SCN5A Polypeptid, wobei besagtes mutiertes SCN5A Polypeptid eine Mutation in einem SCN5A Gen umfasst, wobei besagte Mutation in besagtem SCN5A Gen in einer Deletion der Basen besteht, die Aminosäuren 1505-1507 des besagten SCN5A Polypeptids kodieren. Ein isoliertes HERG Polypeptid, wobei besagtes mutiertes HERG Polypeptid eine Mutation in einem HERG Gen umfasst, wobei besagte Mutation in besagtem HERG Gen ausgewählt ist aus der Gruppe bestehend aus: Deletion der Basen 1498-1524, Deletion der Base 1261, Substitution eines C durch ein T an der Base 1682, Substitution eines A durch ein G an der Base 1408, Substitution eines G durch ein A an der Base 1882 und Substitution eines G durch ein C am Anfang der Spleißdonorstelle von Intron III.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com