PatentDe  


Dokumentenidentifikation DE69835209T2 23.11.2006
EP-Veröffentlichungsnummer 0000991764
Titel REGULATORISCHE SEQUENZEN FÜR TRANSGENE PFLANZEN
Anmelder Dow AgroSciences LLC, Indianapolis, Ind., US
Erfinder AINLEY, Michael, Carmel, IN 46032, US;
ARMSTRONG, Katherine, Zionsville, IN 46077, US;
BELMAR, Scott, Indianapolis, IN 46268, US;
FOLKERTS, Otto, Guilford, CT 06437, US;
HOPKINS, Nicole, Indianapolis, IN 46268, US;
MENKE, A., Michael, Indianapolis, IN 46219, US;
PAREDDY, Dayakar, Carmel, IN 46033, US;
PETOLINO, F., Joseph, Zionsville, IN 46077, US;
SMITH, Kelley, Lebanon, IN 46052, US;
WOOSLEY, Aaron, Fishers, IN 46038, US
Vertreter Weickmann & Weickmann, 81679 München
DE-Aktenzeichen 69835209
Vertragsstaaten CH, DE, DK, FR, GB, IT, LI, NL
Sprache des Dokument EN
EP-Anmeldetag 10.06.1998
EP-Aktenzeichen 989264692
WO-Anmeldetag 10.06.1998
PCT-Aktenzeichen PCT/US98/11921
WO-Veröffentlichungsnummer 1998056921
WO-Veröffentlichungsdatum 17.12.1998
EP-Offenlegungsdatum 12.04.2000
EP date of grant 12.07.2006
Veröffentlichungstag im Patentblatt 23.11.2006
IPC-Hauptklasse C12N 15/53(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 15/82(2006.01)A, L, I, 20051017, B, H, EP   A01H 5/00(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]

Diese Erfindung betrifft die Gentechnik bei Pflanzen. Insbesondere stellt die Erfindung DNA-Sequenzen und Konstrukte bereit, welche für die Kontrolle bzw. Steuerung der Expression von rekombinanten Genen in Pflanzen verwendbar sind. In speziellen erfindungsgemäßen Konstrukten werden neue regulatorische Sequenzen verwendet, welche von einem Maiswurzel-bevorzugenden kationischen Peroxidasegen abgeleitet sind.

Durch die Verwendung der rekombinanten DNA-Technologie und der Gentechnik ist es möglich geworden, gewünschte DNA-Sequenzen in Pflanzenzellen einzubringen, um die Expression von Proteinen von Interesse zu ermöglichen. Jedoch bleibt das Erreichen von gewünschten Expressionsniveaus eine Herausforderung. Um agronomisch bedeutende Genen in Kulturpflanzen mit dem gewünschten Niveau mittel Gentechnik zu exprmieren, ist die Fähigkeit erforderlich, die regulatorischen Mechanismen, welche die Expression in Pflanzen regulieren, zu kontrollieren bzw. steuern, und dies erfordert den Zugriff auf geeignete regulatorische Sequenzen, welche mit den Genen verbunden werden können, deren Expression gewünscht ist.

Ein bestimmtes Projekt kann die Verwendung von mehreren unterschiedlichen Expressionselementen erfordern, beispielsweise eine Gruppe, um ein Gen eines selektierbaren Markers oder ein Reportergen zu steuern und ein anderes, um das Gen von Interesse zu steuern. Der selektierbare Marker muss nicht notwendigerweise das gleiche Expressionsniveau oder Expressionsmuster erfordern, welches für das Gen von Interesse erforderlich ist. In Abhängigkeit von dem bestimmten Projekt kann ein Bedarf an einer konstitutiven Expression vorliegen, welche die Transkription in den meisten oder allen Geweben zu jedem Zeitpunkt steuert, oder es kann ein Bedarf an einer gewebespezifischen Expression vorliegen. Beispielsweise wäre eine wurzelspezifische Expression oder eine wurzelbevorzugende („root preferential") Expression in Mais für eine Verwendung bei der Expression eines Proteins höchst wünschenswert, welches für Schädlinge toxisch ist, welche die Wurzeln von Mais angreifen.

Zellen verwenden eine Anzahl von regulatorischen Mechanismen, um zu kontrollieren bzw. zu steuern, welche Gene exprimiert werden und mit welchem Niveau sie exprimiert werden. Die Regulierung kann auf Transkriptionsebene oder nach der Transkription stattfinden und kann beispielsweise Mechanismen umfassen zum Verstärken, Beschränken oder Verhindern der Transkription der DNA, ebenso wie Mechanismen, welche die Lebensdauer der mRNA beschränken, nachdem diese erzeugt wurde. Die in diese regulatorischen Prozesse einbezogenen DNA-Sequenzen können stromaufwärts, stromabwärts oder sogar zwischen den Struktur-DNA-Sequenzen lokalisiert sein, welche für das Proteinprodukt eines Gens codieren.

Die Initiation der Transkription eines Gens wird durch eine Sequenz reguliert, welche der Promotor genannt wird, welche stromaufwärts (5') der codierenden Sequenz liegt. Eukaryontische Promotoren enthalten im Allgemeinen etwa 10-35 Basenpaare (bp) stromaufwärts der Transkriptionsstartstelle (CAP) eine Sequenz mit einer Homologie zu der Konsensussequenz 5'-TATAAT-3' (TATA-Box). Die meisten Maisgene besitzen eine TATA-Box, welche sich 29 bis 34 Basenpaare stromaufwärts der CAP-Stelle befindet. In den meisten Fällen ist die TATA-Box für eine fehlerfreie Transkriptionsinitiation erforderlich. Weiter stromaufwärts, oft zwischen -80 und -100, kann ein Promotorelement mit einer Homologie zu der Konsensussequenz CCAAT vorliegen. Diese Sequenz ist in vielen Spezies, einschließlich Mais, nicht gut konserviert. Jedoch scheinen Gene, welche diese Sequenz aufweisen, effizient exprimiert zu werden. In Pflanzen ist die CCAAT-"Box" manchmal durch die AGGA-"Box" ersetzt. Andere Sequenzen, welche eine Gewebespezifität, eine Reaktion auf Umweltsignale oder eine maximale Transkriptionseffizienz verleihen, sind möglicherweise zwischen diesen Promotorelementen zu finden und können ferner in der 5'-Richtung von der CAP-Stelle gefunden werden.

Solche Sequenzen sind oft innerhalb von 400 bp bei der CAP-Stelle zu finden, können sich jedoch bis zu 1000 bp oder mehr erstrecken.

Promotoren können in zwei allgemeine Kategorien eingeteilt werden. "Konstitutive" Promotoren werden in den meisten Geweben die meiste Zeit über exprimiert. Die Expression von einem konstitutiven Promotor erfolgt mehr oder weniger während der gesamten Entwicklung mit einem andauernden Niveau. Oft werden Gene, welche für Proteine mit Hauskeeping-Funktionen codieren, von konstitutiven Promotoren gesteuert. Beispiele für konstitutiv exprimierte Gene bei Mais umfassen Actin und Ubiquitin. Wilmink et al. (1995). "Regulierte" Promotoren werden normalerweise nur in bestimmten Gewebearten (gewebespezifische Promotoren) oder zu bestimmten Zeiten während der Entwicklung (temporäre Promtoren) exprimiert. Beispiele für gewebespezifische Gene bei Mais umfassen die Zeine (Kriz et al., (1987)), welche reichlich vorhandene Lagerproteine sind, die nur im Endosperm von Samen zu finden sind. Viele Gene in Mais werden durch Promotoren reguliert, welche sowohl gewebespezifisch als auch temporär spezifisch sind.

Es ist gezeigt worden, dass Promotoren verwendet werden können, um die Expression von fremden Genen in transgenen Pflanzen in einer Art und Weise zu kontrollieren bzw. steuern, welche ähnlich ist zu dem Expressionsmuster des Gens, von welchem der Promotor ursprünglich stammt. Der am gründlichsten charakterisierte Promotor, welcher mit rekombinanten Genen in Pflanzen untersucht wurde, war der 35S-Promotor des CaMV-Virus („Cauliflower Mosaic Virus") sowie dessen Derivate. US-Patent Nr. 5,352,065, Wilmink et al. (1995), Datla et al. (1993). Von Benfey et al. (1984) durchgeführte elegante Untersuchungen ergaben, dass der CaMV 35S-Promotor im Hinblick auf die Bindung an Transkriptionsaktivatoren eine modulare Natur aufweist. US-Patent Nr. 5,097,025; Benfey et al. (1989) und (1990). Zwei unabhängige Domänen ergeben die Transkriptionsaktivierung, welche von vielen als konstitutiv beschrieben worden ist. Der 35S-Promotor wird in den meisten Dikotyledonen sehr effizient exprimiert, und wird in Monokotyledonen mäßig exprimiert. Der Zusatz von Enhancerelementen zu diesem Promotor hat die Expressionsmengen in Mais und anderen Monokotyledonen gesteigert. Konstitutive Promotoren mit monokotyledonem Ursprung (welche nicht so gut untersucht sind) umfassen den Polyubiquitin-I-Promtor und den Reis-Actin-I-Promotor. Wilmink et al. (1995). Außerdem ist ein rekombinanter Promotor, Emu, konstruiert worden und es wurde gezeigt, dass er die Expression in Monokotyledonen auf konstitutive Art und Weise steuert, Wilmink et al. (1995).

Beim Mais sind wenige gewebespezifische Promotoren charakterisiert worden. Es wurden gefunden, dass die Promotoren des Zeingens und des Oleosingens GUS auf eine gewebespezifische Art und Weise regulieren. Kriz et al. (1987); Lee und Huang (1994). In der Literatur sind keine wurzelspezifischen Promotoren aus Mais beschrieben worden. Jedoch sind Promotoren dieser Art in anderen Pflanzenarten charakterisiert worden.

Trotz der bedeutenden Rolle von gewebespezifischen Promotoren bei der Pflanzenentwicklung als auch der Chance, welche die Verfügbarkeit eines Wurzel-bevorzugenden („root preferential") Promotors für die Pflanzenbiotechnologie darstellen würde, sind hinsichtlich der Regulierung der Genexpression in Wurzeln wenig Arbeiten durchgeführt worden. Yamamoto berichtete über die Expression des E.coli:uidA-Gens, welches die &bgr;-Glucuronidase (GUS) exprimiert, unter der Kontrolle des Promotors eines wurzelspezifischen Gens, TobRB7, aus Tabak (N. tabacum). Yamamoto et al. (1991), Conkling et al. (1990). Die wurzelspezifische Expression der Fusionsgene wurde in transgenem Tabak analysiert. In dem Wurzelspitzenmeristem und Gefäßbündel wurde eine signifikante Expression gefunden. EP-Anmeldung Nr. 452 269 (De Framond) lehrt, dass Promotoren von Metallothioneinähnlichen Genen als Promotoren für eine gewebebevorzugende Transkription von verbundenen DNA-Sequenzen in Pflanzen, insbesondere in den Wurzeln, fungieren können. Insbesondere wurde ein Promotor von einem Metallothionein-ähnlichen Gen operabel mit mit ein GUS-Reportergen verbunden und es wurden Scheiben von Tabakblättern transformiert. Es wurde gezeigt, dass der Promotor in Wurzeln, Blättern und Stielen exprimiert wird. WO 9113992 (Croy et al.) lehrt, dass Extensingenpromotoren von Raps (Brassica napus L.) eine gewebebevorzugende Transkription von verbundenen DNA-Sequenzen in Pflanzen steuern können, insbesondere in den Wurzeln. Insbesondere wurde ein Extensingenpromotor aus Raps operativ mit einem extA (Extensinstrukturgen) verbunden und es wurden Scheiben von Tabakblättern transformiert. Es wurde berichtet, dass eine Northernanalyse weder bei der Kontrolle oder noch bei den transformierten Tabakpflanzen eine Hybridisierung einer Extensinsonde mit Blatt-RNA, und eine Hybridisierung der Extensinsonde mit RNA von transgenen Wurzeln von allen untersuchten Transformanden ergab, obwohl das Ausmaß der Hybridisierung für die untersuchten Transformanden variierte. Obwohl jeder dieser Promotoren in einem gewissen Ausmaß eine Gewebebevorzugende Genexpression in einem Dikotyledonen-Modellsystem (Tabak) gezeigt hat, muss die Spezifizität dieser Promotoren und Expressionsmuster und die Mengen, welche aus der Aktivität der Promotoren resultieren, in Monokotyledonen, insbesondere in Mais, noch erreicht werden.

Es sind DNA-Sequenzen identifiziert worden, welche Enhancersequenzen genannt werden, welche bei einer proximal zum Promotor ausgerichteten Anordnung die Genexpression verstärken. Solche Sequenzen sind von Quellen von Virus-, Bakterien- und Pflanzengenen identifiziert worden. Ein Beispiel für eine gut charakterisierte Enhancersequenz ist die ocs-Sequenz des Octopin-Synthasegens in Agrobacterium tumefaciens. Es ist gezeigt worden, dass diese kurze (40 bp) Sequenz die Genexpression sowohl in Dikotyledonen als auch Monokotyledonen, einschließlich Mais, um signifikante Mengen steigert. Es ist gezeigt worden, dass ein Tandem-Repeat dieses Enhancers die Expression des GUS-Gens in Mais 8-fach steigert. Es bleibt unklar, wie diese Enhancersequenzen funktionieren. Wahrscheinlich binden Enhancer an Aktivatorproteine und erleichtern dadurch die Bindung der RNA-Polymerase II an die TATA-Box. Grunstein (1992). WO 95/14098 beschreibt die Untersuchung von verschiedenen Mehrfachkombinationen des ocs-Enhancers und des mas (Mannopinsynthase)-Enhancers, welche eine Steigerung der Genexpression des GUS-Gens in transgenen Tabakkallus um das mehrmals Hundertfache ergaben.

Die 5'-nicht translatierte Leadersequenz von mRNA, Introns und die 3'-nicht translatierte Region von mRNA beeinflussen die Expression durch ihre Wirkung auf Ereignisse nach der Tanskription, beispielsweise durch Förderung der Translation oder Stabilisierung der mRNA.

Die Expression von heterologen Pflanzengenen ist auch durch die Optimierung der nicht translatierten Leadersequenz verbessert worden, d.h. dem 5'-Ende der mRNA, welches sich von der 5'-CAP-Stelle zu dem AUG-Translationsinitiationscodon der mRNA erstreckt. Dieser Leader spielt eine entscheidende Rolle bei der Translationsinitiation und bei der Regulierung der Genexpression. Bei den meisten eukaryontischen mRNAs beginnt die Translation mit der Bindung des CAP-Bindeproteins an die mRNA-CAP. Dies wird dann gefolgt von der Bindung von mehreren anderen Translationsfaktoren ebenso wie dem 43S-Ribosomen-Präinitiationskomplex. Dieser Komplex wandert das mRNA-Molekül hinab, während er es nach dem AUG-Initiationscodon in einem geeigneten Sequenzzusammenhang abtastet. Wenn dieses einmal gefunden ist, und durch die Zugabe der 60S-Ribosomenuntereinheit, initiiert der komplette 80S-Initiationskomplex die Proteintranslation. Pain (1986); Kozak (1986). Es ist gezeigt worden, dass die Optimierung dieser Leadersequenz für eine Bindung an den Ribosomenkomplex die Genexpression als direktes Ergebnis einer verbesserten Translationsinitiationseffizienz steigert. Signifikante Steigerungen der Genexpression sind durch Hinzufügen von Leadersequenzen von Pflanzenviren oder Hitzeschockgenen erzielt worden. Raju et al. (1993); Austin (1994) berichteten, dass die Länge des 5'-nicht translatierten Leaders für die Genexpression in Protoplasten von Bedeutung war.

Neben der nicht translatierten Leadersequenz scheint die Region direkt um den AUG-Start eine wichtige Rolle in der Translationsinitiation zu spielen. Luerhsen und Walbot (1994). Es wurde berichtet, dass die Optimierung der neun Basen um die AUG-Startstelle in eine Kozak-Konsensussequenz die transiente Genexpression in BMS-Protoplasten 10-fach verbesserte. McElroy et al. (1994).

Untersuchungen zur Charakterisierung der Rolle von Introns bei der Regulierung der Genexpression haben gezeigt, dass das erste Intron des Alkoholdehydrogenasegens (Adh-I) aus Mais die Fähigkeit aufweist, die Expression unter anaerobiotischen Bedingungen zu steigern. Callis et al. (1987). Das Intron stimuliert auch (in einem geringeren Ausmaß) die Expression in Abwesenheit von Anaerobiose. Man denkt, dass diese Verstärkung ein Ergebnis einer Stabilisierung der Prä-mRNA im Nukleus ist. Mascarenhas et al. berichteten von einer 12-fachen und 20-fachen Verstärkung der CAT-Expression durch die Verwendung des Adh-I-Introns. Mascarenhas et al. (1990). Es sind mehrere andere Introns von Mais und anderen Monokotyledonen identifiziert worden, welche die Genexpression steigern. Vain et al. (1996).

Das 3'-Ende der mRNA kann auch eine große Wirkung auf die Expression aufweisen und es wird angenommen, dass es mit der 5'-CAP wechselwirkt. Sullivan (1993). Es wurde gezeigt, dass die 3'-nicht translatierte Region (3'-UTR) bei mehreren Maisgenen eine wesentliche Rolle bei der Genexpression besitzt. Insbesondere wurde gezeigt, dass eine 3'-Sequenz mit 200 Basenpaaren für die Suppression einer leichten Induktion der kleinen m3-Untereinheit des Ribulose-1,5-biphosphatcarboxlasegens (rbc/m3) in Mesophyllzellen bei Mais verantwortlich ist. Viret et al. (1994). Es wurde gezeigt, dass einige 3'-UTRs Elemente enthalten, welche anscheinend mit der Instabilität des Transkripts zusammenhängen. Sullivan et al. (1993). Die 3'-UTRs der meisten eukaryontischen Gene enthalten Konsensussequenzen für die Polyadenylierung. Bei Pflanzen, insbesondere bei Mais ist diese Sequenz nicht sehr gut konserviert. Die 3'-nicht translatierte Region, umfassend ein Polyadenylierungssignal, abgeleitet von einem Nopalinsynthasegen (3'-nos), wird bei der Pflanzengentechnik häufig verwendet. Es sind wenige Beispiele für heterologe 3'-UTR-Untersuchungen bei Mais veröffentlicht worden.

Wichtige Aspekte der vorliegenden Erfindung basieren auf dem Befund, dass DNA-Sequenzen, welche von einem für Maiwurzeln spezifischen Gen für eine kationische Peroxidase stammen, für die Verwendung bei der Regulierung der Expression von rekombinanten Genen in Pflanzen außerordentlich nützlich sind.

Die Peroxidasen (Donor:Hydrogen-Peroxidoxidoreductase, EC 1.11.1.7) sind höchst katalytische Enzyme mit vielen potenziellen Substraten in der Pflanze. Siehe Gaspar et al. (1982). Sie sind in Verbindung gebracht worden mit solch unterschiedlichen Funktionen wie Sekundärzellwandbiosynthese, Wundheilung, Auxinkatabolismus und Verteidigung von Pflanzen gegen Pathogenangriffe. Siehe Lagrimini und Rothstein (1987); Morgens et al. (1990); Nakamura et al. (1988); Fujiyama et al. (1988) und Mazza et al. (1980).

Die meisten höheren Pflanzen besitzen eine Anzahl von unterschiedlichen Peroxidaseisozymen, deren Expressionsmuster gewebespezifisch ist, im Hinblick auf die Entwicklung reguliert und durch Umweltfaktoren beeinflusst ist. Lagrimini und Rothstein (1987). Bezogen auf ihren isoelektrischen Punkt werden Pflanzenperoxidasen in drei Untergruppen unterteilt: anionisch, mäßig anionisch und kationisch.

Die Funktion von anionischen Peroxidaseisozymen (pl, 3,5 bis 4,0) wird am besten verstanden. Isozyme aus dieser Gruppe sind im Allgemeinen mit der Zellwand verbunden. Sie entwickeln in vitro eine hohe Aktivität für die Polymerisation von Cinnamylalkoholen und es wurde gefunden, dass sie bei der Lignifizierung und Vernetzung von Extensinmonomeren und feruloylierten Polysacchariden eine Funktion erfüllen. Lagrimini und Rothstein (1987). Sowohl in der Kartoffel als auch der Tomate wurde gezeigt, dass die Expression von anionischen Peroxidasen sowohl bei der Wundinduktion als auch der Abscisinsäurebehandlung induziert wird. Buffard et al. (1990). Dies legt ihre Beteiligung sowohl bei der Wundheilung als auch bei der Regulierung der Gewebesubensation nahe.

Mäßig anionische Peroxidaseisoenzyme (pl, 4,5 bis 6,5) sind ebenso mit der Zellwand verbunden und besitzen eine gewisse Aktivität gegenüber Ligninvorläufern. In Tabak wurde gezeigt, dass Isozyme dieser Klasse in verwundetem Stielgewebe in hohem Maße exprimiert werden. Fujiyama et al. (1988). Diese Isoenzyme können auch eine Funktion bei der Suberisation und Wundheilung erfüllen. Morgens et al. (1990).

Die tatsächliche Funktion von kationischen Peroxidaseisoenzymen (pl, 8,1-11) in der Pflanze bleibt unklar. Es ist jedoch gezeigt worden, dass einige Mitglieder dieser Gruppe die Synthese von H2O2 aus NADH und H2O effizient katalysieren. Andere sind bei der zentralen Vakuole lokalisiert. In Abwesenheit von H2O2 besitzen einige dieser Isoenzyme eine Indolessigsäureoxidaseaktivität. Lagrimini und Rothstein (1987).

Elektrophoretische Untersuchungen mit Maisperoxidasen haben 13 Hauptisozyme offenbart. Brewbaker et al. (1985). Alle Isozyme wurden so bewertet, dass sie als Monomere funktional sind, trotz großer Unterschiede im Molekulargewicht. Alle Maisgewebe besaßen mehr als einen aktiven Peroxidaselocus, und alle Loci waren gewebespezifisch. Die Peroxidasen haben sich dahingehend als einzigartig erwiesen, dass kein Maisgewebe ohne Aktivität gefunden wurde, und dass keine Peroxidase nachweisbar in allen Maisgeweben exprimiert wird.

Zusammenfassung der Erfindung

Die Erfindung stellt isolierte DNA-Moleküle bereit, welche von dem Maiswurzel-bevorzugenden („maize root preferential") Gen der per5-kationischen Peroxidase abgeleitet sind, welche in rekombinanten Konstrukten zur Kontrolle der Expression von Genen in Pflanzen verwendet werden können. Insbesondere betrifft die Erfindung isolierte DNA-Moleküle, welche von der per5-Promotorsequenz abgeleitet werden und eine der Sequenzen

bp 4086 bis 4148 der SEQ ID NO:1,

bp 4086 bis 4200 der SEQ ID NO:1,

bp 4086 bis 4215 der SEQ ID NO:1,

bp 3187 bis 4148 der SEQ ID NO:1,

bp 3187 bis 4200 der SEQ ID NO:1,

bp 3187 bis 4215 der SEQ ID NO:1,

bp 2532 bis 4148 der SEQ ID NO:1,

bp 2532 bis 4200 der SEQ ID NO:1,

bp 2532 bis 4215 der SEQ ID NO:1,

bp 1 bis 4148 der SEQ ID NO:1,

bp 1 bis 4200 der SEQ ID NO:1 und

bp 1 bis 4215 der SEQ ID NO:1,

oder ein Fragment, eine genetische Variante oder eine Deletion solch einer Sequenz aufweisen, welche die Fähigkeit beibehalten, in Pflanzenzellen als ein Promotor zu wirken.

Die Erfindung betrifft auch isolierte DNA-Moleküle, ausgewählt aus den folgenden per5-Intronsequenzen: bp 4426 bis 5058, bp 4420 bis 5064, bp 5251-5382, bp 5245 bis 5388, bp 5549 bis 5649, und bp 5542 bis 5654 des SEQ ID NO:1.

Die Erfindung betrifft auch isolierte DNA-Moleküle, welche von der per5-Transkriptionsterminationssequenz abgeleitet sind und welche die Sequenz der Basenpaare 6068 bis 6431 der SEQ ID NO:1 aufweisen.

Die Erfindung stellt in einem anderen ihrer Aspekte DNA-Konstrukte bereit, welche umfassen:

  • a) einen Promotor, umfassend zumindest als einen Teil seiner Sequenz die bp 4086 bis 4148 der SEQ ID NO:1,
  • b) eine nicht translatierte Leadersequenz, umfassend bp 4149 bis 4200 der SEQ ID NO:1,
  • c) ein Gen von Interesse, welches natürlicherweise nicht mit dem Promotor verbunden ist,
  • d) eine 3'-UTR

    welche in der 5'-3'-Richtung operativ verbunden sind.

Bevorzugte Ausführungsformen dieses Aspekts der Erfindung sind diejenigen, worin der Promotor bp 3187 bis 4148, bp 2532 bis 4148 oder bp 1 bis 4148 der SEQ ID NO:1 umfasst. Besonders bevorzugt ist jede der bevorzugten Ausführungsformen, worin die 3'-UTR die Sequenz der Basenpaare 6066 bis 6340 oder Basenpaare 6066 bis 6439 der SEQ ID NO:1 umfasst.

Die Erfindung stellt in einem anderen ihrer Aspekte DNA-Konstrukte bereit, welche umfassen:

  • a) einen Promotor, welcher zumindest als einen Teil seiner Sequenz die Basenpaare 4086 bis 4148 der SEQ ID NO:1 aufweist,
  • b) eine nicht translatierte Leadersequenz, welche natürlicherweise nicht mit dem Promtor verbunden ist,
  • c) ein Gen von Interesse,
  • d) eine 3'-UTR,

    welche in der 5'-3'-Richtung operativ verbunden sind.

Bevorzugte Ausführungsformen dieses Aspekts der Erfindung sind diejenigen, worin der Promotor die Basenpaare 3187 bis 4148, Basenpaare 2532 bis 4148 oder Basenpaare 1 bis 4148 der SEQ ID NO:1 umfasst. Besonders bevorzugt sind diejenigen der bevorzugten Ausführungsformen, worin die 3'-UTR die Sequenz der Basenpaare 6066 bis 6340 oder Basenpaare 6066 bis 6439 der SEQ ID NO:1 aufweist.

Die Erfindung stellt in einem anderen ihrer Aspekte ein DNA-Konstrukt bereit, umfassend

  • a) einen Promotor, welcher zumindest als einen Teil seiner Sequenz die Basenpaare 4086 bis 4148 der SEQ ID NO:1 aufweist;
  • b) eine nicht translatierte Leadersequenz, umfassend bp 4149 bis 4200 der SEQ ID NO:1;
  • c) ein Intron, welches ausgewählt ist aus der Gruppe bestehend aus einem AdhI-Gen-Intron und den Basenpaaren 4426 bis 5058 der SEQ ID NO:1;
  • d) ein Gen von Interesse; und
  • e) eine 3'-UTR,

    welche operativ in der 5'-3'-Richtung verbunden sind.

Bevorzugte Ausführungsformen dieses Aspekts der Erfindung sind wiederum diejenigen, worin der Promotor die Basenpaare 3187 bis 4148, Basenpaare 2532 bis 4148 oder Basenpaare 1 bis 4148 der SEQ ID NO:1 umfasst. Besonders bevorzugt sind diejenigen der bevorzugten Ausführungsformen, worin die 3'-UTR die Sequenz der Basenpaare 6066 bis 6340 oder Basenpaare 6066 bis 6439 der SEQ ID NO:1 aufweist.

Die Erfindung stellt in einem anderen ihrer Aspekte ein DNA-Konstrukt bereit, umfassend in der 5'-3'-Richtung

  • a) einen Promotor, welcher zumindest als einen Teil seiner Sequenz die Basenpaare 4086 bis 4148 der SEQ ID NO:1 aufweist;
  • b) eine nicht translatierte Leadersequenz;
  • c) ein Intron, welches ausgewählt ist aus der Gruppe bestehend aus einem AdhI-Gen-Intron und den Basenpaaren 4426 bis 5058 der SEQ ID NO:1;
  • d) eine Klonierungsstelle; und
  • e) eine 3'-UTR.

Gemäß einem anderen bedeutenden Aspekte der Erfindung wird eine rekombinante Genkassette bereitgestellt, welche die folgenden operativ verbundenen Sequenzen von 5' nach 3' umfasst: einen Promotor, eine nicht translatierte Leadersequenz, ein Gen von Interesse und der per5-3'-UTR, Basenpaare 6068 bis 6431 von SEQ ID NO:1.

Die Erfindung stellt in einem anderen ihrer Aspkete ein Plasmid bereit, umfassend einen Promotor, welcher zumindest als Teil seiner Sequenz die Basenpaare 4086 bis 4148 der SEQ ID NO:1 aufweist.

In einem anderen Aspekt stellt die Erfindung eine transformierte Pflanze bereit, umfassend mindestens eine Pflanzenzelle, welche ein erfindungsgemäßes DNA-Konstrukt enthält. Die Pflanze kann eine monokotyledon oder eine dikotyledon sein. Bevorzugte Pflanzen sind Mais, Reis, Baumwolle und Tabak.

Die Erfindung stellt in einem anderen ihrer Aspekte einen Samen oder ein Saatkorn bereit, welcher ein erfindungsgemäßes DNA-Konstrukt enthält.

Ausführliche Beschreibung der Erfindung

Die Erfindung betrifft in einem ihrer Aspekte regulatorische Sequenzen, welche von dem Maiswurzel-bevorzugenden kationischen Peroxidaseprotein (per5) abgeleitet sind, welche die Expression von verbundenen DNA-Sequenzen in Pflanzen regulieren können. Insbesondere stellt die Erfindung neue Promotorsequenzen und Konstrukte bereit, worin diese verwendet werden. Sie stellt auch neue DNA-Konstrukte bereit, worin der per5-nicht translatierte Leader und/oder die 3'-UTR verwendet wird. Sie stellt auch neue DNA-Konstrukte bereit, worin die Introns des per5-Gens verwendet werden.

Die DNA-Sequenz für ein 6550 bp-Fragment des genomischen Klons des Maiswurzel-bevorzugenden kationischen Peroxidasegens ist in SEQ ID NO:1 angegeben. Die Sequenz umfasst eine 5'-flankierende Region (nt 1 bis 4200), wobei die Nukleotide 4149 bis 4200 der nicht translatierten Leadersequenz entsprechen. Die codierende Sequenz für die Maiswurzel-bevorzugende kationische Peroxidase ist aus 4 Exons zusammengesetzt: Exon 1 (nt 4201 bis 4425), Exon 2 (nt 5059 bis 5250), Exon 3 (nt 5383 bis 5547) und Exon 4 (nt 5649 bis 6065). Es sollte angemerkt werden, dass die ersten 96 Nukleotide des Exons 1 (nt 4201 bis 4296) für ein Signalpeptid mit 32 Aminosäuren codieren, welches nach der Translation vom Polypeptid abgespalten wird, um das reife Protein bereitzustellen. Es sind drei Introns zu finden: Intron 1 (nt 4426 bis 5058), Intron 2 (5251 bis 5382) und Intron 3 (5548 bis 5648). Die 3'-flankierende Region (373 Nukleotide lang) erstreckt sich vom Nukleotid 6069 (nach dem UGA-Codon an den Nukleotiden 6066 bis 6068) bis zum Nukleotid 6550, umfassend ein Polyadenylierungssignal bei den Nukleotiden 6307 bis 6312.

Wir haben gefunden, dass Promotoren, welche von bestimmten Gewebebevorzugenden Maisgenen stammen, die Anwesenheit eines Introns in dem transkribierten Teil des Gens erfordern, um eine effektive Expression in Mais zu bewirken, und dass die beobachtete temporäre Spezifität und Gewebespezifität von dem verwendeten Intron abhängt. Eine rekombinante Genkassette mit einem Gewebe-bevorzugenden Maispromotor, aber ohne Intron in dem transkribierten Teil des Gens, ergibt in transformiertem Mais keine geeignete Expression. Wenn der transkribierte Teil der Kassette ein Intron enthält, welches von einem Maisgen mit einer ähnlichen Gewebespezifität wie das Maisgen, von welchem der Promotor erhalten wurde, abgeleitet wird, stellt die Genkassette die Gewebe-bevorzugende Expression in Mais wieder her. Das Intron kann, muss aber nicht notwendigerweise vom gleichen Gen wie der Promotor stammen. Wenn ein von einem anderen Maisgen stammendes Intron, wie beispielsweise das AdhI-Intron 1, in einer Genkassette verwendet wird mit einem Promotor von einem Gewebebevorzugenden Maisgen, bewirkt die Kassette im Allgemeinen in Mais eine konstitutive Expression. Wir haben auch gefunden, dass diese Überlegungen auf transgenen Mais zutreffen, aber nicht auf transgenen Reis. Gewebebevorzugende Maispromotoren können verwendet werden, um rekombinante Gene in Reis ohne Intron zu steuern.

Gemäß den vorangehenden unerwarteten und signifikanten Befunden ist ein allgemeines Schema, welches bei der Konstruktion von rekombinanten Genkassetten verwendet wird, welche sich eignen, um eine bevorzugte Expression eines Gens von Interesse in einem ausgewählten Gewebe von transformiertem Mais zu bewirken, dass die Genkassette umfasst:

  • a) einen Promotor eines ersten Maisgens, worin das Maisgen ein Gen ist,

    welches natürlicherweise bevorzugt in dem ausgewählten Gewebe exprimiert wird;
  • b) eine nicht translatierte Leadersequenz;
  • c) das Gen von Interesse, wobei das Gen ein anderes ist als das erste Maisgen;
  • d) eine 3'-UTR;

    wobei der Promotor, die nicht translatierte Sequenz, das Gen von Interesse und die 3'-UTR operativ von 5' nach 3' verbunden sind; und
  • e) eine Intronsequenz, welche in die nicht translatierte Leadersequenz oder in das Gen von Interesse eingebracht ist, worin die Intronsequenz von einem Intron eines Maisgens stammt, welches bevorzugt in dem ausgewählten Gewebe exprimiert wird. Der Promotor kann von einem beliebigen Maisgen stammen, welches bevorzugt in dem Gewebe von Interesse exprimiert wird. Solche Maisgene können durch konventionelle Verfahren identifiziert werden, beispielsweise durch Verfahren, welche ein differenzielles Screening von mRNA-Sequenzen umfassen.

Ein ausführliches Beispiel für die Identifizierung und Isolierung eines Gewebe-bevorzugenden Maisgens ist hierin für das Wurzel-bevorzugende kationische Peroxidasegen angegeben. Das in diesem Beispiel veranschaulichte Verfahren kann verwendet werden, um weitere Gene von verschiedenen Maisgeweben zu isolieren.

Beispiele für Gewebe-bevorzugende Maisgene, welche erfindungsgemäß geeignete Promotoren aufweisen, umfassen: O-Methyltransferase und Glutaminsynthetase 1.

Ein bevorzugter Promotor ist der per5-Promotor, d.h. der Promotor des Wurzel-bevorzugenden kationischen Peroxidasegens aus Mais. Besonders bevorzugt ist der Promotor, welcher Basenpaare 1 bis 4215 von SEQ ID NO:1 umfasst.

Die nicht translatierte Leadersequenz kann von einer beliebigen geeigneten Quelle stammen und kann insbesondere so modifiziert sein, dass die Translation der mRNA gesteigert wird. Die 5'-nicht translatierte Region kann erhalten werden von dem Promotor, welcher zur Expression des Gens ausgewählt wird, der nativen Leadersequenz des zu exprimierenden Gens oder der zu exprimierenden codierenden Region, viralen RNAs, geeigneten eukaryontischen Genen oder kann eine künstliche Sequenz sein.

Das Gen von Interesse kann ein beliebiges Gen sein, von welchem eine Expression in Pflanzen gewünscht ist. Besonders nützliche Gene sind diejenigen, welche eine Toleranz gegenüber Herbiziden, Insekten oder Viren verleihen und Gene, welche einen verbesserten Ernährungswert verleihen oder die Eigenschaften der Pflanze verändern. Beispiele für geeignete agronomisch verwendbare Gene umfassen die Insektizidgene von Bacillus thuringiensis zum Verleihen einer Insektenresistenz und das 5'-Enolpyruvyl-3'-phosphoshikimatsynthase (EPSPS)-Gen und eine beliebige Variante davon zum Verleihen einer Toleranz gegen Glyphosatherbizide. Andere geeignete Gene werden hierin nachfolgend identifiziert. Wie von einem Fachmann leicht verstanden wird, kann jedes beliebige agronomisch bedeutende Gen verwendet werden, welches eine gewünschte Eigenschaft verleiht.

Die 3'-UTR oder 3'-nicht translatierte Region, welche verwendet wird, ist bevorzugt eine Region, welche ein effizientes Processing der mRNA ermöglicht, die Stabilität der Messenger-RNA aufrechterhält und das Hinzufügen von Adenosinribonukleotiden an das 3'-Ende der transkribierten mRNA-Sequenz steuert. Die 3'-UTR kann nativ mit der Promotorregion sein, nativ mit dem Strukturgen sein oder kann von einer anderen Quelle stammen. Geeignete 3'-UTRs umfassen, sind aber nicht beschränkt auf die per5-3'-UTR und die 3'-UTR des Nopalinsynthase (nos)-Gens.

Die bevorzugt verwendeten Introns hängen von dem bestimmten Gewebe ab, in welchem das Gen von Interesse bevorzugt exprimiert werden soll. Für eine Gewebe-bevorzugende Expression in Mais sollte das Intron bevorzugt aus einem Maisgen ausgewählt werden, welches natürlicherweise bevorzugt in dem ausgewählten Gewebe exprimiert wird.

Das Intron muss in eine transkribierte Region der Kassette eingebracht werden. Es wird bevorzugt in den nicht translatierten Leader in 5'-Position des Gens von Interesse und in 3'-Position des Promotors eingebracht oder innerhalb der translatierten Region des Gens.

Weshalb bestimmte Gewebe-bevorzugende Maisgene ein Intron benötigen, um eine effektive Expression in Maisgeweben zu ermöglichen, ist nicht bekannt, aber Experimente deuten darauf hin, dass das kritische Ereignis das Processing nach der Transkription ist. Wenn diesem Schema gefolgt wird, muss das Intron entsprechend in einem transkribierten Teil der Genkassette bereitgestellt werden.

Ein entsprechendes allgemeines Schema, welchem bei der Bereitstellung bestimmter Ausführungsformen der Erfindung gefolgt werden kann, ist eine rekombinante Genkassette, welche eine konstitutive Expression eines Gens von Interesse in transformiertem Mais bewirken kann, umfassend:

  • a) einen Promotor von einem ersten Maisgen, worin das erste Maisgen ein Gen ist, welches natürlicherweise bevorzugt in einem bestimmten Gewebe exprimiert wird;
  • b) eine nicht translatierte Leadersequenz;
  • c) das Gen von Interesse, worin das Gen ein anderes Gen ist als das erste Maisgen;
  • d) eine 3'-UTR;

    worin der Promotor, die nicht translatierte Sequenz, das Gen von Interesse und die 3'-UTR operativ von 5' nach 3' verbunden sind; und
  • e) eine Intronsequenz, welche in den nicht translatierten Leader oder in das Gen von Interesse eingebracht ist, worin die Intronsequenz von einem Intron eines Maisgens stammt, welches natürlicherweise konstitutiv exprimiert wird.

Dieses Schema unterscheidet sich vom vorigen Schema darin, dass das Intron ein Intron von einem Gen ist, welches in den meisten Geweben exprimiert wird, und dass die von der resultierenden rekombinanten Genkassette in Mais erhaltene Expression konstitutiv ist. Geeignete Introns zur Verwendung in dieser Ausführungsform der Erfindung umfassen das AdhI-Intron 1, das Ubiquitin-Intron 1 und das Bronze 2-Intron 1. Besonders bevorzugt ist das AdhI-Intron 1. Obwohl zuvor berichtet wurde, dass das AdhI-Intron 1 die Expression von konstitutiv exprimierten Genen verstärken kann, ist nie berichtet oder nahegelegt worden, dass das AdhI-Intron die Gewebebevorzugenden Eigenschaften eines Gewebe-bevorzugenden Maispromotors verändern kann.

Die vorliegende Erfindung ist im Allgemeinen anwendbar für die Expression von Strukturgenen sowohl in monokotyledonen als auch dikotyledonen Pflanzen. Diese Erfindung ist besonders geeignet für jedes Mitglied der Pflanzenfamilie der Monokotyledonen einschließlich, aber nicht beschränkt auf Mais, Reis, Gerste, Hafer, Weizen, Hirse, Roggen, Zuckerrohr, Ananas, Yams, Zwiebel, Banane, Kokosnuss und Datteln. Eine bevorzugte Anwendung der Erfindung ist die Produktion von transgenen Maispflanzen.

Diese Erfindung, bei welcher ein für Monokotyledonen konstruierter Promotor verwendet wird, ist besonders nützlich für die Familie der Graminaceae, insbesondere für Mais, Weizen, Reis, Hafer, Gerste und Hirse.

Gemäß einem anderen Aspekt der Erfindung wird eine rekombinante Genkassette bereitgestellt, umfassend einen Promotor, eine nicht translatierte Leadersequenz, ein Gen von Interesse und die per5-3'-UTR. Die Verwendung der per5-3'-UTR ermöglicht eine verbesserte Expression im Vergleich mit ähnlichen Genkassetten unter Verwendung der nos3-UTR.

Der mit der per5-3'-UTR verwendete Promotor kann ein beliebiger Promotor sein, welcher für eine Verwendung in Pflanzen geeignet ist. Geeignete Promtoren können von einer Vielzahl von Quellen erhalten werden, wie etwa von Pflanzen oder Pflanzen-DNA-Viren. Bevorzugte Promotoren sind der per5-Promotor, der 35T-Promotor (hierin nachfolgend in den Beispielen 20 und 23 beschrieben) und der Ubiquitin-Promotor. Nützliche Promotoren umfassen diejenigen, welche aus der Gruppe der Caulimoviren isoliert werden, wie etwa die Promotoren der 19S- und 35S-Transkripte des CaMV („cauliflower mosaic virus"). Andere nützliche Promotoren umfassen den erweiterten CaMV35S-Promotor (eCaMV35S), wie von Kat et al. (1987) beschrieben, und den Promotor der kleinen Untereinheit der Ribulose-1,5-bisphosphatcarboxylaseoxygenase (RUBISCO). Beispiele von anderen geeigneten Promotoren sind der Reis-Actingenpromotor, der Cyclophilinpromotor, der AdhI-Genpromotor, Callis et al. (1987), der Klasse 1 bis Patatinpromotor, Bevan et al. (1986), der ADP-Glukosephosphorylasepromotor, der Beta-Conglycininpromotor, Tierney et al. (1987), der E8-Promotor, Deikman et al. (1988), der 2All-Promotor, Pear et al. (1989), der Säurechitinasepromotor, Samac et al. (1990). Der ausgewählte Promotor sollte alleine eine ausreichende Expression des gewünschten Proteins bewirken können, jedoch insbesondere bei einer Verwendung mit der per5-3'-UTR, um die Produktion einer wirksamen Menge des gewünschten Proteins zu ergeben, damit die daraus regenerierten Pflanzenzellen und Pflanzen die Eigenschaften aufweisen, welche phänotypisch durch das exprimierte Protein verursacht werden.

Der mit der per5-3'-UTR verwendete nicht translatierte Leader ist nicht kritisch. Der nicht translatierte Leader ist im Allgemeinen einer, welcher natürlicherweise mit dem Promotor verbunden ist. Der nicht translatierte Leader kann ein Leader sein, welcher gemäß einem anderen Aspekt der vorliegenden Erfindung modifiziert wurde und ein Intron umfasst. Es kann auch eine heterologe Sequenz sein, wie etwa eine Sequenz, bereitgestellt durch das US-Patent Nr. 5,362,865. Diese nicht translatierte Leadersequenz kann von einer beliebigen geeigneten Quelle abgeleitet sein und kann insbesondere modifiziert sein, um die Translation der mRNA zu erhöhen.

Das Gen von Interesse kann ein beliebiges Gen sein, welches ein anderes ist als per5, welches in Pflanzen exprimiert werden soll, wie oben beschrieben.

Die Begriffe "per5-3-UTR" und/oder "per5-Transkriptionsterminationsregion" sollen sich auf eine Sequenz beziehen, welche Basenpaare 6068 bis 6431 der SEQ ID NO:1 umfasst.

Die Konstruktion von Genkassetten unter Verwendung der per5-3'-UTR kann leicht durchgeführt werden unter Verwendung von allgemein bekannten Verfahren, wie etwa diejenigen, welche in Sambrook et al. (1989) und Ausubel et al. (1987) offenbart werden.

Wie in der vorliegenden Anmeldung verwendet, werden die Begriffe "Wurzel-bevorzugender Promotor", "Wurzel-bevorzugende Expression", "Geweb-bevorzugende Expression" und "bevorzugende Expression" so verwendet, dass gezeigt wird, dass eine bestimmte DNA-Sequenz, welche von der 5'-flankierenden Region oder einer Region stromaufwärts eines Pflanzengens abgeleitet wurde, bezüglich des Strukturgens ausschließlich oder nahezu ausschließlich in Wurzelgewebe und nicht in der Mehrheit der anderen Pflanzenteile exprimiert wird. Diese DNA-Sequenz bewirkt bei einer Verbindung mit einem offenen Leserahmen eines Gens für ein Protein mit einer bekannten oder unbekannten Funktion eine differenzielle Wirkung, d.h. dass die Transkription der verbundenen DNA-Sequenzen oder die Expression eines Genprodukts ist in einigen Geweben größer, beispielsweise in den Wurzeln einer Pflanze, als in einigen anderen oder in allen anderen Geweben der Pflanze, beispielsweise im Samen. Die Expression des Produkts des verbundenen Gens wird gezeigt durch einen beliebigen konventionellen RNA-, cDNA-, Proteinassay oder biologischen Assay, oder dadurch, dass eine bestimmte DNA-Sequenz gezeigt wird.

Ausführungsformen dieser Erfindung betreffen die Konstruktion eines rekombinanten DNA-Konstrukts, bei welchem DNA-Sequenzen des Promotors eines Wurzel-bevorzugenden kationischen Peroxidasegens aus Mais, ein expressionsfähiges Strukturgen einer Pflanze (z.B. das GUS-Gen (Jefferson, (1987)) und einen geeigneten Terminator kombiniert wird.

Die vorliegende Erfindung umfasst auch DNA-Sequenzen, welche im Wesentlichen eine Sequenzhomologie mit den speziell offenbarten Promotorsequenzen aufweisen, so dass sie die offenbarte Wirkung auf die Expression aufweisen können.

Wie in der vorliegenden Anmeldung verwendet, wird der Begriff "wesentliche Sequenzhomologie" verwendet, um zu zeigen, dass eine Nukleotidsequenz (im Fall von DNA oder RNA) oder eine Aminosäuresequenz (im Fall eines Proteins oder Polypeptids) eine wesentliche funktionelle oder strukturelle Äquivalenz mit einem anderen Nukleotid oder einer anderen Aminosäuresequenz aufweist. Beliebige funktionelle oder strukturelle Unterschiede zwischen Sequenzen mit einer wesentlichen Sequenzhomologie sind de minimis, das bedeutet, sie beeinflussen nicht die Fähigkeit der Sequenz, wie in der vorliegenden Anmeldung aufgezeigt zu fungieren. Eine Sequenz, welche eine wesentliche Sequenzhomologie mit einer DNA-Sequenz aufweist, welche als ein Wurzel-bevorzugender Promotor offenbart ist, kann die Wurzelbevorzugende Expression einer verbundenen DNA-Sequenz steuern. Sequenzen, welche wesentliche Sequenzhomologie mit den hierin offenbarten Sequenzen aufweisen, sind im Allgemeinen Varianten der offenbarten Sequenz, wie etwa Mutationen, können aber auch künstliche Sequenzen sein.

In den meisten Fällen fungieren Sequenzen mit einer 95%-igen Homologie mit den hierin offenbarten speziellen Sequenzen als Äquivalente, und in vielen Fällen ist eine beträchtlich geringere Homologie, beispielsweise 75% oder 80% akzeptabel. Das Auffinden der Teile dieser Sequenzen, welche nicht kritisch sind, kann zeitaufwändig sein, ist jedoch Routine und im Fachgebiet allgemein bekannt.

DNA, welche für den Maiswurzel-bevorzugenden kationischen Peroxidasepromotor codiert, kann aus chromosomaler DNA oder DNA künstlichen Ursprungs unter Verwendung allgemein bekannter Techniken präpariert bzw. hergestellt werden. Insbesondere werden als Teil dieser Erfindung genomische DNA-Sequenzen verstanden. Genomische DNA kann durch Standardverfahren isoliert werden. Sambrook et al. (1989), Mullis et al. (1987), Horton et al. (1989), Erlich (Editor) (1989). Es ist auch möglich, künstliche Sequenzen durch Oligonukleotidsynthese herzustellen. Siehe Caruthers (1983) und Beaucage et al. (1981).

Es wird in Betracht gezogen, dass Sequenzen, welche den oben angegebenen Sequenzen entsprechen, eine oder mehrere Modifikationen in den Sequenzen vom Wildtyp enthalten können, aber die entsprechenden Elemente noch immer vergleichbar machen im Hinblick auf die Lehren dieser Erfindung. Wie beispielsweise oben angegeben ist, können Fragmente verwendet werden. Man kann in die isolierten Sequenzen Modifikationen einfügen, einschließlich einer Addition, Deletion oder nicht konservativen Substitution einer beschränkten Zahl von verschiedenen Nukleotiden oder der konservativen Substitution von vielen Nukleotiden. Weiterhin können bei der Konstruktion solcher DNA-Nukleotide Quellen verwendet werden, welche eine Stärkung der Expression von heterologen Genen verleihen, welche unter ihrer regulatorischen Kontrolle platziert werden. Exemplarische Techniken für die Modifikation von Oligonukleotidsequenzen umfassen die Verwendung von einer Polynukleotid-vermittelten ortsgerichteten Mutagenese. Siehe Zoller et al. (1984); Higuchi et al. (1988); Ho et al. (1989); Norton et al. (1989); und „PCR Technology: Principles and Applications for DNA Amplification" (Editor) Erlich (1989).

In einer Ausführungsform umfasst eine erfindungsgemäße Expressionskassette in 5'-3'-Richtung die Maiswurzel-bevorzugende kationische Peroxidasepromotorsequenz, im Leserahmen mit einer oder mehreren Nukleinsäuresequenzen von Interesse, gefolgt von einer Transkriptionsterminationssequenz. Die Expressionskassette kann auf viele Arten verwendet werden, umfassend beispielsweise die Insertion in eine Pflanzenzelle für die Expression der Nukleinsäuresequenz von Interesse.

Die Gewebe-bevorzugenden Promotor-DNA-Sequenzen sind bevorzugt operativ mit einer codierenden DNA-Sequenz verbunden, beispielsweise einer DNA-Sequenz, welche in RNA transkribiert wird oder welche schließlich bei in der Produktion eines Proteinprodukts exprimiert wird.

Eine Promotor-DNA-Sequenz ist mit einer codierenden DNA-Sequenz "operativ verbunden", wenn die zwei so angeordnet sind, dass die Promotor-DNA-Sequenz die Transkription der codierenden DNA-Sequenz beeinflusst. Wenn die codierende DNA-Sequenz beispielsweise für die Produktion eines Proteins codiert, wäre die Promotor-DNA-Sequenz mit der codierenden DNA-Sequenz operativ verbunden, wenn die Promotor-DNA-Sequenz die Expression des Proteinprodukts von der codierenden DNA-Sequenz beeinflusst. Beispielsweise sind in einer DNA-Sequenz, umfassend eine Promotor-DNA-Sequenz, welche mit der codierenden DNA-Sequenz im gleichen chimären Konstrukt physikalisch verbunden ist, die zwei Sequenzen wahrscheinlich operativ verbunden.

Die mit der regulatorischen oder Promotor-DNA-Sequenz verbundene DNA-Sequenz kann heterolog oder homolog sein, das bedeutet, die insertierten Gene können von einer anderen Pflanzenart als die Art der Empfängerpflanze stammen. In jedem Fall sind die DNA-Sequenzen, Vektoren und Pflanzen der vorliegenden Erfindung verwendbar zum Steuern der Transkription der verbundenen DNA-Sequenz, so dass die transkribierte mRNA oder das durch die verbundene DNA-Sequenz codierte Protein in einigen Pflanzengeweben, wie etwa Wurzeln, Blättern oder Stielen, in größerer Menge exprimiert wird als im Samen. Somit kann die verbundene DNA-Sequenz bevorzugt für ein Protein codieren, welches in einer Pflanze nur in einem bevorzugten Gewebe exprimiert werden soll, wie etwa den Wurzeln, Blättern oder Stielen, und nicht im Samen.

Promotoren sind in 5'-Richtung (stromaufwärts) bezüglich der Gene lokalisiert, welche sie steuern bzw. kontrollieren. Wie im Fachgebiet bekannt ist, können einige Variationen in dieser Distanz ohne Verlust der Promotorfunktion eingestellt werden. Auf ähnliche Art und Weise ist die bevorzugte Position eines regulatorischen Sequenzelements im Hinblick auf ein heterologes Gen, welches unter dessen Kontrolle platziert werden soll, durch die Position des Elements in der natürlichen Anordnung definiert, d.h. in den Genen, von welchen es abgeleitet ist. Erneut kann, wie im Fachgebiet bekannt ist und hierin mit mehreren Kopien von regulatorischen Elementen gezeigt wird, eine gewisse Variation in dieser Distanz auftreten.

In diesen Konstruktionen kann ein beliebiges, in Pflanzen exprimierbares Strukturgen verwendet werden. Ein Strukturgen ist der Teil eines Gens, umfassend ein DNA-Segment, welches für ein Protein, Polypeptid, Antisense-RNA oder Ribozym oder eines Teils davon codiert. Der Begriff kann sich auf Kopien eines Strukturgens beziehen, welche natürlicherweise innerhalb der Zelle zu finden sind, jedoch künstlich eingebracht wurden, oder das Strukturgen kann für ein Protein codieren, welches normalerweise nicht in der Pflanzenzelle zu finden ist, in welche das Gen eingebracht wurde, in diesem Fall wird es als heterologes Gen bezeichnet.

Die verbundene DNA-Sequenz kann beispielsweise für Proteine codieren, welche bekanntermaßen Insekten oder Pflanzenpathogene wie etwa Pilze, Bakterien und Nematoden hemmen. Die Proteine umfassen, sind aber nicht beschränkt auf in Pflanzen unspezifische Lipidacylhydrolasen, insbesondere Patatin; Mitteldarm-wirksame Pflanzencystatine, insbesondere Kartoffelpapaininhibitor; Magainine, Zasloff (1987); Cecropine, Hultmark et al. (1982); Attacine, Hultmark et al. (1983); Melittin; Gramicidin S, Katsu et al. (1988); Natriumkanalproteine und künstliche Fragmente, Oiki et al. (1988); das Alpha-Toxin von Staphylococcus aureus, Tobkes et al. (1985); Apolipoproteine und Fragmente davon, Knott et al. (1985) und Nakagawa et al. (1985); Alamethicin und eine Vielzahl von künstlichen amphipathischen Peptiden, Kaiser et al. (1987); Lectine, Lis et al. (1986) und Van Parijs et al. (1991); Pathogenverbundene Proteine, Lindhorst (1991); Osmotine und Permatine, Vigers et al. (1992) und Woloscuk et al. (1991); Chitinasen; Glucanasen, Lewah et al. (1991); Thionine, Bohlmann und Apel (1991); Proteaseinhibitoren, Ryan (1990); antimikrobielle Pflanzenpeptide, Cammue et al. (1992); und Polypeptide von Bacillus thuringiensis, von welchen gesagt wird, dass sie kleine Poren in der Darmzellmembran von Insekten erzeugen, Knowles et al. (1987) und Hofte und Whitely (1989).

Die Strukturgensequenz ist im Allgmeinen eine Sequenz, welche von einer Pflanzenart stammt, welche sich von der Art des Zielorganismus unterscheidet. Jedoch sieht die vorliegende Erfindung auch die Wurzelbevorzugende Expression von Strukturgenen vor, welche von einer Pflanze der gleichen Art wie die Zielpflanze stammen, welche jedoch nativ nicht unter der Kontrolle des nativen Wurzel-bevorzugenden kationischen Peroxidase (per5)-Promotors exprimiert werden.

Das Strukturgen kann insgesamt oder als Teil von einem Bakteriengenom oder Episom, von eukaryontischer genomischer DNA, Mitochondrien-DNA oder Plastiden-DNA, cDNA, viraler DNA oder chemisch synthetisierter DNA stammen. Es ist möglich, dass ein Strukturgen ein oder mehrere Modifikationen entweder in der codierenden oder den nicht translatierten Regionen enthalten kann, welches die biologische Aktivität oder die chemische Struktur des Expressionsprodukts, die Expressionsrate oder die Art und Weise der Expressionskontrolle bzw. -steuerung beeinflusst. Solche Modifikation umfassen, sind aber nicht beschränkt auf Mutationen, Insertionen, Deletionen, Umordnungen und Substitutionen von einem oder mehreren Nukleotiden. Das Strukturgen kann eine nicht unterbrochene codierende Sequenz bilden oder es kann ein oder mehrere Introns umfassen, gebunden durch die geeigneten in Pflanzen funktionellen Spliceverbindungen. Das Strukturgen kann aus Segmenten zusammengesetzt sein, welche aus einer Vielzahl von Quellen stammen, natürlich vorkommend oder künstlich. Das Strukturgen kann auch für ein Fusionsprotein codieren, solange die experimentellen Manipulationen die Funktionalität in der Verbindung der codierenden Sequenz aufrechterhalten.

Die Verwendung einer Signalsequenz für eine Sekretion oder Absonderung in eine ausgewählte Organelle ermöglicht es, dass das Protein bis zur Freisetzung in der Magenumgebung eines Insektenpathogens an einem metabolisch inerten Ort verbleibt. Außerdem werden manche Proteine eher in höheren Mengen in transgenen Pflanzen angereichert, wenn sie von den Zellen sekretiert werden, als wenn sie im Zytosol gelagert werden. Hiatt et al. (1989).

Am 3'-Terminus des Strukturgens wird eine Terminationssequenz bereitgestellt, welche in Pflanzen funktionell ist. Es ist eine große Vielzahl von Terminationsregionen verfügbar, welche von Genen erhalten werden können, welche in Pflanzenwirten exprimierbar sind, z.B. Bakterien-, Opin-, Virus- und Pflanzengene. Geeignete 3'-UTRs umfassen diejenigen, welche Fachleuten bekannt sind, wie etwa beispielsweise nos 3', tmL 3' oder acp 3'.

Bei der Herstellung der Konstrukte dieser Erfindung können die verschiedenen DNA-Fragmente manipuliert werden, so dass DNA-Sequenzen in der richtigen Orientierung und entsprechend im richtigen Leserahmen bereitgestellt werden. Adapter oder Linker können zur Verbindung der DNA-Fragmente verwendet werden und es können andere Manipulationen enthalten sein, um geeignete Restriktionsstellen, die Entfernung von überflüssiger DNA, Entfernung von Restriktionsstellen oder dergleichen zu ermöglichen.

Beim Durchführen der verschiedenen Schritte wird eine Klonierung verwendet, damit ein Vektor amplifiziert wird„ welcher den Promotor/das Gen von Interesse enthält, für ein nachfolgendes Einbringen in gewünschte Wirtszellen. Es ist eine breite Vielzahl von Klonierungsvektoren verfügbar, wobei der Klonierungsvektor ein in E.coli funktionelles Replikationssystem und einen Marker umfasst, welcher eine Selektion der transformierten Zellen ermöglicht. Beispielhafte Vektoren umfassen pBR322, die pUC-Reihe, pACYC184, die Bluescript-Reihe (Stratagene) usw. Somit kann die Sequenz in den Vektor an einer geeigneten Restriktionsstelle (geeigneten Restriktionsstellen) insertiert werden, das resultierende Plasmid kann zur Transformation des E.coli-Wirts (z.B. E.coli-Stämme HB101, JM101 und DH5&agr;) verwendet werden, E.coli kann in einem geeigneten Nährmedium angezogen werden und die Zellen können geerntet, lysiert und das Plasmid kann rückgewonnen werden. Die Analyse kann eine Sequenzanalyse, Restriktionsanalyse, Elektrophorese oder dergleichen umfassen. Nach jeder Manipulation kann die im Endkonstrukt zu verwendende DNA-Sequenz eingegrentz und mit der nächsten Sequenz verbunden werden, wobei jedes der Teilkonstrukte in das gleiche oder in unterschiedliche Plasmide kloniert werden kann.

Vektoren für die Transformation von Pflanzenzellen sind verfügbar oder können leicht hergestellt werden. Im Allgmeinen sollten Plasmidvektoren oder virale Vektoren die gesamten DNA-Kontrollsequenzen enthalten, welche sowohl für die Aufrechterhaltung als auch Expression einer heterologen DNA-Sequenz in einem bestimmten Wirt notwendig sind. Solche Kontrollsequenzen umfassen im Allgemeinen neben der Maiswurzel-bevorzugenden kationischen Peroxidasepromotorsequenz (einschließlich einer Transkriptionsstartstelle) eine Leadersequenz und eine DNA-Sequenz, welche für ein Translationsstartsignalcodon codiert (im Allgemeinen entweder von dem Maiswurzelbevorzugenden kationischen Peroxidasegen oder von dem Gen von Interesse erhalten, welches durch den Promotor exprimiert werden soll, oder von einem Leader eines dritten Gens erhalten , welches bekanntermaßen gut arbeitet oder die Expression in der ausgewählten Wirtszelle verstärkt), ein Translationsterminatorcodon und eine DNA-Sequenz, welche für eine 3'-nicht translatierte Region codiert, enthaltend Signale zur Kontrolle bzw. Steuerung des Processing der Messenger-RNA. Die Auswahl von geeigneten Elementen zur Optimierung der Expression in einer beliebigen bestimmten Art ist dem Fachmann unter Verwendung der Lehren dieser Offenbarung geläufig, in einigen Fällen werden Hybridkonstruktionen bevorzugt, wobei die Promotorelemente stromaufwärts des Gewebe-bevorzugenden Promotors TATA und CAAT-Box mit einem minimalen 35S-Promotor, bestehend aus der 35S-TATA- und CAAT-Box kombiniert werden. Schließlich ist es wünschenswert, dass die Vektoren ein Markergen aufweisen, welches eine phänotypische Eigenschaft bereitstellt, welche die Identifizierung von Wirtszellen ermöglicht, welche den Vektor enthalten, und ein Intron in der 5'-nicht translatierten Region, z.B. Intron 1 des Alkoholdehydrogenasegens aus Mais, welches die ständig vorhandenen Mengen der mRNA des Markergens erhöhen.

Die Aktivität des in Pflanzenzellen insertierten Fremdgens hängt von dem Einfluss der endogenen Pflanzen-DNA neben dem Insert ab. Im Allgemeinen scheint die Insertion von heterologen Genen unter Verwendung einer beliebigen Transformationstechnik zufällig zu sein, jedoch existiert gegenwärtig eine Technologie zum Erzeugen von Pflanzen mit einer ortsspezifischen Rekombination der DNA in Pflanzenzellen (siehe WO/9109957). Die für die Transformation solcher Pflanzenzellen verwendeten bestimmten Verfahren sind in dieser Erfindung nicht kritisch, noch sind nachfolgende Schritte kritisch, wie etwa die Regeneration solcher Pflanzenzellen, falls nötig. Jedes beliebige Verfahren oder jede beliebige Kombination von Verfahren ist annehmbar, welche die Expression der gewünschten Sequenz oder Sequenzen unter der Kontrolle des Promotors ergibt.

Konventionelle Technologien zum Einbringen von biologischem Material in Wirtszellen umfassen Elektroporation, wie von Shigekawa und Dower (1988), Miller et al. (1988) und Powell et al. (1988) offenbart; Mechanismen zur direkten DNA-Aufnahme, wie von Mandel und Higa (1972) und Dityatkin et al. (1972), Wigler et al. (1979) und Uchimiya et al. (1982) offenbart; Fusionsmechanismen, wie von Uchidaz et al. (1980) offenbart; infektiöse Mittel, wie etwa von Fraley et al. (1986) und Anderson (1984) offenbart; Mikroinjektionsmechanismen, wie von Crossway et al. (1986) offenbart; und Hochgeschwindigkeitsbeschussmechanismen, wie in EP 0 405 696 offenbart.

Pflanzenzellen von monokotyledonen oder dikotyledonen Pflanzen können erfindungsgemäß transformiert werden. Monokotyledonenarten umfassen Gerste, Weizen, Mais, Hafer und Hirse und Reis. Dikotyledonenarten umfassen Tabak, Tomate, Sonnenblume, Baumwolle, Zuckerrübe, Kartoffel, Salat, Melone, Sojabohne und Raps (Rapssamen).

Das für die Transformation einer ausgewählten Wirtszelle geeignete Verfahren kann in Übereinstimmung mit der verwendeten Wirtszelle ausgewählt werden. Auf Basis der Erfahrung bis heute scheint ein geringer Unterschied in der Expression von Genen vorzuliegen, wenn sie erst einmal in Zellen insertiert sind, welcher dem Transformationsverfahren selbst zuzuschreiben ist. Wenn ein Strukturgen einmal in ein Pflanzengewebe eingebracht ist, kann die Expression des Strukturgens in einem transienten Expressionssystem bewertet werden, oder sie kann nach einer Selektion im Hinblick auf eine stabile Integration in das Pflanzengenom bestimmt werden.

Es sind Verfahren für die in vitro-Kultur von Pflanzengewebe bekannt, und in einer Vielzahl von Zellen für die Regeneration zu ganzen Pflanzen. Das geeignete Verfahren zur Herstellung von reifen transgenen Pflanzen kann gemäß der verwendeten Pflanzenart ausgewählt werden. Die Regeneration variiert von Pflanzenart zu Pflanzenart. Ein effiziente Regeneration hängt vom Medium, vom Genotyp und von der Vorgeschichte der Kultur ab. Wenn ganze Pflanzen erhalten wurden, können sie sexuell oder klonal oder auf solche Art und Weise reproduziert werden, dass zumindest eine Kopie der Sequenz in den Zellen der Nachkommen der Reproduktion vorliegt. Samen der regenerierten Pflanzen können für eine zukünftige Verwendung gesammelt werden, und aus diesem Samen können Pflanzen herangezogen werden. Verfahren zur Übertragung des eingebrachten Gens von der ursprünglich transformierten Pflanze in kommerziell verwendbare Kultivare sind Fachleuten bekannt.

Beispiel 1 Charakterisierung einer Maiswurzel-bevorzugenden kationischen Peroxidase

Das Vorliegen von Peroxidaseaktivität kann in situ in Natriumdodecylsulfat-Polyacrylamidgelen (SDS-PAGE) durch Inkubation mit H2O2 und einem chromogenen Substrat wie etwa 3,3'-Diamidobenzidin nachgewiesen werden. Eine gewebespezifische Peroxidaseaktivität wurde im Wesentlichen wie folgt durch Extraktion von Proteinen aus Wurzel, Stiel und Blattgewebe von Mais nachgewiesen, gefolgt von einem Nachweis in Gelen gemäß Nakamura et al. (siehe Nakamura et al. (1988)). Ein Gramm Maisgewebe wurde im Mörser in 1 ml Extraktionspuffer, zusammengesetzt aus 62,5 mM TrisHCl pH 6,8, 5 mM MgCl2, 0,5 M Saccharose, 0,1% Ascorbinsäure mazerisiert, zentrifugiert und zur Entfernung von Pflanzentrümmern über einen 0,2 &mgr;M-Filter geleitet. Das Gesamtprotein wurde unter Verwendung des Bradford-Proteinassays bestimmt. Siehe Bradford (1976). 10 &mgr;g Protein von jedem Gewebe wurde auf einem SDS-Polyacrylamidgel einer Elektrophorese unterzogen. Um die Enzymaktivität beizubehalten, wurde Beta-Mercaptoethanol aus dem Probenpuffer weggelassen. Nach der Elektrophorese wurde das Gel zweimal jeweils für 30 min in 50 mM TrisHCl pH 7,5 gewaschen, um das SDS zu entfernen, und dann für 10 min in der Assaylösung inkubiert, welche aus 50 mM TrisHCl pH 7,5, 0,5 mg/ml Diaminobenzidin und 0,01 % Wasserstoffperoxid zusammengesetzt war. Die der Peroxidaseaktivität entsprechenden Banden wurden durch die Bildung eines braunen Präzipitats sichtbar gemacht. Nicht reduzierte Molekulargewichtsmarker (Amersham Corporation) wurden in einer parallelen Spur gefahren und durch eine StandardProteinfärbung in einer getrennten Inkubation mit Coomassie Brilliant-Blau sichtbar gemacht. Die Peroxidaseaktivität in dem Gel, entsprechend einer etwa bei 54 kDa migrierenden Bande, wurde nur in Wurzelgewebe nachgewiesen und war weder in Blatt noch Stielgewebe vorhanden. Identische Muster der Peroxidasefärbung wurden erzeugt, wenn mehrere unterschiedliche MaisgenoARTn im Hinblick auf wurzelspezifische Peroxidaseisozyme untersucht wurden (B37 × H84, Pioneer Hybrid 3737, B73).

Beispiel 2 Isolierung von cDNA-Klonen, welche für die Maiswurzel-bevorzugende kationische Peroxidase codieren A. RNA-Isolierung, cDNA-Synthese und Konstruktion einer Bibliothek

Maiskörner (Zea mays hybrid B37 × H84) wurden auf Filterpapier unter sterilen Bedingungen gekeimt. 6 Tage nach der Keimung wurde Wurzelgewebe geerntet und in flüssigem Stickstoff eingefroren und in einem Mörser und Pistill gemahlen, bis ein feines Pulver erhalten wurde. Zu dem Pulver wurden 10 ml TLE-Puffer (0,2 M Tris HCl pH 8,2, 0,1 M LiCl, 5 mM EDTA) mit 1% SDS zugegeben und mit 50 ml TLE-äquilibriertem Phenol und 50 ml Chloroform extrahiert. Die Extraktion wurde für 45 min unter Schütteln inkubiert und nachfolgend für 20 min bei 50°C inkubiert. Die wässrige Phase wurde in ein sauberes Zentrifugenröhrchen übertragen, gefolgt von einer Zentrifugation und zweimal erneut mit einem halben Volumen Phenol/Chloroform (1:1) extrahiert, gefolgt von Extraktionen mit Chloroform. Die RNA wurde aus der wässrigen Phase durch Zugabe eines Drittel Volumens LiCl und Inkubation bei 4°C für 24 h präzipitiert. Das Präzipitat wurde durch Zentrifugation gesammelt, mit 2 M LiCl2 gewaschen und in 12 ml Wasser resuspendiert. Die RNA wurde durch Zugabe eines gleichen Volumens von 4 M LiCl, Inkubation bei 4°C für 24 h und Zentrifugation wieder präzipitiert. Das RNA-Pellet wurde in 2 ml Wasser wieder suspendiert und einer Ethanolpräzipitation unterzogen durch Zugabe von 200 &mgr;l 3 M Na-Acetat und 5,5 ml Ethanol und einer 16-stündigen Inkubation bei -20° C, gefolgt von einer Zentrifugation. Das endgültige RNA-Pellet wurde in 1 ml Wasser resuspendiert. Die Konzentration der RNA wurde bestimmt unter Verwendung einer Messung der Absorption bei 260 nm. Messenger-RNA wurde gereinigt durch Binden an und nachfolgende Elution von PolyA QuickkitTM-Säulen, genau wie vom Hersteller beschrieben (Stratagene Cloning System, La Jolla, CA). Die Konzentration wurde durch eine A260-Messung bestimmt. Die cDNA wurde aus 5 &mgr;g PolyA + RNA unter Verwendung des ZAPcDNA®-Synthesekits synthetisiert, in den Uni-ZAP®-Vektor kloniert, in Phagenköpfe verpackt unter Verwendung von Stratagene Gigapack Gold®-Verpackungsextrakten und infiziert und amplifiziert mit dem E.coli-Stamm PLK-F', genau nach den vom Hersteller (Stratagene) bereitgestellten Protokollen. Der Titer der resultierten amplifizierten Bibliothek wurde bestimmt durch Ausplattieren auf PLK-F'-Zellen und wurde mit 2,7 × 109 pfu (plaque forming units) pro ml bestimmt.

B. Isolierung einer Peroxidasehybridisierungssonde

Eine Hybridisierungssonde, welche einem zentralen Teil der PeroxidasecDNA-Sequenzen entspricht, wurde wie folgt isoliert. Eine Sequenzanalyse für eine Anzahl von klonierten Peroxidasen zeigte, dass es mehrere Domänen in den vorhergesagten und/oder bestimmten Aminosäuresequenzen gab, welche in hohem Maße konserviert waren. Siehe Lagrimini und Rothstein (1987). Es wurden zwei degenerierte Polynukleotidprimer gegen zwei konservierte Domänen synthetisiert, unter Berücksichtigung einer Abweichung von C oder G gegenüber A oder T in der dritten Codonposition in Mais. Ein Teil der ersten konservierten Domäne FHDCFVNGC, entsprechend den Aminosäuren 41 bis 49 der Tabakperoxidase (siehe Lagrimini und Rothstein (1987)) wurde revers translatiert in das degenerierte Oligonukleotid MM1:

5'-TTYCAYGAYTGYTTYGTYAAYGGBTG-3' (SEQ ID NO:3). Ein Teil einer zweiten konservierten Domäne VALSGAHT (entsprechend den Aminosäuren 161 bis 168 der Tabakperoxidase (siehe Lagrimini und Rothstein (1987)) wurden revers translatiert und revers komplementiert und ergab das degenerierte Oligonukleotid MM3: 5'-SGTRTGSGCSCCGSWSAGVGCSAC-3' (SEQ ID NO:4). In beiden Oligonukleotiden bedeutet Y die Degeneration C und T; R zeigt A und G an, S zeigt C und G an; W zeigt A und T an; V zeigt A, C und G an und B zeigt C, G und T an. Unter Verwendung des Polymerase Chain ReactionTM-Kits (Perkin Elmer Cetus) wurde unter Verwendung von DNA einer Gesamtwurzel-cDNA-Bibliothek als Templat ein DNA-Fragment mit 380 bp amplifiziert. Die Größe dieses Fragments entsprach sehr gut der erwarteten Größe basierend auf der Distanz der zwei Domänen in Peroxidaseproteinen, 128 Aminosäuren entsprechen 384 nt. Nach einer Gelreinigung wurde das Fragment mit 380 nt radiomarkiert unter Verwendung einer zufälligen Primermarkierung mit einem Oligo LabelingTM-Kit (Pharmacia LKB Biotechnology, Inc., Piscataway, NJ) mit [DI]50 Mikrocurie [&agr;-32P}dCTP, gemäß den Anweisungen des Herstellers.

C. Screening der Wurzel-cDNA-Bibliothek

200.000 Phagen wurden auf E.coli XLI-Blue-Zellen (Stratagene) ausplattiert, verteilt über 10 Platten. Von jeder Platte wurden Plaque-Lift-Filter im Duplikat hergestellt. Die Filter wurde prähybridisiert und hybridisiert in einem Gesamtvolumen von 150 ml einer Hybridisierungslösung gemäß den Standardverfahren (Sambrook et al., 1989). Die ungefähre Konzentration einer markierten Probe bei der Hybridisierung betrug 2,20 × 105 cpm/ml. Nach der Hybridisierung wurden die Filter gemäß den Standardverfahren gewaschen, luftgetrocknet, bedeckt und gegen einen Kodak XAR5-Film exponiert. Die Signale wurden als positiv bestimmt, wenn sie an der gleichen Position auf den beiden Duplikatfiltern von einer Platte relativ zu den Markierungen auftraten. Vermeintlich positive Phagen wurden aus der Platte ausgebohrt und in 1 ml SM-Puffer gelagert. 34 positive Phagen wurden zweimal gescreent, um einen reinen Phagenstamm zu erhalten, unter Verwendung von Hybridisierungsexperimenten, welche ähnlich sind wie die oben beschriebenen. DNA von allen 34 positiven Phagen-cDNA-Klonen wurde durch alkalische Lyse-Minipreps präpariert, gefolgt von einer in vivo-Bergung von Phagemiden gemäß den Protokollen, welche vom Hersteller (Stratagene) bereitgestellt werden, und zur Freisetzung der Inserts mit EcoRi und XhoI verdaut. Alle Plasmide enthielten ein Insert im Größenbereich von 1,3 bis 1,4 kb, welches mit der Peroxidasesonde mit 380 nt hybridisierte.

Beispiel 3 Analyse des Klons per5 der Maiswurzel-bevorzugenden kationischen Peroxidase-cDNA A. Analyse von Expressionsmuster durch Northern-Hybridisierung

RNA wurde von Wurzel-, Stiel-, Blatt-, Samen- und Antherenpinsel („Tassel")-Gewebe präpariert, wie in Beispiel 2, Abschnitt A. beschrieben wird. 30 &mgr;g denaturierte Gesamt-DNA von jedem Gewebe wurde auf einem 1 %-igen Agarose/Na-Phosphatgel einer Elektrophorese unterzogen und auf eine Nylonmembran übertragen und prähybridisiert und mit der markierten Peroxidasesonde mit 380 nt gemäß Standardverfahren hybridisiert. In Wurzel- und Stiel-RNA wurde ein Transkript mit 1470 nt nachgewiesen, dies fehlte aber in Blatt-, Samen- und Antherenpinsel-RNA. Die Menge des nachgewiesenen Transkripts in Wurzeln war mindestens 5,5-fach höher als in Stielgewebe.

B. Sequenzanalyse des per5-cDNA-Klons

Beide Stränge der dsDNA vom DNA-Klon mit dem längsten Insert (per5) wurden sequenziert unter Verwendung des SequenaseTM-Sequenzierkits (United States Biochemical, Cleveland, Ohio). Die Sequenzierung wurde unter Verwendung der T3- und T7-Primer gestartet und durch Laufen entlang der DNA unter Verwendung von Sequenzierprimern vervollständigt, welche auf Basis der in den vorhergehenden Läufen erhaltenen Sequenz konzipiert wurden. Die Sequenz des per5-cDNA-Inserts wird in SEQ ID NO:5 gezeigt. Das per5-cDNA-Insert ist 1354 Nukleotide (nt) lang und besitzt einen 5'-nicht translatierten Leader mit 52 nt und eine 3'-nicht translatierte Sequenz mit 275 nt vor dem Start der Polyadenylierung. Es enthält auch die Tierkonsensus-Polyadenylierungssignalsequenz AATAAA, 34 Nukleotide vor der Anfügung eines Poly(A)-Schwanzes mit 28 Nukleotiden. Die cDNA besitzt einen offenen Leserahmen von 999 bp, welcher sich zwischen den Nukleotiden 53 und 1051 erstreckt. Das erste ATG-Codon in der cDNA-Sequenz wurde als Translationsstart ausgewählt. Die vorhergesagte Größe der reifen Maisperoxidase beträgt 301 Aminosäuren mit einem MW von 32.432 und einem geschätzten pl von 9,09. Der N-Terminus des reifen Proteins wurde bestimmt durch Abgleichen der Maisaminosäuresequenz mit anderen veröffentlichten Sequenzen und bekannten N-terminalen Sequenzen, welche durch eine N-terminale Aminosäuresequenzierung erhalten wurden. Es wird von der cDNA-Sequenz vorhergesagt, dass das Protein anfänglich als ein PräProtein mit einem MW von 35.685 synthetisiert wird mit einer Signalsequenz mit 32 Aminosäuren, welche 72% hydrophob ist. Das Vorhandensein dieser Signalsequenz, welche auch in mehreren anderen Pflanzenperoxidasen beobachtet worden ist, deutet darauf hin, dass das Protein in das endoplasmatische Reticulum aufgenommen wird und für eine subzelluläre Ansteuerung oder Sekretion modifiziert wird. Dies wird gestützt durch das Vorliegen von 4 potenziellen N-Glykosylierungsstellen (Asn-Xaa-THR/Ser), welche an den Resten 53, 138, 181 und 279 des mutmaßlichen reifen Proteins vorliegen. Das Vorliegen von vier mutmaßlichen N-Glykosylierungsstellen deutet auf eine Rolle bei der posttranslationalen Modifikation (z.B. Glykosylierung) hin und erklärt die Diskrepanz in der beobachteten (~44 kD) und der vorhergesagten Größe des reifen Proteins (~36 kD). Der Vergleich der abgeleiteten Aminosäuresequenzen der Mais-per5-cDNA mit den veröffentlichten Sequenzen von Weizen (siehe Hertig et al. (1991)), Meerrettich [C1] (siehe Fujiyama et al. (1988)), Rübe [TP7] (siehe Mazza und Welinder (1980)), Erdnuss [PNC1] (siehe Buffard et al. (1990)), Tabak (siehe Lagrimini et al. (1987)) und Gurke (siehe Morgens et al. (1990)) bestätigt, dass per5 für ein Peroxidaseprotein codiert. Es gibt eine >80% bis >92%-ige Sequenzähnlichkeit zwischen diesen sieben Pflanzenperoxidasen in vier konservierten Domänen. Alle sieben Peroxidasen besitzen 8 Cysteine, konserviert in der Position in der Primärsequenz. Es wurde gezeigt, dass diese Cysteine im Meenettich und der Rübe in intramolekulare Disulfidbrücken einbezogen sind.

Beispiel 4 Isolierung des genomischen Klons der Maiswurzel-bevorzugenden kationischen Peroxidase A. Genomische DNA-Blot-Hybridisierung

Aus einer diploiden homozygoten Maislinie (B73) wurde genomische DNA isoliert. Die DNA wurde mit den Restriktionsenzymen EcoRI, HindIII und SacI verdaut, auf einem 1 %-igen Agarosegel aufgetrennt, einem Membrantransfer und einer Hybridisierung sowohl mit einer 32P-markierten per5-Volllängen-cDNA als auch einer per5-cDNA-Gen-spezifischen Sonde (GSP5) unterzogen. Die GSP5-Sonde mit 136 bp wurde durch PCR unter Verwendung des per5-cDNA-Klons als Templat-DNA und der Primer MM21: 5'-GTCATAGAACTGTGGG-3' (SEQ ID NO:6); und MM22: 5'-ATAACATAGTACAGCG-3' (SEQ ID NO:7) amplifiziert. Diese Sonde ist aus den Nukleotiden 25 bis 160 des per5-cDNA-Klons zusammengesetzt und umfasst 27 bp der 5'-nicht translatierten Sequenz, die gesamte codierende Sequenz für das mutmaßliche Signalpeptid für das endoplasmatische Reticulum und 7 bp, welche für den Aminoterminus der mutmaßlichen Domäne des reifen per5 codieren.

Unter Verwendung der per5-cDNA-Volllängensonde wurden in jedem Verdau zwei starke Hybridisierungssignale nachgewiesen. Dies deutete darauf hin, dass das per5-Gen in zwei Kopien pro haploidem Genom vorliegen könnte. Jedoch unter Verwendung von GSP als Sonde wurde nur eine Bande pro Spur nachgewiesen, was darauf hindeutete, dass nur eine Kopie des per5-Gens pro haploidem Genom vorliegt und dass die andere hybridisierende Bande auf dem genomischen DNA-Blot entfernter verwandten Sequenzen entspricht. Dies zeigte auch, dass die Sonde GSP5 genspezifisch war und für die Isolierung des genomischen Peroxidaseklons aus einer Maisgenombibliothek geeignet sein würde.

B. Isolierung des Wurzel-bevorzugenden kationischen Peroxidasegens aus einer W22-Maisbibliothek.

Ungefähr 2 × 106 Plaques einer genomischen W22-Maisbibliothek (Clontech Laboratories, Inc., Palo Alto, CA) wurden gescreent unter Verwendung von GSP5 als Sonde gemäß einem Standardprotokoll für das Screening einer Bibliothek. GSP5 wurde als Sonde verwendet, da es nur die genomischen Klone erkennen würde, welche dem per5-cDNA-Klon entsprechen. 10 genomische Klone wurden isoliert und Plaque-gereinigt. Die Klone wurden auf einer Platte amplifiziert, um ihre Titer zu erhöhen, flüssige Lysate wurden angezogen und von diesen Kulturen wurde die Phagen-DNA isoliert. Eine Restriktionsanalyse mit 9 der 10 Klone unter Verwendung von SalI, welches die genomischen DNA-Inserts aus den Phagenarmen freisetzt, zeigte, dass 8 der 9 Klone das gleiche SalI-Bandenmuster aufwiesen. Diese 8 Klone enthielten Inserts mit -14,9 Kb, welche in zwei SalI-Fragmente mit 10,4 Kb bzw. ~4,5 Kb geschnitten werden konnten. Der neunte Klon (perGEN19) enthielt ein Insert mit 15,6 Kb, welches nach einem SalI-Verdau zwei Fragmente ergab, ~13,1 Kb und ~2,5 Kb groß. Eine Restriktion und DNA-Hybridisierungsanalyse deuteten darauf hin, dass perGEN19 ein Insert enthält, welches mit den Sau3A-Inserts der anderen 8 Klone überlappt. Einer der 8 identischen genomischen Klone (perGEN1) wurde stellvertretend weiter analysiert. Das Fragment mit 10,4 Kb wurde in die SalI-Stelle des Plasmids pBluescript®II SK(-) (Stratagene, Inc.) subkloniert, wobei das Plasmid perGEN1 (10.44) erzeugt wurde. Restriktionsverdaue (unter Verwendung von ApaI, BamHI, EcoRI, HindIII, KpnI, NcoI, SacI und XbaI) und DNA-Blot-Hybridisierungsanalysen (unter Verwendung der Volllängen-per5-cDNA oder GSP5 als Sonden) zeigten, dass das SalI-Fragment mit 10,44 Kb in perGEN1 die Peroxidasesequenzen enthielt. Weitere Restriktionsverdaue unter Verwendung von Einzel- und Doppelverdauen mit HindIII, KpnI, SacI und XbaI und DNA-Blot-Hybridisierungsanalysen unter Verwendung von gelgereinigten KpnI-Fragmenten von perGEN1 (10,44) als Sonden wurden mit perGEN1 (10,44) durchgeführt.

Beispiel 5 Sequenz des Maiswurzel-bevorzugenden kationischen Peroxidasegens

Insgesamt 6550 nt der genomischen DNA-Sequenz, welche das Maiswurzel-bevorzugende kationische Peroxidasegen und dessen 5'- und 3'-flankierende Sequenzen umfasst, wurden durch Sequenzierung von überlappenden Unterfragmenten des Plasmids perGEN1 (10,44) erhalten, welches mit der GSP5-Sonde, wie in Beispiel 3 beschrieben, und auch mit dem per5-cDNA-Insert hybridisierte. Die Sequenz ist in SEQ ID NO:1 gezeigt. Die Sequenzierungsverfahren waren Standardverfahren, welche Fachleuten bekannt sind. Die stromaufwärts liegende flankierende Region von der 5'-most NcoI-Stelle zu der mutmaßlichen Startstelle der Translation wurde als 4200 nt lang bestimmt. Das Maiswurzel-bevorzugende kationische Peroxidasegen ist aus Exons zusammengesetzt: Exon 1 (225 bp), Exon 2 (192 bp), Exon 3 (166 bp) und Exon 4 (416 bp). Der GC-Gehalt der Exons beträgt 54,7%. Die Sequenz der erstellten Exon-Sequenzen war 100% identisch mit der Sequenz der codierenden Region der per5-cDNA. Die Translation dieser Exons ergab eine abgeleitete Proteinsequenz, welche 100% identisch ist mit der abgeleiteten Proteinsequenz der per5-cDNA-Sequenz. Es wurden 3 Introns gefunden: Intron 1 (633 bp,%AU = 62,7,%U = 33,8), Intron 2 (132 bp,%AU = 63,6,%U = 35,6) und Intron 3 (101 bp,%AU = 65,3,%U = 37,6). Es wurde gefunden, dass die stromabwärts liegende flankierende Region von dem UGA-Codon bis zu der 3'-most XbaI-Stelle 373 bp lang war. Die Intron-Splicestellen entsprachen den 5'- und 3'-Splicestellen-Konsensussequenzen von Monokotyledonen nicht völlig, folgten jedoch der "GU/AG-Regel" für Splicestellen in Säugern. Die Intronsequenzen entsprachen auch der Definition der von Walbot vorgeschlagenen Definition von Mais-Intronsequenzen. Siehe Walbot et al. (1991).

Beispiel 6 pDAB 406

Dieses Beispiel beschreibt pDAB 406, einen Vektor, welcher für die Untersuchung der Promotoraktivität sowohl in transienten als auch stabilen Transformationsexperimenten entworfen wurde. Die vollständige Sequenz von pDAB 406 ist in SEQ ID NO:8 angegeben. Mit Bezug auf SEQ ID NO:8 werden wesentliche Merkmale von pDAB 406 in Tabelle 1 angegeben.

Der Vektor kann von Fachleuten leicht unter Verwendung allgemein bekannter Verfahren zusammengefügt werden.

Beispiel 7 pDAB 411

Dieses Beispiel beschreibt das Plasmid pDAB 411, welches ein Plasmid mit 11784 bp ist, welches ein pUC19-Grundgerüst aufweist und eine Genkassette enthält, umfassend 1,6 kb des per5-Promotors, den per5-nicht translatierten Leader, das GUS-Gen und die nos 3'-UTR. Im nicht translatierten Leader von pDAB 411 ist kein Intron vorhanden. Die vollständige Sequenz von pDAB 411 ist in SEQ ID NO:9 angegeben. Mit Verweis auf SEQ ID NO:9 sind wesentliche Merkmale von pDAB 411 in Tabelle 2 angegeben.

Eine vorläufige Untersuchung von pDAB 411 in transgenen Maispflanzen konnte keine merkliche GUS-Expression zeigen. Dieser Misserfolg stimmt überein mit unserem Befund, dass bestimmte Gewebe-bevorzugenden Maispromotoren das Vorliegen eines Introns im transkribierten Teil des Gens benötigen, damit eine signifikante Expression beobachtet werden kann.

Beispiel 8 pDAB 419

Dieses Beispiel beschreibt die Konstruktion des Plasmids pDAB 419, welches ein Plasmid mit 11991 bp ist, welches mit pDAB 411 identisch ist, außer dass der dem GUS-Gen vorangehende nicht translatierte Leader eine Sequenz mit 207 bp umfasst, welche eine deletierte Version des Mais-AdhI-Introns 1 umfasst. Die vollständige Sequenz von pDAB 419 ist in SEQ ID NO:10 angegeben. Unter Verweis auf SEQ ID NO:10 sind die entscheidenden Merkmale von pDAB 419 wie folgt:

Das Plasmid pDAB 419 wurde aus pDAB 411 unter Verwendung konventioneller Verfahren konstruiert. Insbesondere wurde der per5-Promotor im Plasmid pDAB 411 mit den Primern MM88:

5'-ACGTACGTACGGGCCCACCACTGTTGTAACT TGTAAGCC-3' (SEQ ID NO:11) und 0F192: 5' AGGCGGACCTTTGCACTGTGA GTTACCTTCGC-3' (SEQ ID NO:12) amplifiziert. Das modifizierte AdhI-Intron 1, entsprechend nt 2939-3145 der SEQ ID NO:8, wurde aus dem Plasmid pDAB 406 unter Verwendung der Primer 0F190: 5'-CTCTGTCGACGAGCGCAGCTGCAC GGGTC-3' (SEQ ID NO:13) und 0F191: 5'-GCGAAGGTAACTCACAGTGCA AAGGTCCGCCT-3' (SEQ ID NO:14) amplifiziert. Nach der Amplifikation wurden beide Fragmente durch ein 1 %-iges Agarosegel gereinigt. Es wurde eine Splice-Overlap-Extension-PCR verwendet, um das per5-Promotorfragment mit dem AdhI-Intronfragment zu verbinden. Proben (2,5 &mgr;l) jedes gelgereinigten Fragments wurden gemischt und unter Verwendung der Primer MM88 und 0F192 (SEQ ID NOS 11 und 12) wieder amplifiziert. Das resuliterende per5-Adh-Fragment mit 1,6 kB wurde mit ApaI und SalI verdaut, gelgereinigt und in pDAB 406 ligiert, welcher mit ApaI und SalI verdaut war, was ein Plasmid pDAB 419 mit 11,991 bp ergab.

Beispiel 9 Transformation von Reis mit pDAB 419

Dieses Beispiel beschreibt die Transformation von Reis mit pDAB 419 und die histochemischen und quantitativen Muster der GUS-Expression in den transformierten Reispflanzen.

A. Transgene Produktion 1. Pflanzenmaterial und Kalluskultur

Zur Initiation von embryogenem Kallus wurden reife Samen von einem Japonica-Kultivar, Taipei 309, von der Hülse befreit und in 70% Ethanol für 2-5 min, gefolgt von einem 30-45 minütigen Einweichen in 50% kommerzieller Bleiche (2,6% Natriumhypochlorid) mit wenigen Tropfen "Liquinox"-Seife oberflächensterilisiert. Die Samen wurden dann 3x in sterilem destillierten Wasser gespült und auf Filterpapier platziert, ehe sie auf ein Induktionsmedium (NB) übertragen wurden. Das NB-Medium bestand aus N6-Makroelementen (Chu, 1978), B5-Mikroelementen und Vitaminen (Gamborg et al., 1968), 300 mg/l Caseinhydrolysat, 500 mg/l L-Prolin, 500 mg/l L-Glutamin, 30 g/l Saccharose, 20 mg/l 2,4-Dichlorphenoxyessigsäure (2,4-D) und 2,5 g/l Gelrite (Schweizerhall, NJ), wobei der pH auf 5,8 eingestellt wurde. Die reifen Samen, welche auf dem Induktionsmedium kultiviert wurden, wurden im Dunkeln bei 28°C inkubiert. Nach 3-wöchiger Kultur wurde der hervortretende Primärkallus, induziert von der Skutellumregion des reifen Embryos, auf frisches NB-Medium für die weitere Erhaltung übertragen.

2. Plasmide und DNA-Präzipitation

pDAB 354 mit 35T-hpt (Hygromycinphosphotransferase, welche eine Resistenz gegen das Antibiotikum Hygromycin verleiht, beschrieben in Beispiel 25) wurde in Cotransformationen mit pDAB 419 verwendet. Etwa 140 &mgr;g DNA wurden auf 60 mg Goldpartikel präzipitiert. Die Plasmid-DNA wurde auf 1,5-3,0 &mgr;m (Aldrich Chemical Co., Milwaukee, WI) oder 1,0 &mgr;m (Bio-Rad) Goldpartikel präzipitiert. Das Präzipitationsgemisch enthielt 60 mg vorgewaschene Goldpartikel, 300 &mgr;l Wasser/DNA (140 &mgr;g), 74 &mgr;l 2,5 M CaCl2 und 30 &mgr;l 0,1 M Spermidin. Nach der Zugabe der Bestandteile in der obigen Reihenfolge wurde das Gemisch sofort geschüttelt und konnte sich für 2-3 min absetzen. Dann wurde der Überstand abpippettiert und verworfen. Die mit DNA beschichteten Goldpartikel wurden in 1 ml 100% Ethanol resuspendiert und auf 17,5 &mgr;g DNA/7,5 mg Gold pro ml Ethanol zur Verwendung in Beschussexperimenten verdünnt.

3. Heliumbeschuss in embryogenen Kallus und Selektion

Aktiv wachsende embryogene Kalluskulturen, 2-4 mm groß, wurden einer Hochosmosebehandlung unterzogen. Diese Behandlung enthielt das Platzieren von Kallus auf NB-Medium mit 0,2 M Mannit und 0,2 M Sorbit (Vain et al., 1993) für 4 h vor dem Heliumbeschuss. Nach der Osmosebehandlung wurden die Kalluskulturen auf "Beschuss"-Medium übertragen (NB + 2% Agar) und mit einer Edelstahlscheibe (230 &mgr;m) bedeckt. Der Heliumbeschuss umfasste die Beschleunigung der suspendierten DNA-beschichteten Goldpartikel in Richtung auf und in das vorbereitete Gewebeziel. Die verwendete Vorrichtung war ein früherer Prototyp des Typs, welcher im US-Patent Nr. 5,141,131 beschrieben wird, welches hierin durch Bezugnahme enthalten ist, wenngleich beide auf ähnliche Art und Weise funktionieren. Die Kalluskulturen wurden bei unterschiedlichen Heliumdrücken (1 750-2 250 psi) einmal oder zweimal pro Ziel beschossen. Nach dem Beschuss wurde der Kallus über Nacht zurück auf Hochosmosemedium gelegt, ehe er auf einem Selektionsmedium platziert wurde, welches aus NB-Medium mit 30 mg/l Hygromycin bestand. Nach 2 Wochen wurden die Kulturen auf frisches Selektionsmedium mit höheren Konzentrationen des Selektionsmittels, d.h. NB + 50 mg/l Hygromycin, übertragen (Li et al., 1993).

4. Regeneration

Kompakte, weißlich gelbe embryogene Kalluskulturen, gewonnen auf NB + 50 mg/l Hygromycin, wurden regeneriert durch Übertragen auf "Prä-Regenerations" (PR)-Medium + 50 mg/l Hygromycin. Das PR-Medium bestand aus NB-Medium mit 2 mg/l 6-Benzylaminopurin (BAP), 1 mg/l Naphthalenessigsäure (NAA) und 5 mg/l Abszisinsäure (ABA). Nach 2 Wochen Kultur im Dunkeln wurden sie auf "Regenerations" (RN)-Medium übertragen. Die Zusammensetzung des RN-Mediums ist NB-Medium mit 3 mg/l BAP und 0,5 mg/l NAA. Die Kulturen auf dem RN-Medium wurden für 2 Wochen bei 28°C unter Hochfluoreszenzlicht (325-ft-Kerzen) inkubiert. Die Pflänzchen mit 2 cm Trieben wurden auf 1/2 MS-Medium (Murashige und Skoog, 1962) mit 1/2 B5-Vitaminen, 10 g/l Saccharose, 0,05 mg/l NAA, 50 mg/l Hygromycin und 2,5 g/l Gelrite, eingestellt auf pH 5,8 in „Magenta-Boxen" übertragen. Als die Pflänzchen mit einem gut entwickelten Wurzelsystem ausgestattet waren, wurden sie auf Erde übertragen (1 Metromix:1 Teil Erde) und in einer Wachstumskammer oder einem Gewächshaus (29/24°C Tag/Nacht-Zyklus, 50-60% Feuchtigkeit, 12 h Lichtperiode) bis zur Reife aufgezogen. Es wurden insgesamt 23 Hygromycin-resistente Kalluslinien etabliert.

B. Histochemische GUS-Assays

Histochemische GUS-Assays wurden durchgeführt gemäß Jefferson (1987). Die Gewebe wurden in 24-Well Mikrotiterplatten (Corning, New York, NY) mit 500 &mgr;l Assaypuffer pro Well platziert. Der Assaypuffer bestand aus 0,1 M Natriumphosphat (pH 8,0), 0,5 mM Kaliumferricyanid, 0,5 mM Kaliumferrocyanid, 10 mM Natrium-EDTA, 1,9 mM 5-Brom-4-chlor-3-indolylbeta-Dglucuronid und 0,06% Triton X-100. Die Platten wurden im Dunkeln für 1-2 Tage bei 37°C inkubiert, ehe sie unter einem Mikroskop beobachtet wurden. 14 der 23 Hygromycin-resistenten Reislinien exprimierten das GUS-Gen, wie durch eine Blaufärbung nach 48 h im histochemischen GUS-Assay gezeigt wurde. 9 der 14 GUS exprimierenden Linien wurden weiter charakterisiert (Tabelle 4).

  • + = gelegentlich blaue Region
  • ++ = durchgehende hellblaue Färbung
  • +++ = dunkelblaue Regionen
  • ++++ = durchgehende intensive blaue Färbung

C. Southern-Analyse

Eine Southern-Analyse wurde verwendet, um Primärregenerat (Ro)-Pflanzenlinien von Reis zu identifizieren, welche eine intakte Kopie des Transgens enthielten und um die Komplexität des Integrationsereignisses zu messen. Mehrere Blätter von jeder Reispflanze wurden geerntet und bei jeder Linie wurde bis zu 5 Einzelpflanzen eine Probe entnommen. Genomische DNA der Reis-Ro-Pflanzen wurde aus lyophilisiertem Gewebe präpariert, wie von Saghai-Maroof et al. (1984) beschrieben. 8 &mgr;g jeder DNA wurden mit dem Restriktionsenzym XbaI verdaut unter Verwendung der vom Hersteller vorgeschlagenen Bedingungen (Bethesda Research Laboratory, Gaithersburg, MD) und durch Agarosegelelektrophorese aufgetrennt. Die DNA wurde auf eine Nylonmembran geblottet, wie von Southern beschrieben (1975, 1980).

Eine für die &bgr;-Glucuronidase (GUS) codierende Region spezifische Sonde wurde aus dem Plasmid pDAB419 ausgeschnitten unter Verwendung der Restriktionsenzyme NcoI und SstI. Das resultierende 1,9 kb-Fragment wurde mit dem Qiaex II-DNA-Reinigungskit (Qiagen Inc., Chatsworth, CA) gereinigt. Die Sonde wurde präpariert unter Verwendung eines Oligomarkierungskits (Pharmacia LKB, Piscataway, NJ) mit 50 Mikrocurie von &agr;32P-dCTP (Amersham Life Science, Arlington Heights, IL). Die GUS-Sonde hybridisierte mit der genomischen DNA auf den Blots. Die Blots wurden bei 60°C in 0,25 × SSC und 0,2% SDS für 45 min gewaschen, trocken-geblottet und über Nacht gegen einem XAR-5-Film mit zwei Verstärkungsscheiben exponiert.

D. GUS-Quantifizierung 1. Gewebepräparation

Histochemisch GUS-positive Pflänzchen, aufgezogen in Magenta-Boxen, wurden in Wurzel- und Blattgewebe zerteilt. Zweifache Proben von ungefähr 300 mg Wurzel und 100 mg Blatt wurden in ein steriles 1,5 ml-Probenröhrchen (Kontes, Vineland, NJ) übertragen und vor dem Einfrieren bei -80°C auf Eis platziert. Die Extraktion von Proteinen bestand aus Mahlen des Gewebes unter Verwendung eines Edelstahl-Kontes-Pellet-Pistills, angetrieben durch einen 0,35 Amp, 40 W-Motor (Modell 102, Rae Corp., McHenry, IL) bei einer Einstellung von "40". Der GUS-Lysepuffer vom GUS-LightTM-Assaykit (Tropix, Bedford, MA) wurde durch die Zugabe von 20% Glycerol modifiziert, um den Extraktionspuffer zu erzeugen. Vor dem Mahlen wurden die gefrorenen Proben auf Eis platziert und Aliquots von 100 &mgr;l Extraktionspufter wurden zu dem Probenröhrchen zugegeben. Das Gewebe wurde in ungefähr vier 25-Sekundenintervallen homogenisiert, während zusätzliche Aliquots an Extraktionspuffer bis zu einem Endvolumen von 300 &mgr;l für Wurzelgewebe und 200 &mgr;l für Blattgewebe zugegeben wurden. Die Proben wurden auf Eis gehalten, bis das Zermahlen aller Proben vollständig war. Dann wurden die Proben zweimal bei 5°C für 8 min bei voller Geschwindigkeit zentrifugiert (Eppendorf-Zentrifuge, Modell 5415). Der Überstand wurde in sterile Mikrozentrifugenröhrchen auf Eis übertragen und später verwendet, um die Proteine und GUS zu quantifizieren, das Pellet wurde verworfen.

2. Quantifizierung des Gesamtproteins

Die Quantifizierung von extrahierbaren Proteinen wurde mit dem Bio-Rad-Proteinassaykit (Bio-Rad Laboratories, Hercules, CA) bestimmt. Ein Proteinstandard, hergestellt aus Rinderalbumin (Sigma, St. Louis, MO) wurde verwendet, um eine Standardkurve von 0 bis 100 &mgr;g/ml zu erhalten. Zweifache Proben für jedes Gewebe wurden präpariert unter Verwendung von 5 &mgr;l Proteinextrakt mit 5 &mgr;l GUS-Lösepuffer in einem sterilisierten Mikrozentrifugenröhrchen. Dann wurde Wasser zugegeben, um das Volumen auf 800 &mgr;l anzuheben, ehe 200 &mgr;l Färbereagenz zugegeben wurden. Die Röhrchen wurden geschüttelt, dann bei Raumtemperatur für mindestens 5 min inkubiert, ehe die Flüssigkeit in 1,5 ml-Küvetten übertragen und in dem Spektrophotometer (Shimadzu, Japan) platziert wurde. Die Absorptionsmessungen wurden bei 595 nm durchgeführt.

3. GUS-Quantifizierung

Die Analyse der GUS-Aktivität erforderte die Verwendung des GUS-LightTM-Assaykits und eines automatischen Lumineszenzphotometers (Modell 1251-Luminometer und Modell 1291-Dispenser, Bio-Orbit, Finnland). Für jede Probe wurde mit 1 &mgr;l Extrakt eine relative Menge GUS-Aktivität gemessen. Von der Anfangsmessung wurden die Probenvolumen auf zwischen 2 und 10 &mgr;l Extrakt pro Luminometergefäß vergrößert, solange sie innerhalb der Nachweisgrenzen des Apparates blieben. Die Proben wurden dreifach präpariert, zu ihnen wurden 180 &mgr;l Aliquots des GUS-LightTM-Reaktionspuffers in jedem Luminometergefäß in 10 sek-Intervallen zugegeben. Nach einer 1-stündigen Inkubation bei Raumtemperatur im Dunkeln wurden die Gefäße in den Probenhalter des Luminometers geladen. Zu jedem Gefäß wurden beim Eintreten in die Kammer 300 &mgr;l GUS-LightTM-Lichtemissionsbeschleunigungspufter zugegeben und die Lumineszenz wurde über eine 5-Sekunden-Integrationsperiode nachgewiesen. Eine "Blindreaktion" war in dem Assay enthalten, unter Verwendung von 10 &mgr;l des GUS-Extraktionspuffers. Ein GUS-Standard, präpariert, um 8000 relative Lichteinheiten (RLU) von kommerziell erhältlicher &bgr;-Glucuronidase zu einzugeben (Sigma, MO), wurde verwendet, um die Empfindlichkeit des verwendeten Apparats und der Reagenzien zu bestätigen. Die GUS-Messwerte (RLU) wurden vor dem Teilen durch &mgr;g-Gesamtprotein im Hinblick auf die "Blindprobe" und die GUS-Standardmesswerte korrigiert.

  • n.d = nicht bestimmt

Die aus transgenem Kallus regenerierten Reispflanzen färbten sich sowohl in Wurzeln als auch Blättern positiv im Hinblick auf GUS, was eine konstitutive Expression anzeigt. Aufgrund des Fehlens der Expression in den Blättern des nativen per5-Gens in Mais wurde nicht erwartet, dass durch das pDAB419-Konstrukt eine konstitutive Expression von GUS beobachtet werden würde.

Beispiel 10 Transformation von Mais mit pDAB419 A. Etablierung von Typ II-Kalluszielen

Zwei Eltern von "High II" (Armstrong und Phillips, (1991)) wurden gekreuzt und als die sich entwickelnden Embryos eine Größe von 1,0 bis 3,0 mm erreichten (10-14 Tage nach der Bestäubung) wurde die Ähre herausgeschnitten und oberflächensterilisiert. In Kürze, die Ähren wurden mit Liquinox-Seife (Alconox, Inc., NY) gewaschen und für 2-5 min in 70% Ethanol und für 30-45 min 20%-ige kommerzielle Bleiche (0,1% Natriumhypochlorit) eingetaucht, gefolgt von 3 Spülungen in sterilem destillierten Wasser. Die unreifen Embryonen wurden isoliert und verwendet, um Typ II-Kallus zu erzeugen.

Für die Erzeugung von Typ II-Kallus wurden unreife Embryonen (mit der Seite des Scutellum nach oben) auf die Oberfläche von "Initiations"-Medium (15Ag10) platziert, welches N6-Basissalze und Vitamine (Chu, 1978), 20 g/l Saccharose, 2,9 g/l L-Prolin, 100 mg/l enzymatisches Caseinhydrolysat (ECH), 37 mg/l Fe-EDTA, 10 mg/l Silbernitrat, 1 mg/l 2,4-Dichlorphenoxyessigsäure (2,4-D) und 2,5 g/l Gelrite (Schweizerhall, NJ) enthielt, wobei der pH auf 5,8 eingestellt war. Nach 2-3-wöchiger Inkubation im Dunkeln bei 28°C wurde weicher, bröckeliger Kallus mit zahlreichen globulären und länglichen somatischen embryoähnlichen Strukturen (Typ II) ausgewählt. Nach 2-3 Subkulturen auf dem "Initiations"-Medium wurde der Kallus auf "Erhaltungs"-Medium (No. 4) übertragen. Das "Erhaltungs"-Medium unterschied sich von dem "Initiations"-Medium darin, dass es 690 mg/l L-Prolin und kein Silbernitrat enthielt. DerTyp II-Kallus wurde nach etwa 16-20 Wochen für die Transformationsexperimente verwendet.

B. Heliumbeschuss und Selektion

pDAB367 (Beispiel 27) und pDAB419 wurden auf der Fläche von Goldpartikeln mit 1,5-3,0 &mgr;m (Aldrich Chem. Co., Milwaukee, WI) copräzipitiert. pDAB367 enthält eine Phosphinothricin-Acetyltransferase-Genfusion, welche für eine Resistenz gegenüber dem Herbizid BastaTM codiert. Dieses Gen wird verwendet, um stabile transgene Ereignisse zu selektieren. Das Präzipitationsgemisch enthielt 60 mg vorgewaschene Goldpartikel, 140 &mgr;g Plasmid-DNA (jeweils 70 &mgr;g) in 300 &mgr;l sterilem Wasser, 74 &mgr;l 2,5 M CaCl2 und 30 &mgr;l 0,1 M Spermidin. Nach der Zugabe der Bestandteile in der obigen Reihenfolge wurde das Gemisch sofort geschüttelt und man ließ es für 2-3 min absetzen. Der Überstand wurde entfernt und verworfen und die Plasmid/Gold-Partikel wurden in 1 ml 100% Ethanol resuspendiert und unmittelbar vor dem Beschuss auf 7,5 mg Plasmid/Gold-Partikel pro ml Ethanol verdünnt.

Ungefähr 400-600 mg des Typ II-Kallus wurde auf der Oberfläche eines #4-Mediums mit 36,4 g/l Sorbit und 36,4 g/l Mannit für 4 h platziert. In der Vorbereitung für den Beschuss wurde der Kallus auf #4-Medium mit 2% Agar (JRH Biosciences, Lenexa, KS) übertragen und mit einer Edelstahlscheibe (104 &mgr;m) bedeckt. Der Heliumbeschuss wurde durchgeführt unter Verwendung der gleichen Vorrichtung, wie in Beispiel 9 beschrieben. Jede Kallusprobe wurde insgesamt viermal beschossen. Nach dem Beschuss wurde der Kallus auf #4-Medium mit 36,4 g/l Sorbit und 36,4 g/l Mannit für 18-24 h zurückgesetzt, danach wurde er auf "Selektions"-Medium (#4-Medium mit 30 mg/l BastarTM und kein ECH oder L-Prolin) übertragen. Der Kallus wurde alle 4 Wochen für etwa 3 Monate auf frisches "Selektions"-Medium übertragen. Nach 8-12 Wochen wurden aktiv wachsende transgene Kolonien isoliert und alle 2 Wochen auf frischem "Selektions"-Medium subkultiviert, um Kallus für die Regeneration zu vermehren.

C. Histochemischer GUS-Assay.

BastaTM-resistenter Kallus wurde durch Inkubation einer 50 mg-Probe in 150 &mgr;l Assaypuffer für 28 h bei 37°C im Hinblick auf GUS-Expression untersucht. Der Assaypuffer bestand aus 0,2 M Na-Phosphat pH 8,0, 0,5 mM jeweils von Kaliumferricyanid und Kaliumferrocyanid, 10 mM Natrium-EDTA, 1,9 mM 5-Brom-4-chlor-3-indolyl-b-D-glucuronid und 0,06% v/v Triton X-100 (Jefferson et al., 1987). Transgener Kallus, welcher das GUS-Gen exprimierte, wurde blau. Insgesamt wurden für Mais 17 BastaTM-resistente Kalluslinien etabliert, wobei 3 Maislinien das GUS-Gen exprimierten, wie durch eine Blaufärbung nach 48 h in dem histochemischen GUS-Assay gezeigt wurde.

  • + = gelegentlich blaue Region
  • ++ = durchgehende hellblaue Färbung
  • +++ = dunkelblaue Regionen
  • ++++ = durchgehende intensive blaue Färbung

Zwischen dem exprimierenden Kallus lag eine beträchtliche Variabilität in der Intensität der Färbung im Bereich von sehr intensiv bis ziemlich fleckig vor (Tabelle 6). Im Allgemeinen war die Färbung des Kallus bei Reis intensiver als bei Mais.

D. Pflanzenregeneration.

GUS-exprimierender Kallus wurde auf "Induktions"-Medium übertragen und bei 28°C, 16/8 Licht/Dunkel-Fotoperiode mit geringem Licht (13 mE/m2/sek) für 1 Woche inkubiert, gefolgt von 1 Woche mit starkem Licht (40 mE/m2/sek), bereitgestellt durch kalte weiße Fluoreszenzlampen. Das "Induktions"-Medium war zusammengesetzt aus MS-Salzen und Vitaminen (Murashige und Skoog (1962)), 30 g/l Saccharose, 100 mg/l Myoinositol, 5 mg/l 6-Benzylaminopurin, 0,025 mg/l 2,4-D, 2,5 g/l Gelrite (Schweizerhall, NJ), eingestellt auf pH 5,7. Nach dieser zweiwöchigen Induktionsperiode wurde der Kallus auf "Regenerations"-Medium übertragen und in starkem Licht (40 mE/m2/sek) bei 28°C inkubiert. Das Regenerationsmedium war zusammengesetzt aus MS-Salzen und Vitaminen, 30 g/l Saccharose und 2,5 g/l Gelrite (Schweizerhall, NJ), eingestellt auf pH 5,7. Der Kallus wurde alle 2 Wochen auf frisches "Regenerations"-Medium subkultiviert, bis Pflänzchen erschienen. Sowohl das "Induktions"- als auch das "Regenerations"-Medium enthielten 30 mg/l BastaTM. Die Pflänzchen wurden in 10 cm-Töpfe übertragen, welche ungefähr 0,1 kg von trockenem Metromix (The Scotts Company, Marysville, OH) enthielten, gründlich befeuchtet und für ungefähr 4 Tage mit klaren Plastikbechern bedeckt. Im Zustand mit 4-5 Blättern wurden die Pflanzen in Töpfe mit 5 Gallonen eingepflanzt und bis zur Reife aufgezogen.

E. Southern-Analyse

Eine DNA-Sonde, spezifisch für die &bgr;-Glucuronidase (GUS) codierende Region wurde aus dem pDAB418-Plasmid unter Verwendung der Restriktionsenzyme NcoI und SstI ausgeschnitten. Das 1,9 kb-Fragment wurde mit dem Qiaex II-DNA-Reinigungskit (Qiagen Inc., Chatsworth, CA) gereinigt. Die Sonde wurde mit 50 Mikrocurie a32P-dCTP (Amersham Life Science, Arlington Heights, IL) hergestellt, unter Verwendung eines Oligomarkierungskits (Pharmacia LKB, Piscataway, NJ). Es wurde eine Southern-Analyse verwendet, um Maiskallusmaterial zu identifizieren, welches eine intakte Kopie des Transgens enthielt, und um die Komplexität des Integrationsereignisses zu messen. Das Kallusmaterial wurde von dem Medium entfernt, in destilliertem Wasser für 30 min eingeweicht und vor der Lyophilisierung in eine neue Petrischale übertragen. Genomische DNA von dem Kallus wurde aus dem lyophilisierten Gewebe präpariert wie von Saghai-Maroof et al. (1984) beschrieben. 8 &mgr;g jeder DNA wurden mit dem Restriktionsenzym XbaI verdaut, unter Verwendung der vom Hersteller (Bethesda Research Laboratory, Gaithersburg, MD) vorgeschlagenen Bedingungen, und durch Agarosegelelektrophorese aufgetrennt. Die DNA wurde auf eine Nylonmembran geblottet, wie von Southem beschrieben (1975, 1980). Die GUS-Sonde wurde mit der genomischen DNA auf den Blots hybridisiert. Die Blots wurden bei 60°C in 0,25 x SSC und 0,2% SDS für 45 min gewaschen, trocken-geblottet und über Nacht mit zwei Verstärkungsplatten gegen einen XAR-S-Film exponiert.

F. Screening von R0-Pflanzen im Hinblick auf eine einheitliche Expression.

Das sechste Blatt wurde von 5 oder 6 Pflanzen im "V/6-Äquivalenz"-Stadium gesammelt (da die exakte Blattnummer von R0-Pflanzen nicht bestimmt werden konnte, wurde das Pflanzencharaktenstikum des V6-Stadiums verwendet). Das gesamte Blatt wurde entfernt, in Stücke geschnitten und bei -70°C bis zur weiteren Verarbeitung in einer Plastiktüte gelagert. Die Blätter wurden in flüssigem Stickstoff pulverisiert und Gewebeproben, welche ungefähr 400 &mgr;l Gewebe darstellen, wurden in Mikrozentrifugenröhrchen platziert. Das Gewebe wurde entweder gelagert oder unmittelbar extrahiert. GUS wurde extrahiert durch Mischen des pulverisierten Gewebes mit GUS-Lysepuffer (Jefferson, 1987), modifiziert durch die Zugabe von 1 % Polyvinylpyrrolidon (für mindestens 1 h im Puffer hydratisiert), 20% Glycerol, 50 mg/ml Antipain, 50 mg/ml Leupeptin, 0,1 mM Chymostatin, 5 mg/ml Pepstatin und 0,24 mg/ml PefablocTM (Boehringer Mannheim, Indianapolis, IN). Nach einer Inkubation auf Eis für mindestens 10 min wurden die Proben bei 16 000 g für 10 min zentrifugiert. Die Überstände wurden gesammelt und ein zweites Mal wie oben beschrieben zentrifugiert. Die Überstände wurden gewonnen und auf Trockeneis eingefroren und bei -70°C gelagert. Die Experimente zeigten, dass die GUS-Aktivität für mindestens 4 Frost-Tau-Zyklen bei einer Lagerung in dem oben beschriebenen Puffer stabil war. Die GUS-Aktivität wurde unter Verwendung eines GUS-LightTM-Kits (Tropix, Inc., Bedford, MA) gemessen. Zu Proben von 5 &mgr;l unverdünntem Extrakt oder von Extrakt, welcher so verdünnt war, dass die Lumineszenz in dem durch den Luminometer gemessenen Bereich lag, wurden 195 &mgr;l des GUS-LightTM-Reaktionspuffers zugegeben. Nach 1 h wurde die Lumineszenz unter Verwendung eines BioOrbit 1251-Luminometers, ausgestattet mit einem BioOrbit 1291-Injektors, nach der Injektion von 300 &mgr;l GUS-LightTM-Beschleuniger gemessen. Die Lumineszenz wurde für 5 sek nach einer Verzögerung von 5 sek integriert. Das Protein wurde mit dem von Bradford entwickelten Assay (1976) unter Verwendung von humanem Serumalbumin als Standard gemessen.

G. Quantitative Analysen zur organspezifischen Expression

Im Gewächshaus in Töpfen mit 5 Gallonen herangezogene Pflanzen wurden geerntet, um die Organspezifität der GUS-Expression zu bestimmen. Vor dem Ernten von Gewebe von V6-Äquivalenzpflanzen wurden die Wurzeln ungefähr 1 Inch von der Seite des Topfs abgeschnitten, um alles tote Wurzelgewebe zu entfernen. Die Wurzeln von einem VT-Stadium (reife) Pflanzen wurden gewaschen und alles tote Wurzelgewebe wurde vor dem Einfrieren bei -70°C entfernt. Blätter, Stiele (nur Pflanzen im VT-Stadium) und Wurzeln wurden geerntet und entweder bei -70°C eingefroren oder sofort in flüssigem Stickstoff pulverisiert. Die Experimente zeigten, dass GUS in gefrorenem Gewebe stabil ist. Nach dem Pulverisieren der Gewebe wurden 3 Aliquots von ungefähr 10 ml Gewebe in zuvor gewogenen Röhrchen gesammelt, und die Röhrchen mit dem Gewebe wurden gewogen und bei -70° C gelaget. Das Gewebe wurde in dem gleichen Puffer wie oben beschrieben extrahiert, außer dass Proteaseinhibitoren nur zu Aliquots des Extrakts anstelle des gesamten Extraktvolumens zugegeben wurden. Für die Extraktion wurde das pulverisierte Gewebe in 4 ml Puffer/g Gewebe getaut und für 5-10 sek bei 8000 rpm homogenisiert, unter Verwendung eines Ultra-Turrax T 25 (IKA-Works, Inc.)-Homogenisators mit einem 18 mm-Fühler. Die Proben wurden bei 4°C für 5 min bei 2015 g zentrifugiert. Nach dem Entfernen der Überstände wurden die Pellets erneut extrahiert, jedoch mit 2 ml Puffer/g Gewebe und der Überstand nach der Zentrifugation wurde mit dem Überstand der ersten Extraktion vereinigt. Das Pellet wurde erneut mit 2 mg/g Gewebe extrahiert, der Überstand nach der Zentrifugation wurde getrennt von den vereinigten Überständen der ersten beiden Extraktionen bearbeitet. Die in dem letzten Extrakt gewonnene GUS-Aktivität wurde verwendet, um die Extraktionseffizienz der ersten zwei Extraktionen zu bestimmen. Die GUS- und Proteinassays wurden für beide Gruppen der Überstände wie oben beschrieben durchgeführt. Wurzeln an jedem Knoten der V7-Pflanzen, angezogen in Töpfen mit ungefähr 5 Gallonen, wurden wie oben beschrieben separat untersucht.

H. Histochemische Analysen zur Färbung von Maisgeweben.

Histochemische Analysen der per5adh/GUS/nos-Genexpression wurde im Wesentlichen wie von Jefferson (1987) beschrieben durchgeführt. Zuerst wurden die Wurzeln 1 h bei 37°C in 100 mM NaqPO4-Puffer, pH 7,0, 10 mM EDTA, 0,1% Triton X-100 und 10 mM &bgr;-Mercaptoethanol behandelt. Die Wurzelabschnitte wurden 3x mit dem gleichen Puffer, jedoch ohne &bgr;-Mercaptoethanol gewaschen und dann 1 h in dem gleichen Puffer bei 37°C inkubiert. Es wurde histochemischer GUS-Assaypuffer (Jefferson (1987)) zugegeben und die Gewebe wurden für unterschiedliche Zeiten bei 37°C inkubiert. Wurzeln von V6- und VT-Pflanzen wurden von jedem Knoten entfernt und getrennt behandelt. Die Wurzeln von jedem Knoten der V6-Pflanzen wurden gemessen, in 6 gleiche Teile geschnitten und 2 Stücke mit 1 cm wurden mit Enden jedes Wurzelabschnitts entfernt. 1 Wurzelstück von jedem Abschnitt wurde gefärbt, bis die Enden blau waren, das andere Stück von jedem Abschnitt wurde über Nacht gefärbt. Die Wurzeln der VT-Pflanzen wurden auf ähnliche Art und Weise gefärbt, jedoch wurden zwei Wurzeln von jedem Knoten, falls vorhanden, in mehrere Stücke geschnitten und zusammen gefärbt. Eine Wurzel von jedem Knoten wurde gefärbt, bis die Wurzeln blau wurden, die andere Wurzel von jedem Knoten wurde über Nacht gefärbt. 1 intaktes Blatt wurde vom unteren Teil, von der Mitte und vom oberen Teil der V6- und VT-Pflanzen entfernt und analysiert. Die Blätter wurden der Länge nach geschnitten. Die Blatthälfte mit der Mittelrippe wurde schräg in Abschnitten über die Mittelrippe und entlang der äußeren Kante der Blätter geschnitten. Die Blätter wurden mit histochemischen GUS-Assaypuffer vakuuminfiltriert und bei 37°C inkubiert, bis gefärbte Regionen sichtbar wurden. Das Chlorophyll wurde durch Inkubation in 70% Ethanol bei Raumtemperatur entfernt. Stücke von Stielen, welche einen Knoten und benachbarte internodale Regionen enthielten, wurden vom unteren Teil, von der Mitte und von oberen Abschnitten der VT-Pflanzen herausgeschnitten. Querschnitte der Regionen zwischen den Knoten und der Längsschnitte, welche Knoten und Regionen zwischen Knoten oberhalb und unterhalb der Knoten enthielten, wurden gefärbt. Ein längs geschnittener und ein quer geschnittener Teil von jeder untersuchten Stielregion wurde gefärbt, bis blaue Farbe sichtbar wurde, ein andere Gruppe von Stielteilen wurde über Nacht gefärbt. Nach der Färbung wurden die Stielteile in 70% Alkohol platziert, um das Chlorophyll zu entfernen. Von den transgenen per5adh/GUS/nos-Pflanzen wurde für 2 h von Pinseln Pollen gesammelt, von welchen alle extrudierten Antheren entfernt wurden. Der Pollen wurde über Nacht gefärbt. Die Körner wurde 20 Tage nach der Befruchtung von Kreuzungen analysiert, welche mit der transgenen Pflanze als männlichem Elternteil und von Kreuzungen, welche mit der transgene Pflanze als weiblichem Elternteil durchgeführt wurden. Die Körner wurden längs durch den Embryo präpariert.

I. Screening von R0-Pflanzen im Hinblick auf eine einheitliche Expression

Um die räumlichen und temporären Expressionsmuster eines Promotors von Interesse zu definieren, dürfen die Expressionsmuster eines Transgens nicht durch die Lage im Chromosom beeinflusst werden. Die Indizien deuten darauf hin, dass eine Transgenexpression in unterschiedlichen Teilen der Pflanze auf uneinheitliche Weise "stillgelegt" werden kann, was räumliche und temporäre Expressionsmuster ergibt, welche nicht die wirkliche Promotoraktivität in transgenen Pflanzen repräsentieren. Eine Stllegung eines Gens tritt oft zufallsabhängig auf, wobei sie bei Individuen innerhalb einer Population in unterschiedlichen Ausmaßen auftritt (Übersicht von Matzke et al. (1993)). Alle Transformationsereignisse wurden im Hinblick auf eine einheitliche Expression bei 5 oder 6 R0-Pflanzen für jedes Ereignis gescreent (Tabelle 7), wodurch Transformationsereignisse eliminiert wurden, welche eine Stilllegung des Transgens in einer Population dieser Größe zeigen. Die GUS-Expression zwischen Ro-Pflanzen, welche für jedes der hier beschriebenen drei Transformationsereignisse analysiert wurden, waren statistisch nicht unterscheidbar.

  • a für einige der 308/419-01-Pflanzen wurde nur eine Probe untersucht.
  • b Standardabweichungen wurden aus unabhängigen Untersuchungen von zwei Aliquots des Gewebes von jeder Pflanze bestimmt.

J. Quantitative Analysen von pDAB419-Maispflanzen.

Quantitative Analysen der GUS-Aktivität wurden in zwei Stadien der Kornentwicklung durchgeführt: V6 (Wirtelstadium) und VT (Auftreten von Pinseln). Gesamte Blatt-, Stiel- oder Wurzelproben wurden pulverisiert und Aliquots wurden im Duplikat analysiert. Die GUS-Aktivität wurde entweder relativ zur extrahierten Proteinkonzentration oder zum Frischgewicht des Gewebes bestimmt. Die hohe prozentuale Rückgewinnung der GUS-Aktivität zeigt, dass das Expressionsverfahren für GUS effizient ist (Tabellen 8 und 9). Die 308/419-01- und 419-02-Pflanzen waren BC1- (zweimal nacheinander mit der gleichen Inzucht gekreuzt) bzw. R0-Generationen. Der per5adh-Promotor wird in Wurzel-, Stiel (VT-Pflanzen)- und Blattgewebe (Tabellen 8 und 9) exprimiert. Wenn ein Abgleich mit dem extrahierbaren Protein durchgeführt wird, exprimieren Wurzeln höhere Mengen an GUS als Blätter in V6- und VT-Pflanzen, in einem Stiel wird GUS mit höheren Mengen angereichert als in Blättern oder Wurzeln von VT-Pflanzen (Tabellen 8 und 9). Die hinsichtlich des Frischgewichts des Gewebes abgeglichene GUS-Expression und die hinsichtlich der extrahierbaren Proteinmengen abgeglichene Expression folgen ähnlichen Trends der Organspezifität und Expression in VT-Pflanzen, obwohl die relativen Anteile der Expression zwischen den Organen unterschiedlich sind. Bei V6-Pflanzen exprimiert der per5adh-Promotor GUS mit ähnlichen Mengen in Blättern und Wurzeln, bezogen auf das Frischgewicht des Gewebes, aber der Promotor exprimiert GUS in deutlich höherem Maß in Wurzeln als in Blättern, wenn die Expression im Hinblick auf das extrahierbare Protein abgeglichen wird.

  • a Standardabweichungen wurden aus unabhängigen Untersuchungen von zwei Aliquots des Gewebes von jeder Probe bestimmt.
  • b Extraktionseffizienz als Prozent Rückgewinnung der GUS-Aktivität in den ersten zwei Extraktionen bezüglich der gesamten GUS-Aktivität in allen drei Extraktionen der Gewebe.

  • a Standardabweichungen wurden aus unabhängigen Untersuchungen von zwei Aliquots des Gewebes von jeder Probe bestimmt.
  • b Extraktionseffizienz als Prozent Rückgewinnung der GUS-Aktivität in den ersten zwei Extraktionen bezüglich der gesamten GUS-Aktivität in allen drei Extraktionen der Gewebe.

Die per5adh-Protomoraktivität wurde ausführlich in Wurzeln untersucht. Für diese Experimente wurden 308/419-01-Pflanzen in Töpfen mit 15 Gallonen angezogen, um die Wurzelqualität zu verbessern. Bei allen Knoten der Wurzeln wurde GUS exprimiert, aber die GUS-Aktivität pro mg extrahierbarem Protein steigt in den Knoten 3-5 relativ zur Expression in den Knoten 1 und 2 (Tabelle 10).

  • a Standardabweichungen wurden aus unabhängigen Untersuchungen von zwei Aliquots des Gewebes von jeder Probe bestimmt, für Knoten 1 war nur eine Probe verfügbar.

K. Histochemische Analysen von pDAB419-Maispflanzen.

Der per5adh-Promotor exprimiert GUS mit Mengen, welche in allen untersuchten Linien unter Verwendung des histochemischen Färbeverfahrens von Jefferson nachweisbar sind, mit der Ausnahme von Samen (aber nur, wenn die transgene Pflanze als ein Pollendonor verwendet wird) und Pollen. In den Wurze dieser transgenen Pflanzen wird an allen Knoten GUS exprimiert. GUS wird über die gesamte Länge der Wurzeln exprimiert mit der Ausnahme, dass zumindest in einigen Wurzeln die Expression am distalen Ende der Wurzel dramatisch abfällt. Der Verlust der färbbaren Aktivität in den Wurzelenden rührt nicht von technischen Beschränkungen des Protokolls, da Wurzeln bei Transformationsereignissen Transgene, welche von anderen Promotoren gesteuert werden, in diesen Regionen in hohem Maße exprimieren. Die Stiele färben sich hinsichtlich der GUS-Aktivität nicht einheitlich, wobei das Mark eine schlechte oder keine Färbung aufweist, die Knoten und die benachbarten Bereiche am äußeren Ende des Stiels färben sich. Die meisten der sich färbenden Bereiche entsprechen Regionen, welche reich sind an vaskulärem Gewebe. In den Halmen, der Hülle und der Mittelrippe der Blätter wird GUS exprimiert. Körner zeigen bei einer Inkubation über Nacht in histochemischer GUS-Färbelösung keine färbbare Aktivität, wenn die Kerne von Kreuzungen stammen, worin die per5adh/GUS/nos-Pflanzen als Pollendonor verwendet wurden. Wenn jedoch die transgene Pflanze als mütterlicher Elternteil in der Kreuzung verwendet wird, wird GUS im Pericarp (Samenhülle) ebenso wie in einem bestimmten Bereich des Embryos exprimiert.

Die Expressionsmuster der Maispflanzen, welche mit pDAB419 transformiert wurden, waren ähnlich wie die Expressionsmuster, welche in transgenem Reis beobachtet wurden. Die Kombination per5-Promotor/adhl-Intron scheint ein Expressionsmuster zu fördern, welches konstitutiv ist. Das bedeutet, dass eine signifikante Expression sowohl in Wurzeln als auch Blättern beobachtet wird. Dies ist unerwartet, da das per5-Gen natürlicherweise bevorzugt in der Wurzel expnmiert wird. Dieses Ergebnis stimmt mit dem Expressionsmuster überein, welches bei Reis beobachtet wurde.

Beispiel 11 PerGUS16

PerGUS16 ist ein Plasmid mit 4 kb des per5-Promotors, der per5-nicht translatierten Leadersequenz, der codierenden Sequenz für die ersten fünf Aminosäuren von per5, dem GUS-Gen und der nos-3'UTR. Die vollständige Sequenz von PerGUS16 ist in SEQ ID NO:15 angegeben. Unter Bezug auf SEQ ID NO:15 sind signifikante Merkmale von PerGUS16 in Tabelle 11 angegeben.

PerGUS16 unterscheidet sich vom pDAB411 dann, dass PerGUS16 die codierende Sequenz für die ersten fünf Aminosäuren des per5-Proteins enthält. Außerdem enthält PerGUS16 4 kB stromaufwärts der Promotorsequenz, wohingegen pDAB411 nur 2 kB der Sequenz enthält. Weder PerGUS16 noch pDAB411 enthalten ein Intron im nicht translatierten Leader. PerGUS16 wurde wie folgt konstruiert und in einem transienten Maiswurzelexpressionsassay untersucht.

A. Konstruktion von PerGUS16.

Ein 4,0 kB NcoI-Fragment, welches 4 kB der stromaufwärts liegenden per5-Sequenz, die per5-nicht translatierte Leadersequenz und die codierende Sequenz für die ersten fünf Aminosäuren von per5 von perGEN1 (10,4) enthält, wurde aus einem 1 %-igen Agarosegel unter Verwendung eines Qiagen-Kits gereinigt. Dieses 4,0 kB-Promotorfragment wurde in eine NcoI-Stelle an die Translationsinitiationsstartstelle des GUS-Gens in pGUSnos12 ligiert. pGUSnos12 ist ein Plasmid, basierend auf Bluescript® II SK- mit einem insertierten BamHI-HindIII-Fragment, welches die codierende Region des GUS-Gens und die nos-3'UTR enthält. Die resultierende Translationsfusion ist PerGUS16.

B. Expressionsassay.

Ergebnisse der Untersuchung von PerGUS16 in einem transienten Maiswurzelexpressionsassay sind in Tabelle 14 angegeben.

Beispiel 12 PERGUSPER3

PERGUSPER3 ist ein Plasmid mit 4 kB des per5-Promotors, der per5-nicht translatierten Leadersequenz, der codierenden Sequenz für die ersten fünf Aminosäuren von per5, dem GUS-Gen und der per5-3'UTR. Die vollständige Sequenz von PERGUSPER3 ist in SEQ ID NO:16 angegeben. Unter Bezug auf SEQ ID NO:16 sind die entscheidenden Merkmale von PERGUSPER3 wie folgt:

PERGUSPER3 ist identisch mit PerGUS16, außer bezüglich der 3'UTR. PerGUS16 besitzt die nos- und PERGUSPER3 besitzt die per5-3'UTR. Weder PERGUSPER3 noch PerGUS16 besitzen ein Intron im nicht translatierten Leader. PERGUSPER3 wurde wie folgt konstruiert und in einem transienten Maiswurzelassay, in stabil transformiertem Reiskallus und in stabil transformierten Reispflanzen untersucht.

A. Konstruktion von PERGUSPER3 1. BSGUSper4.

Die 3'UTR des per5-Gens wurde auf einem 396 bp-Fragment (entspricht Basenpaar 6069-6439 von SEQ ID NO:1 plus 26 Basen einer künstlichen Linkersequenz) aus dem Plasmid perGEN1 (10,4) unter Verwendung von Amplitaq-Polymerase mit den gelieferten Puffern und den künstlichen Primern TTATCTCGAGGGCACTGAAGTCGCTTGATGTGCTGAATT (SEQ ID NO:17) und GGGGAAGCTTCTCTAGATTTGGATATATGCCGTGAACAATTG (SEQ ID No 18) amplifiziert. Der 5'-Primer fügte eine XhoI-Restriktionsstelle an und der 3'-Primer enthielt eine HindIII-Stelle, um die Klonierung zu erleichtern. Dieses Fragment enthält ein anerkanntes AAUAAA-poly-A-Additionssignal an Position 247 (entspricht Basenpaar 6306 von SEQ ID NO:1). Das Amplifikationsprodukt wurde in XhoI/HindIII des Plasmids pDAB356/X ligiert und in DHS&agr; transformiert [Anmerkung: Die Struktur des Plasmids pDAB356/X ist für das Endergebnis dieser Konstruktionsreihe nicht direkt relevant. Es wurde während einer nicht damit zusammenhängenden Reihe konstruiert und wurde ausgewählt, weil es Restriktionserkennungsstellen für XhoI und HindIII am 3'-Ende der GUS codierenden Region enthält. Ein Fachmann erkennt, dass andere Plasmide an dieser Stelle mit entsprechenden Ergebnissen eingesetzt werden können.] Ampicillin-resistente Transformanten wurden durch Koloniehybridisierung unter Verwendung des per5-3'UTR-Amplifikationsprodukts als Sonde gescreent.

Drei der resultierenden Transformanten hybridisierten mit dem 32Pradiomarkierten 3'UTR-Amplifikationsprodukt. Das Plasmid aus jeder dieser drei Transformanten wurde für eine Sequenzanalyse extrahiert. Eine Sequenzanalyse unter Verwendung eines automatisierten Sequenzierapparats von Applied Biosystems ergab, dass ein mit p3'per26 bezeichneter Klon keine durch die PCR eingebrachten Fehler enthielt. Ein 2,0 kB BamHI/HindIII-Fragment von p3'per26 mit der GUS-per5-3'UTR wurde wie oben beschrieben gelgereinigt und in die BamHI/HindIII-Klonierungsstelle von Bluescript® II SKligiert. Eines der resultierenden Plasmide, mit BSGUSper4 bezeichnet, wurde charakterisiert und für eine Subklonierung ausgewählt.

2. PERGUSPER3

Das 4,0 kB NcoI-per5-Promotorfragment von perGEN1 (10,4), oben beschrieben, wurde in die NcoI-Stelle von BSGUSper4 ligiert (die Translationsinitiation des GUS-Gens). Der resultierende Klon PERGUSPER3 enthält 4 kB des per5-Promotors, die per5-nicht translatierte Leadersequenz, die ersten fünf Aminosäuren von per5, das GUS-Gen und die per5-3'UTR.

B. Expressionsassays.

Ergebnisse der Untersuchung von PERGUSPER3 in einem transienten Maiswurzelassay sind in Tabelle 14 angegeben. Die Ergebnisse der Untersuchung von PERGUSPER3 in stabil transformiertem Reiskallus und bei Reispflanzen sind in Tabelle 15 angegeben.

Beispiel 13 5'-Deletionen von PERGUSPER3

Eine Reihe von 5'-Deletionen von PERGUSPER3 wurde gesammelt, um die Wirkung auf die Expression zu untersuchen. Bei der Konstruktion dieser Vektoren wurden natürlich vorkommende Restriktionsstellen in der 4,0 kB NcoI-Promotorregion verwendet.

A. Konstruktion von SPGP1

SPGP1 ist identisch mit PERGUSPER3, außer dass 2 kB der 5'-stromaufwärts liegenden Sequenz fehlen (d.h. Basenpaar 25-2585 von SEQ ID NO:16 sind deletiert). SPGP1 wurde erhalten von PERGUSPER3 durch Subklonierung des XbaI-Fragments von PERGUSPER3 in die XbaI-Stelle von Bluescript® II SK'.

B. Konstruktion von HSPGP4.

HSPGP4 ist identisch mit SPGP1, außer dass 1 kB der 5'-stromaufwärts liegenden Sequenz fehlt (d.h. Basenpaar 25-3240 von SEQ ID NO:16 sind deletiert). Dieser Vektor wurde von SPSP1 durch Deletion des 1 kB HindIII-Fragments abgeleitet.

C. Konstruktion von PSPGP1

PSPGP1 ist identisch mit SPGP1, außer dass 1,9 kB der PstI-Sequenz fehlen (d.h. Basenpaar 25-4139 von SEQ ID NO:16 sind deletiert). PSPGP1 besaß nur 109 Basen der 5'-Sequenz, welche die TATA-Box enthält.

D. Expressionsassay.

Die Ergebnisse der Untersuchung von SPGP1, HSPGP4 und PSPGP1 in einem transienten Maiswurzelexpressionsassay sind in Tabelle 14 angegeben.

Beispiel 14 Transienter Wurzelexpressionsassay

Transiente Assays sind erfolgreich für die Untersuchung der Genexpression in Pflanzen verwendet worden, insbesondere wenn ein effizientes System für eine stabile Transformation nicht verfügbar ist (d.h. bei Mais, Weizen). In Protoblasten sind diese Assays verwendet worden, um die Expression von regulatorischen Elementen mit relativ einfachen Expressionsmustern zu untersuchen. Beispielsweise sind konstitutive Promotoren, einschließlich dem CaMV 35S-Promotor, in Maisprotoblasten intensiv untersucht worden. Luehrsen und Walbot (1991). Es wurde jedoch angenommen, dass ein Wurzel-bevorzugender Promotor wie etwa per5 in Protoblasten wahrscheinlich nicht normal funktioniert, insbesondere in Protoblasten, welche von einer Gewebekultur stammen. Deshalb war ein System zur Untersuchung der Expression in intaktem Wurzelgewebe wünschenswert. Der Partikelbeschuss von Wurzelgewebe ermöglicht eine transiente Expressionsanalyse und verringert den Bedarf für die Produktion von stabilen transgenen Pflanzen.

A. Heliumbeschuss in Wurzeln

Mit CaptanTM behandelte Samen von CQ806 und OQ403 wurden für 45 min eingeweicht, 3x in sterilem destillierten Wasser gespült und in sterilen Petrischalen (100x25 mm) mit Whatman #1-Filterpapier, welches mit sterilem Milli-Q-Wasser befeuchtet wurde, für etwa 4-7 Tage gekeimt. Wurzelspitzen mit ungefähr 1 cm Größe wurden ausgeschnitten und (6 pro Ziel) in "Beschuss"-Medium (#4 mit 2% Agar) angeordnet. Das "Beschuss"-Medium bestand aus N6-Basissalzen und Vitaminen (Chu, 1978), Fe-EDTA, 20 g/l Saccharose, 690 mg/l L-Prolin, 100 mg/l enzymatisches Caseinhydrolysat (ECH), 1 mg/l 2,4-Dichlorphenoxyessigsäure (2,4-D) und 20 g/l Agar. Die Wurzeln wurden mit einer 204 &mgr;m-Scheibe vor dem Beschuss bedeckt. Jedes Ziel wurde unter Verwendung einer zweifachen Verdünnung der Gold/DNA-Lösung einmal mit 1500-2000 psi beschossen. Die Goldpartikel (Biorad 1,0 &mgr;m) wurden mit DNA beschichtet (unterschiedliche Plasmide, wie im Text beschrieben), wie es in Beispiel 10B beschrieben wird. Es wurden unterschiedliche Beschussparameter untersucht, d.h. 1) unterschiedliche Heliumdrücke (500, 1000, 1500 und 2000 psi), 2) Zahl der Beschüsse pro Ziel (1-4 Beschüsse pro Ziel), 3) Konzentration von Gold/DNA (1-4-fache Verdünnungen der Gold/DNA-Lösung), 4) Partikelgröße (Aldrich 1,5-3,0 &mgr;m gegenüber Biorad 1,0 &mgr;m Goldpartikel) und 5) Hochosmosebehandlung (0,2 M Mannit und 0,2 M Sorbitbehandlung 4 h vor und 16-18 h nach dem Beschuss). Nach dem Beschuss wurden die Wurzeln auf 15Ag10-2D-Medium übertragen und im Dunkeln bei 27°C inkubiert. Das 15Ag10-2D-Medium unterschied sich vom #4-Medium darin, dass es 2,9 g/l L-Prolin, 10 mg/l Silbernitrat, 2 mg/l 2,4-D und 2,5 g/l Gelrite enthielt.

B. Histochemischer GUS-Assay

Nach 18-24 h wurden die beschossenen Wurzeln im Hinblick auf die GUS-Expression gemäß Jefferson (1987) untersucht. Die Wurzeln wurden in 24-Well-Mikrotiterplatten (Coming, New York, NY) mit 500 &mgr;l Assaypuffer pro Well angeordnet (6 pro Well). Der Assaypuffer bestand aus 0,1 M Natriumphosphat (pH 8,0), 0,5 mM Kaliumferricyanid, 0,5 mM Kaliumferrocyanid, 10 M Natrium-EDTA, 1,9 mM 5-Brom-4-chlor-3-indolyl-beta-D-glucuronid und 0,06% Triton X-100. Die Platten wurden im Dunkeln für 1-2 Tage bei 37°C inkubiert, ehe die GUS-Expression unter einem Mikroskop beobachtet wurde.

C. Optimierung der DNA-Zuführung in Wurzeln

Die transiente Expression stieg mit steigendem Heliumdruck, wobei die größten Mengen bei 1500-2000 psi beobachtet wurden. Eine Hochosmosebehandlung vor dem Beschuss verstärkte die GUS-Expression nicht. Ebenso ergab eine Steigerung der Zahl der Beschüsse pro Ziel keine erhöhte Expression. Ein Beschuss pro Ziel ergab die höchste Expression in Wurzeln, sowohl bei OQ403 als auch bei CQ806. Außerdem wurde gefunden, dass eine zweifache Verdünnung der Gold/DNA-Lösung und die Verwendung der Biorad-1,0 &mgr;m-Partikel am geeignetsten war, um einheitliche hohe Expressionmengen zu erhalten. Auf Basis dieser Ergebnisse wurde eine Reihe von Bedingungen für den Beschuss in Wurzeln etabliert. Unter diesen Bedingungen exprimierten 60-100% der beschossenen Wurzeln unter Verwendung von pDAB418 (Ub1-GUS-nos) GUS mit einer durchschnittlichen Zahl von etwa 50 GUS-Expressionseinheiten pro Ziel.

D. Transiente Expression von unterschiedlichen per5-Konstrukten in Wurzeln

Die transiente GUS-Expression von unterschiedlichen per5-Konstrukten in Wurzeln wurde nach Heliumbeschuss unter Verwendung der oben beschriebenen Bedingungen untersucht. Die Ergebnisse von 10 unterschiedlichen Experimenten sind in Tabelle 14 zusammengefasst.

  • * GUS-Expressionseinheiten (Zahl der beobachteten blauen Spots) pro Ziel
  • N= # der beschossenen Ziele

pDAB411, das Konstrukt mit 2,0 kB per5, exprimierte mit sehr niedrigen Mengen. Mit PerGUS16, welches 4,0 kB per5 und eine Fusion einschließlich der fünf ersten Aminosäuren des per5-Proteins enthält, war die Expression dreimal höher als die Expression bei pDAB411. Ferner zeigte PERGUSPER3, welches aus per5 mit der 3'UTR besteht, eine weitere dreifache Steigerung gegenüber PerGUS16, was zeigt, dass das 3'-Ende für die Regulation der Expression auch wichtig ist. Obwohl SPGP1 2,0 kB von per5 enthielt, wurde zwischen der Expression von SPGP1 und PERGUSPER3 kein Unterschied beobachtet. Mit einer weiteren Deletion in der 5'-Region von per5 in HSPGP (welches 1,0 kB von per5 enthält) war die Expression gegenüber der Expression von SPGP1 und PERGUSPER3 verrigert. Jedoch wurden mit PSPGP, welches nur 0,1 kB der Region von per5 enthält, relativ geringe Expressionsmengen beobachtet.

Wahrscheinlich liegen alle Promotorelemente, welche für eine maximale wurzelspezifische Expression benötigt werden, in den ersten 1 kB der 5'-Sequenz vor. Jedoch müssen Elemente, welche die Expression in anderen Geweben unterdrücken, nicht unbedingt in dieser 1 kB-Sequenz enthalten sein.

Ähnliche Beobachtungen sind gemacht worden mit den stromaufwärts liegenden 5'-Sequenzen des Sus4-Gens aus der Kartoffel, welche ein negatives Element enthalten, welches die Expression in Stielen und Blättern hemmt. Fu et al. (1995). Transiente Assays in anderen Geweben wären notwendig, um diese Information hinsichtlich der per5-Konstrukte zu erhalten. Die Expression von PSPGP, welches nur 100 Basen der 5'-Sequenz enthielt, wirkt wahrscheinlich als ein Basispromotor und es wird deshalb nicht erwartet, dass es die notwendigen Elmente für eine wurzelspezifische Expression oder die Enhancerelemente enthält, welche für eine maximale Aktivität des Promotors notwendig sind. Es wird erwartet, dass die Expression dieses Konstrukts in stabilen Pflanzen konstitutiv ist.

Eine Translationsfusion des per5-Gens, welches den per5-5'-nicht translatierten Leader (UTL) und die ersten 5 Aminosäuren des per5-Gens enthält, fusioniert mit uidA, wurde in die Konstrukte PerGUS16, PERGUSPER3, SPGP1, HSPGP und PSPGP eingebracht. Die Fähigkeit dieser Konstrukte zur GUS-Expression zeigte, dass diese UTL-Sequenz die Translation fördern kann und deshalb verwendet werden kann, um kommerziell wichtige Transgene zu exprimieren.

Die deutlichste Verbesserung der Expression wurde beobachtet durch das Zufügen der per5-3'UTR anstelle der nos-Sequenz. Die 3'UTRs enthalten bekanntermaßen Sequenzen, welche die Genexpression durch eine Veränderung der Stabilität der Messenger-RNA (Sullivan und Green (1993)) oder durch Beeinflussung der Translation (Jackson und Standart (1990)) beeinflussen. Beispiele umfassen die Polyadenylierungssignale (Rothnie et al. (1994)) und destabilisierende Elemente (Gallie et al. (1989)). Jedoch können die per5- und nos-3'UTRs durch Vorhandensein oder Abwesenheit dieser Sequenzen nicht unterschieden werden. Beide UTRs enthalten ein anerkanntes AAUAAA-poly-A-Additionssignal. Keine Sequenz scheint eines der publizierten destabilisierenden Elemente zu enthalten. Ein offensichtlicher Unterschied zwischen den zwei UTRs ist die Länge, die längere per5-UTR kann der Messenger-RNA eine größere Stabilität verleihen.

Beispiel 15 Transformation von PERGUSPER3 in Reis Transgene Produktion und histochemischer GUS-Assay

Um die Expression von PERGUSPER3 in transgenem Reis zu untersuchen, wurden insgesamt 35 unabhängige transgene Linien erzeugt. Von diesen zeigten Pflanzen von neun Linien (354/PERGUSPER3-03, 20, 21, 23, 24, 27, 28, 30 und 34) eine GUS-Expression in Wurzeln. Obwohl die GUS-Expression von Linie zu Linie variierte, zeigten wenige Linien eine sehr intensive Expression in Wurzeln. Eine histochemische GUS-Analyse von unterschiedlichen Geweben nach Vakuuminfiltration zeigte eine GUS-Expression in geschnittenen Teilen von Blättern, „Glumes", Antheren, Pollen und im Embryo. Im Endosperm war keine Expression zu sehen. Alle diese Ergebnisse deuten darauf hin, dass per5 im Reis auf konstitutive Art und Weise exprimiert.

Reispflanzen von 6 PERGUSPER3-R0-Linien wurden durch Southern Analyse charakterisiert. Die Reis-DNA wurde auch mit dem Restriktionsenzym XbaI geschnitten, was bei Hybridisierung mit der GUS-Sonde ein Fragment mit 4,2 kB ergeben sollte. Alle der 6 Linien enthielten das Genkonstrukt. In einer der 6 Linien wurde ein mäßig komplexes Integrationsereignis nachgewiesen, enthaltend eine intakte Kopie des Genkonstrukts. Die restlichen 5 Linien wiesen alle komplexe Integrationsereignisse mit bis zu 9 Hybridisierungsprodukten auf. Eine Zusammenfassung der Genanalyse ist in Tabelle 15 angeordnet.

Sowohl Längsschnitte als auch Querschnitte der Wurzel, präpariert von transgenen Reiskeimlingen, zeigten Zellen mit GUS-Expression (blaue Farbe) und Zellen, bei welchen ein Fehlen der GUS-Expression interpretiert wurde (rote Farbe, resultierend aus der Gegenfärbung). Ein Längsschnitt einer Primärwurzel zeigte in allen Fällen eine GUS-Expression, außer bei den Zellen, welche in der Wurzelkappe, der Meristemzone und einem Teil der Zellverlängerungszone vorliegen. Dieses Expressionsmuster wurde für die sekundäre Wurzelbildung in einem Querschnitt des Wurzelgewebes bestätigt. Ein Querschnitt einer Primärwurzel, präpariert aus einem Teil innerhalb der Zone der Zellverlängerung und Differenzierung zeigte die meisten GUSexprimierenden Zellen. Eine sehr intensive GUS-Expression (dunkelblau) wurde in der Exodermis oder im äußeren Cortex der Wurzelprobe beobachtet. In der Epidermisschicht wurde die GUS-Expression als leicht bis fehlend eingeordnet, obwohl makroskopisch beobachtet wurde, dass Wurzelhaare blau sind. Sowohl vaskuläre als auch kortikale Gewebe zeigten eine mäßige Expression. Auf Basis des übereinstimmenden Färbemusters, welches von Freihand-Gewebeschnitten erhalten wurde, exprimierten die Zellen der vaskulären und kortikalen Gewebe das GUS-Protein vielmehr auf echte Art und Weise, als dass Artefakte durch die Diffusion der histochemischen Färbung aus der Exodermis auftrat.

Eine Analyse der Varianz zeigte, dass die Variation von Probe zu Probe innerhalb jedes der einzelnen Ereignisse nicht signifikant war. Jedoch war der größte Teil der Variation zwischen den unterschiedlichen Ereignissen assoziiert. Bezogen auf quantitative GUS-Daten wurde gezeigt, dass nur das Ereignis 354/PERGUSPER3-20 einen höchst signifikanten Unterschied (p<0,001) zu 0 aufweist (Tabelle 15), auch wenn fünf andere Ergebnisse histochemisch GUS-positiv waren.

Die Mais-per5-5'-Region in Kombination mit den 3'-nicht translatierten Sequenzen förderte ein hohes Expressionsniveau des eingebrachten &bgr;-Glucuronidasegens in jungen transgenen Reispflanzen. Sowohl in Wurzeln als auch Blättern wurde eine funktionelle Aktivität beobachtet. Quantitative Daten zeigten, dass eine beträchtliche Variabilität der Expression zwischen den unterschiedlichen Ereignissen vorlag. Diese Variabilität ist höchstwahrscheinlich ein Ergebnis einer Kombination von Faktoren, einschließlich positiver Effekte des integrierten Transgens, Unterschiede in der Kopienzahl der Insertionsprodukte und Umordnungen der Insertionsereignisse. Alle diese Variablen besitzen die Möglichkeit, die Expressionsmengen zu beeinflussen und sind in den meisten transgenen Untersuchungen dokumentiert worden.

Trotz des hohen Ausmaßes der Variabilität in den Expressionsmengen stimmte das Expressionsmuster von PERGUSPER3 in unterschiedlichen Transformationsereignissen überein. Eine leichte bis sehr intensive Expression war in den gesamten primären und sekundären Wurzeln mit Ausnahme der Wurzelspitzen deutlich sichtbar. Eine histologische Analyse zeigte eine sehr intensive Expression im äußeren Cortex und eine mäßige Expression im Cortex und vaskulären Geweben. Solch ein beobachtetes Muster und Ausmaß der Expression scheint für eine Expression von Genen zur Bekämpfung von Wurzelschädlingen (d.h. Wurzelkäfer) sehr geeignet zu sein. In Übereinstimmung mit der Expression in Wurzeln wurden außerdem hohe Expressionsmengen in Stiel und Blattgewebe beobachtet (quantiative Daten), was eine Möglichkeit zur Kontrolle bzw. Bekämpfung von anderen Insekten (d.h. Stengelbohrer) ermöglicht. Diese Daten zeigen, dass der per5-Promotor ohne Intron eine konstitutive Expression von Transgenen in Reis bewirkt.

Beispiel 16 Maistransformation von PERGUSPER3

Die Etablierung von Typ II-Kalluszielen und die Heliumbeschussbedingungen waren die gleichen wie in Beispiel 10 beschrieben. Insgesamt 82 unabhängige transgene Kolonien von Mais wurden erzeugt. Von diesen wurden 55 Linien einer Southernanalyse wie in Beispiel 15 beschrieben unterzogen. 29 Linien waren Southem-positiv und enthielten ein intaktes Hybridisierungsprodukt des GUS-Gens. Nach dem histochemischen GUS-Assay zeigte der Kallus von etwa 72 Linien keine Expression. Auch Wurzeln und Blätter von unterschiedlichen Southern-positiven Linien zeigten keine GUS-Expression, wenn Kallus auf dem "Regenerations"-Medium regeneriert wurde. Diese Daten unterstützen die Beobachtung, dass andere Sequenzen als die 5'-Promotorregion und die 3'-UTR für eine Expression in Mais entscheidend sind.

Beispiel 17 Plasmid PIGP/367

Das Plasmid PIGP/367 enthält den per5-Promotor, den per5-nicht translatierten Leader, modifiziert durch Einschluss des per5-Intron 1, das GUS-Gen und die per5-3'UTR. Die vollständige Sequenz von PIGP/367 ist in SEQ ID NO:19 angegeben. Unter Bezug auf SEQ ID NO:19 sind die entscheidenden Merkmale von PIGP/367 in Tabelle 16 angegeben.

Da gezeigt worden ist, dass Intron-flankierende Sequenzen (Exon-DNA) beim Processing des Introns wichtig sind (Luehrsen und Walbot (1991)), wurden 16 Basen der flankierenden Exon-DNA in die Fusion innerhalb des per5-nicht translatierten Leaders eingebracht.

Konstruktion von PIGP/367.

Der Promotor des per5-Gens wurde unter Verwendung des Vorwärtsprimers GGGGGATCCTCTAGACAATGATATACATAGATAAAAACC (SEQ ID NO:20), welcher eine BamHI (GGATCC)-Stelle in 5'-Position des Promotors zum Erleichtern der Klonierung enthält, amplifiziert. Der reverse Primer innerhalb des nicht translatierten Leaders des per5-Gens war GGGAGATCTCCTTCGCTGTACTATGTTATAAGAGAAGAG (SEQ ID NO:21) und brachte eine BgllI (AGATCT)-Restriktionsstelle an 3'-Position ein. Mit dem Promotor homologe Sequenzen sind unterstrichen. Die Primer wurden auf einem 394 DNA/RNA Synthesizer (Applied Biosystems, Foster City, CA) synthetisiert. Die Amplifikationsreaktionen wurden mit dem ExpandTM Long Template PCR System (Boehringer Mannheim, Indianapolis, IN) durchgeführt. Das Plasmid perGEN 10,44, welches 10,1 kB des Maisperoxidasegens und nicht translatierte und nicht transkribierte Sequenzen enthält, wurde als Templat-DNA verwendet. Die Amplifikationszyklen wurden mit einer Annealingtemperatur von 56°C durchgeführt. Die Amplifikationsprodukte wurden aufgetrennt und durch eine Elektrophorese auf einem 1 %-Agarosegel sichtbar gemacht. Resultierende Amplifikationsprodukte wurden aus der Agarose herausgeschnitten und die DNA wurde unter Verwendung von Qiaex II (Qiagen, Hilden, Deutschland) gereinigt. Die Produkte wurden in PCR 2,1 ligiert unter Verwendung des originalen TA Cloning Kit (Invitogen Corporation, San Diego, CA). Rekombinante Plasmide wurden auf Luria-Agar (Gibco, Bethesda, MD) mit 75 mg/l Ampicillin (Sigma, St. Louis, MO) und 40 mg/Platte einer 40 mg/ml Stammlösung von X-gal (Boehringer Mannheim, Indianapolis, IN) selektiert. Die Plasmid-DNAs wurden gereinigt unter Verwendung des WizardTM plus Miniprep DNA Purification System (Promega, Madison, WI). Die DNA wurde analysiert und mit Restriktionsendonucleasen und T4-DNA-Ligase von Bethesda Research Laboratories (Bethesda, MD) subkloniert. Der resultierende per5-Promotorklon wurde p121-20 genannt.

Intron 1 und 25 Basen der flankierenden Exon-DNA des per5-Gens wurden amplifiziert unter Verwendung des Vorwärtsprimers GGGGGATCCTGACTGCTTTGTCAAGGTTCAATTCTGCTT (SEQ ID NO22), welcher eine BamHI (GGATCC)-Stelle an 5'-Position der Exon/Intron-DNA einfügte, und dem reversen Primer GGGCCATGGATCGCAGCCCTACACATGTAACAGTGTTGT (SEQ ID NO23), welcher eine NcoI (CCATGG)-Stelle an 3'-Position einfügte, um eine Fusion am ATG-Startcodon des GUS-Gens zu erleichtern. Sequenzen homolog zur per5-Sequenz sind unterstrichen. Die Amplifikation und Klonierung wurden wie oben beschrieben durchgeführt, wobei der resultierende Intronklon p122-2 genannt wurde. Das Intron wurde dann von p122-2 aus dem BamHI/NcoI-Fragment ausgeschnitten und an 5'-Position des GUS-Gens/der per5-3'-nicht translatierten Region in BSGUSper4 eingebracht. Die Ligationen wurden in DH5&agr; (Laboratory, Bethesda, MD) transformiert und DNA wurde wie oben beschrieben extrahiert. Die Sequenz über die Verbindung wurde unter Verwendung des Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Foster City, CA) und einem 373A DNA-Sequenzer (Applied Biosystems, Foster City, CA) verifiziert. Eine Computeranalyse der Sequenzen wurde durch den SequencherTM 3.0 (Gene Codes Corporation, Ann Arbor, MI) erleichtert. Das Zwischenprodukt p128-1 wurde dann mit BamHI verdaut und mit dem gereinigten Promotor BgllI/BamHI-Fragment von p121-20 ligiert. Um ein Endkonstrukt mit dem selektierbaren Markergen für eine BastaTM-Resistenz zu erzeugen, wurden per5-Promotor/per5-Intron/GUS-Gen/per5-3'UTR aus PIPG147-2 auf einem Pvu/Notl-Fragment ausgeschnitten und in eine Pmel/Notl-Stelle von pDAB367 eingebracht. PDAB367, welches das Gen für die BastaTM-Resistenz enthält, wird in Beispiel 27 beschrieben. Das Endkonstrukt wurde als pPIGP/367 bezeichnet.

Beispiel 18 Transformation von Mais mit pPIGP/367 A. Etablierung von Typ II-Kalluszielen.

Die verwendeten Materialen und Methoden waren die gleichen wie in Beispiel 10.

B. Heliumbeschuss und Selektion.

Die verwendeten Materialien und Methoden waren die gleichen wie in Beispiel 10. Es wurden 33 BastaTM-resistente Linien erhalten welche mit pPIGP-01 bis pPIGP-33 bezeichnet wurden.

C. Regeneration von Pflanzen

Die verwendeten Materialien und Methoden waren die gleichen wie in Beispiel B. Die Pflänzchen wurden von 5 der transgenen PIGP/367-Linien regeneriert (PIGP/367-01, PIGP/367-06, PIGP/367-19, PIGP/367-32 und PIGP/367-33).

D. Histochemische GUS-Färbung.

Gewebe von Pflänzchen von pPIGP-01 wurden wie in Beispiel 10 beschrieben histochemisch bewertet. Die Pflänzchen zeigten in den Wurzeln eine gute GUS-Expression, mit Ausnahme der Wurzelkappe, wo keine Expression beobachtet wurde. In den Blättern dieser jungen Pflanzen wurde keine Expression beobachtet.

F. Proteinextraktion und Messung von GUS.

Blatt- und Wurzelgewebe wurde gesammelt und bei vier der transgenen PIGP/367-Linien (PIGP/367-06, PIGP/367-19, PIGP/367-32 und PIGP/367-33), welche eine positive histochemische GUS-Expression zeigten, wurde die Analyse der GUS-Expression vervollständigt. Eine nicht transformierte Pflanze im gleichen Entwicklungsstadium, CS405, diente als Negativkontrolle. Das sechste Blatt und gereinigte Wurzeln (die Wurzeln wurden unter fließendem kaltem Leitungswasser gesäubert und mit destilliertem Wasser gespült) wurden von 4-5 R0-Pflanzen innerhalb der transgenen Linien gesammelt. Die Proben wurden entweder bei -70°C gelagert oder unter Verwendung von flüssigem Stickstoff pulverisiert. 50 ml-Röhrchen, gekühlt auf Trockeneis, wurden bis zur 10 ml-Marke mit den pulverisierten Proben gefüllt. Das Protein wurde von jeder Probe im Duplikat extrahiert. 4 Volumina/Gewicht Extraktionspuffer (der Extraktionspuffer ist 1 % Polyvinylpyrrolidon (hydratisiert in der Lösung für mindestens 1 h), 20% Glycerol, 0,7 &mgr;l/ml &bgr;-Mercaptoethanol, 50 mM NaPO, pH 7,0, 10 mM EDTA, 0,1% Triton X-100, 0,1% Sarcosyl, 10 mM &bgr;-Mercaptoethanol) wurden zu jeder Probe zugegeben. Die Proben wurden unter Verwendung eines Ultra-Turrax T 25 (IKA-Works INC, Staufen I. Br., Deutschland) gemahlen und auf Eis gelagert. Die Proben wurden für 5 min bei 3000 rpm bei 4°C zentrifugiert. 10 &mgr;l/ml Proteaseinhibitor (50 &mgr;g/ml Antipain, 50 &mgr;g/ml Leupeptin, 0,1 mM Chymostain, 5 mg/ml Pepstatin, 0,24 &mgr;g/m1 pefabloc (Boehringer Mannheim, Indianapolis, IN) wurde zu dem entnommenen Probenüberstand zugegeben. Die Proben wurden dann bei 4°C für 10 min bei 13000 rpm zentrifugiert. Die Überstände wurden abgenommen und bei -70°C gelagert. Die Proteinkonzentration wurde auf einem Spektrophotometer für UVsichtbares Licht (Shimadzu, Kyoto, Japan) gemessen. 5 &mgr;l der Probe wurde zu 2,5 ml Proteinfärbereagenz (Sigma Diagnostics, St. Louis, MO) und 100 &mgr;l sterilem Wasser zugegeben. Aus der Proteinstandardlösung (Sigma Diagnostics, St. Louis, MO) wurde ein Bereich von Standards hergestellt.

Die GUS-Aktivität wurde unter Verwendung eines GUS-LightTM Kits (Tropix Inc., Bedford, MA) in wiederholten Proben der Duplikatextraktionen gemessen. 5 &mgr;l-Proben des unverdünnten Extrakts oder des Extrakts, welcher so verdünnt war, dass die Lumineszenz in dem durch das Luminometer gemessenen Bereich lag, wurden zu 195 &mgr;l der GUSTM-Verdünnungslösung zugegeben. Nach 1 h Inkubation bei 28°C im Dunkeln wurde die Lumineszenz unter Verwendung eines Bio Orbit 1251-Luminometers, ausgerüstet mit einem Bio Orbit 1291-Injektor, nach der Injektion von 300 &mgr;l GUS-LightTM-Beschleuniger gemessen. Die Lumineszenz wurde nach einer Verzögerung von 5 sek für 5 sek integriert. Die verwendeten Standards waren Extraktionspuffer, nicht transformiertes Gewebe und GUS-LightTM Gus-Standard. Die Ergebnisse sind in Tabelle 17 zusammengefasst und zeigten hohe Expressionsmengen in den Wurzeln, aber geringe bis keine signifikante Expression in den Blättern.

G. Zusammenfassung der Expressionsergebnisse.

In den vorigen Beispielen hierin wurde in keinem Maisgewebe eine signifikante Expression beobachtet (obwohl diese in Reis vorlag), wenn das Intron stromaufwärts des per5-Promotors nicht vorhanden war. Wenn das AdhI-Intron mit dem Promotor fusioniert wurde (Beispiele 8, 10) wurde in Mais eine Expression beobachtet. Das AdhI-Intron 1 war nicht in der Lage, die Wurzelbevorzugende Expression in Mais wiederherzustellen, welche für das native per5-Gen charakteristisch ist. Eine Wurzel-bevorzugende Expression wurde nur erreicht, wenn der Promotor in Kombination mit dem per5-Intron platziert wurde. Dies ist die erste Demonstration dafür, dass ein Intron eine Gewebespezifität oder eine Gewebe-bevorzugende Expression in transgenen Pflanzen steuert. Xu et al. (1994) haben in vorausgehenden Untersuchungen von dem Promotor eines anderen Wurzel-bevorzugenden Gens berichtet, dem Triosephosphatisomerasegen von Reis. Sie fanden, dass in Reisprotoblasten für eine Expression durch diesen Promotor ein Intron erforderlich ist, aber die Wirkungen des Introns auf die Genexpression in reifen Geweben ist nicht beschrieben worden.

Der Mechanismus für die Verstärkung durch ein Intron wird nicht gut verstanden. Die Wirkung scheint vielmehr posttranskriptional zu sein (als promotorähnliche Effekte auf die Initiation der Transkription), da die Verstärkungen nur zu sehen sind, wenn das Intron in der Region der DNA vorliegt, welche transkribiert wird (Callis, 1987). Introns könnten bei der Stabilisierung der Prä-mRNA im Nukleus oder beim Steuern des nachfolgenden Processing (Luehrsen und Walbot, 1991) eine Rolle spielen. Die Wurzel-bevorzugende Expression der per5-Promotor-Intron-Kombination könnte durch das Erfordernis eines Introns für das Processing und durch eine beschränkte Gewebeverteilung eines anderen Faktors (von anderen Faktoren), welche für ein korrektes Processing notwendig sind, erklärt werden.

Beispiel 19 Plasmid p188-1

Das Plasmid p188-1 ist ein Klon der p5-3'UTR. Die per5-3'UTR wurde auf dem Plasmid Xba4 amplifiziert, welches das 4,1 kB-XbaI-Fragment von nt 2532 bis 6438 der SEQ ID NO:1 enthält, unter Verwendung des Vorwärtsprimers AAA GAG CTC TGA GGG CAC TGA AGT CGC TTG ATG TGC (SEQ ID NO:24), welcher eine SstI-Stelle am 5'-Ende einbrachte, und dem reversen Primer GGG GAA TTC TTG GAT ATA TGC CGT GAA CAA TTG TTA TGT TAC (SEQ ID NO:25), welcher am 3'-Ende eines 366 bp-Segments der per5-3'UTR eine EcoRI-Stelle einbrachte (entspricht nt 6066 bis 6431 der SEQ ID NO:1). Die Sequenzhomologien mit dem Promotor sind unterstrichen. Die Primer wurden auf einem 394 DNA/RNA Synthesizer (Applied Biosystems, Foster City, CA) synthetisiert. Die Amplifikationsreaktionen wurden durchgeführt mit dem ExpandTM Long Template PCR System (Boehringer Mannheim, Indianapolis, IN). Die Plasmid-Xba-Amplifikationszyklen wurden bei einer Annealingtemperatur von 56°C durchgeführt. Die Amplifikationsprodukte wurden aufgetrennt und auf einem 1 %-igen Agarosegel durch Elektrophorese sichtbar gemacht. Die resultierenden Amplifikationsprodukte wurden aus der Agarose ausgeschnitten und die DNA wurde unter Verwendung von Qiaex II (Qiagen, Hilden, Deutschland) gereinigt. Die Produkte wurde in pCR2.1 aus dem Original TA Cloning Kit (Invitrogen Corporation, San Diego, CA) ligiert.

Rekombinante Plasmide wurden auf Luria-Agar selektiert (Gibco, Bethesda, MD), welcher 75 mg/l Ampicillin (Sigma, St. Louis, MO) enthielt, und 40 mg/Platte einer 40 mg/ml X-gal-Stammlösung (Boehringer Mannheim, Indianapolis, IN). Die Plasmid-DNAs wurden gereinigt unter Verwendung des WizardTM plus Miniprep DNA Purification-Systems (Promega, Madison, WI). Die DNA wurde analysiert und mit Restriktionsendonucleasen und T4-DNA-Ligase von Bethesda Research Laboratories (Bethesda, MD) subkloniert. Der resultierende per5-3'UTR-Klon wurde p188-1 genannt.

Beispiel 20 pTGP190-1

Das Plasmid pTGP190-1 ist ein 5887 bp-Plasmid, welches eine Genkassette umfasst, worin die folgenden Bestandteile operativ verbunden sind: der 35T-Promotor, das GUS-Gen und die per5-3'UTR. Die vollständige Sequenz von pTGP190-1 ist in SEQ ID NO:26 angegeben. Unter Bezug auf SEQ ID NO:26 umfassen die wichtigen Merkmale von pTGP190-1:

Konstruktion von pTGP190-1.

Die per5-3'UTR wurde unter Verwendung der SstI/EcoRI-Stellen aus p188-1 ausgeschnitten (Beispiel 19) und wie oben beschrieben aus einem Agarosegel gereinigt. Dieses Fragment wurde mit dem SstI/EcoRI-A-Fragment von pDAB305 ligiert. (pDAB305 wird ausführlich in Beispiel 24 beschrieben). Das Plasmid pDAB305 ist ein 5800 bp-Plasmid, welches einen heterologen Promotor enthält, welcher als 35T bekannt ist. Die Konstruktion des 35T-Promotors ist ausführlich in Beispiel 24 beschrieben. Im Grunde enthält dieses Konstrukt zweifache Kopien des CaMV 35S-Promotors (35S), eine deletierte Version des AdhI-Intron 1, und den nicht translatierten Leader des Hüllproteins des MSV ("Maize Streak Mosaic Virus"), fusioniert mit dem &bgr;-Glucuronidasegen, welches dann von der nos-3'UTR gefolgt wird. Das SstI/EcoRI A-Fragment von pDAB305 deletiert die nos-3'UTR. Die Ligationen wurden in DH5&agr; (Bethesda Research Laboratory, Bethesda, MD) transformiert und DNA wurde wie oben beschrieben extrahiert. Die Sequenz über die Verbindung des Promotor/GUS wurde verifiziert unter Verwendung des Dye Terminator Cycle Sequencing Ready Reaction Kits (Perkin Eimer, Foster City, CA) und eines 373A DNA Sequencers (Applied Biosystems, Foster City, CA). Die Computeranalyse der Sequenzen wurde erleichtert durch den SequencherTM 3.0 (Gene Codes Corporation, Ann Arbor, Ml). Das Plasmid pTGP190-1 ist identisch mit pDAB305, außer dass die per5-3'UTR durch die nos-3'UTR ersetzt ist, gefolgt vom GUS-Gen.

Beispiel 21 UGP232-4

Das Plasmid UGP232-4 ist ähnlich wie pTGP190-1, enthält aber anstelle des 35T-Promotors den Ubiquitin 1 (ubi)-Promotor und das Intron 1 aus Mais. Der ubi-Promotor wurde auf einem HindIII/NcoI-Fragment aus pDAB1538 (in Beispiel 29 beschrieben) ausgeschnitten und mit dem HindIII/NcoI A-Fragment von pTGP190-1 ligiert, um UGP232-4 zu erhalten. Die vollständige Sequenz von UGP232-4 ist in SEQ ID NO:27 angegeben. Unter Bezug auf SEQ ID NO:27 sind die wichtigen Merkmale von UGP232-4 in Tabelle 19 angegeben.

  • PUGN81-3 wurde als Ubiquitin/GUS/nos-Kontrollplasmid verwendet.

Beispiel 22 Quantitative transiente Assays von Maiskallus, bombardiert mit pTGP191-1 oder UGP232-4 A. DNA-Präparation für transiente Untersuchung.

Jedes der Testkonstrukte wurde neben pDAB305 (in Beispiel 24 beschrieben) gemäß dem folgenden Protokoll mit pDeLux (in Beispiel 26 beschrieben) auf Goldpartikel copräzipitiert. Es wurden gleiche molare Mengen des GUS-Konstrukts verwendet. Insgesamt 140 &mgr;g DNA, 70 &mgr;g pDeLux plus 70 &mgr;g Test-DNA und Bluescript® II SK--DNA (falls nötig) wurden in sterilem Wasser auf ein Volumen von 300 &mgr;l verdünnt. Die DNA und das Wasser wurden zu 60 mg Oberflächen-sterilisierten kugelförmigen Goldpartikeln mit 1,0 &mgr;m (Bio-Rad Laboratories, Hercules, CA) zugegeben. Das Gemisch wurde kurz gemischt (ungefähr 15 sek), ehe 74 &mgr;l 2,5 M Calciumchlorid und 30 &mgr;l 0,1 M Spermidin (freie Base) zugegeben wurden. Nach dem Mischen für 30 sek ließ man die DNA und das Gold aus der Lösung präzipitieren. Der Überstand wurde entfernt und 1 ml Ethanol wurde zugegeben. Das DNA/Goldgemisch wurde vor der Verwendung für die Transformation 1:8 verdünnt.

B. Transiente Untersuchung in Maiskallus.

Regenerierbarer Maiskallus (Typ II) wurde auf osmotischem Medium (N6-Salze und Vitamine (Chu (1978)), 1 mg/l 2,4-Dichlorphenoxyessigsäure, 0,2 M Sorbit, 0,2 M Mannit, 7 g/l Gelrite, pH 5,8) für ungefähr 16 h vorbehandelt. Danach wurde er auf 60 × 20 mm-Platten mit osmotischem Medium, verfestigt mit 2% Agar für den Heliumbeschuss angeordnet. Käfige mit 104 &mgr;m Maschengitter bedeckten jedes „Ziel" (500-600 mg Kallus), um Spritzen und Verlust von Gewebe zu verhindern. Die Ziele wurden individuell mit einem DNA/Goldgemisch beschossen unter Verwendung des in Beispiel 10 beschriebenen Heliumbeschussapparats. Unter einem Vakuum von 650 mg Hg, mit einer Schussdistanz von 10 cm und einem Druck von 1500 psi wurde das DNA/Goldgemisch 4x in Richtung jedes Gewebes beschleunigt, wobei 20 &mgr;l pro Schuss geliefert wurden. Die Ziele wurden nach jedem Beschuss um 180°C gedreht. Das Gewebe wurde ebenso auf halbem Wege während des Beschussverfahrens gemischt, um nicht beschossenen Kallus zu exprimieren. Nach Beendigung des Beschusses wurden die Ziele erneut für die Übernachtinkubation bei 26°C im Dunkeln auf dem anfänglichen osmotischen Medium platziert.

Vier Typ II-Kalluszelllinien wurden für jedes Experiment ausgewählt. Zwei Ziele von jeder Linie wurden pro Behandlungsgruppe verwendet. Es wurden auch zwei nicht transformierte Kontrollen (NTC) in jedes Experiment eingeschlossen, zusammengesetzt aus Gewebe, welches von allen vier Linien zusammengenommen war. Diese Kontrollen wurden auf osmotisches und Beschussmedium gemäß dem obigen Protokoll übertragen, wurden jedoch keinem Heliumbeschuss unterzogen.

C. Quantitative GUS-Analyse.

Ungefähr 20 h nach dem Beschuss wurden 200-400 mg jedes Ziels in ein 1,5 ml-Probenröhrchen übertragen (Kontes, Vineland, NJ). Für die Extraktion von Proteinen wurde der Kallus homogenisiert unter Verwendung eines Edelstahlpellet-Pistills, angetrieben durch einen 35 amp, 40 Watt-Motor (Modell 102, Rae Corporation, McHenry, IL) mit einer Einstellung von "90". Das Zellkulturlysereagenz von einem Luciferaseassaykit (Promega, Madison, WI) diente als der Extraktionspuffer. Zu dem Lysepuffer wurden Proteaseinhibitoren, Phenylmethylsulfonylfluorid (PMSF) und Leupeptinhemisulfatsalz mit Konzentrationen von 1 mM bzw. 50 &mgr;M zugegeben. Vor dem Mahlen wurde 0,5 &mgr;l Lysepufter pro mg Gewebe zu dem Probenröhrchen zugegeben. Der Kallus wurde in vier 25 sek-Intervallen homogenisiert, wobei nach jedem Zeitraum des Mahlens eine 10 sek-Inkubation auf Eis folgte. Danach wurde 1,0 &mgr;l Lysepufter pro mg Gewebe zu der Probe zugegeben, welche auf dem Eis belassen wurde, bis das gesamte Mahlen der Probe vollendet war. Die Proben wurden dann 2x bei 5°C für 7 min bei voller Geschwindigkeit zentrifugiert (Eppendorf Zentrifuge Modell 5415). Nach der ersten Runde wurde der Überstand von jedem Röhrchen entfernt und das Pellet wurde verworfen. Kallusextrakte (Überstände) wurden auch nach dem zweiten Lauf gesammelt und für die GUS- und Luciferase (LUC)-Analysen auf Eis gehalten.

Der LUC-Assaypuffer wurde mittels LUC-Assaykit hergestellt gemäß den Anleitungen des Herstellers durch Wiederherstellen eines lyophilisierten Luciferinsubstrats. Dieser Puffer wurde auf Raumtemperatur erwärmt und in die Zufuhrpumpe eines automatischen Lumineszenzphotometers (Modell 1251 Luminometer und Modell 1291 Dispenser, Bio-Orbit, Finnland) geladen. Jede Probe wurde dreifach getestet durch Zugeben von 20 &mgr;l Extrakt zu 3 Polypropylen-Luminometerröhrchen (Wallac, Gaithersburg, MD). Pro Röhrchen wurden 100 &mgr;l Assaypuffer zugeführt und die Lumineszenz wurde über eine 45 sek-Integrationsperiode nachgewiesen. "Leere Reaktionen", welche 20 &mgr;l Extraktionspufer anstelle von Kallusextrakt enthielten, wurden ebenso innerhalb jedes Experiments gemessen, um das Ausmaß des Hintergrundmesswerts des Luminometers zu bestimmen.

Für die Analyse der GUS-Aktivität wurde ein GUS-LightTM Assay Kit (Tropix, Bedford, MA) verwendet. Erneut wurde jede Probe dreifach untersucht, unter Verwendung von 20 &mgr;l Extrakt pro Luminometergefäß. Der GUS-LightTM-Reaktionspuffer wurde aus dem Assaykit hergestellt durch Verdünnen eines flüssigen GlucuronTM-Substrats nach den Anleitungen des Herstellers. Dieser Puffer wurde auf Raumtemperatur erwärmt und zu jedem Luminometergefäß in 180 &mgr;l Aliquots in 7 sek-Intervallen zugegeben. Nach 1 h Inkubation bei Raumtemperatur wurden 300 &mgr;l GUS-LightTM Light Emission-Beschleunigungspuffer zugegeben und die Lumineszenz wurde über eine 5 sek-Integrationsperiode nachgewiesen. "Leere Reaktionen" wurden ebenso in dem GUS-Assay eingeschlossen, unter Verwendung von 20 &mgr;l Extraktionspuffer anstelle von Kallusextrakt.

Die GUS- und LUC-Ergebnisse wurden als relative Lichteinheiten (RLU) angegeben. Sowohl "leere" als auch NTC-Messwerte wurden von den Proben-RLU-Werten abgezogen. Zum Vergleich eines Konstrukts mit einem anderen wurden die GUS-Messwerte im Hinblick auf LUC-Daten durch Berechnen der GUS/LUC-Verhältnisse für jede untersuchte Probe abgeglichen. Die Verhältnisse für alle Proben innerhalb einer Behandlungsgruppe wurden dann Bemittelt und die Mittelwerte wurden einem T-Test zur Bestimmung der statistischen Signifikanz unterzogen. Innerhalb jedes Experiments wurden die Ergebnisse als Prozent der pDAB305-Expression angegeben.

Der transiente Beschuss von Typ II-Kallus mit jedem der Konstrukte wurde wie oben beschrieben durchgeführt. Durch Einbeziehen von pDAB305 als Standard in jedem Experiment und Angeben der Ergebnisse als ein Prozentwert des Standards können die Daten von zahlreichen Experimenten aussagekräftig verglichen werden. Tabelle 20 zeigt Ergebnisse von drei Experimenten, wobei die nos-3'UTR gegenüber der per5-3'UTR unter Verwendung von zwei Promotoren untersucht wurde. Sowohl mit dem 35T- als auch dem Ubi1-Promotor ergab die per5-3'UTR eine höhere transiente GUS-Expression als die nos-3'-Endkonstrukte. pUGN223-3 ist ein Plasmid, welches eine Fusion des Maisubiquitinpromotors und des Ubiquitin-Intron 1 mit dem GUS-Gen enthält, ähnlich wie pUGP232-4. Jedoch besitzt pUGN223-3 anstelle der per-3'UTR die nos5-3'UTR. pUGN223-3 wurde als eine Kontrolle zum direkten Vergleich der Expression relativ zu den 3'-UTRs von per5 und nos in Kombination mit dem Maisubiquitin 1 (Ubi 1)-Promotor und dem Intron 1 verwendet.

  • * kein signifikanter Unterschied (p=0.05)
  • t signifikanter Unterschied (p=0,05)

Die transiente Analyse zeigte, dass die per5-3'UTR ebenso wie nos funktionierte, wenn das GUS-Gen durch den 35T-Promotor gesteuert war, und um 19% besser als nos, wenn sie durch den Ubiquitin 1-Promotor aus Mais gesteuert war. Der Grund für diese gesteigerte Effizienz ist nicht bekannt, könnte jedoch ein Ergebnis der Veränderungen in der Effizienz des Processing oder der gesteigerten Stabilität der Messenger-RNA sein.

Beispiel 23 Vergleich der GUS-Expression in transformiertem Reis für per5-3'UTR- und nos-3'UTR-Konstrukte

In diesem Beispiel werden die quantitativen Mengen der GUS-Expression gemessen, welche in transgenen Reispflanzen bei Verwendung der 3'-UTR als eine regulatorische Polyadenylierungssequenz erhalten werden, UGP232-4. In diesem Beispiel wird das GUS-Gen von dem Ubiquitin 1 (Ubi 1)-Promotor aus Mais gesteuert. Die Expressionsmengen werden verglichen mit denjenigen der nos-3'UTR-Sequenz und dem gleichen Promotor (Ubi 1)/GUS-Fusion, pDAB1518 (in Beispiel 28 beschrieben).

A. Transgene Produktion (in Beispiel 9 beschrieben).

  • 1. Plasmide. Das Plasmid UGP232-4, welches das GUS-Gen enthält, gesteuert vom Maisubiquitin 1-Promotor und der per5-3'UTR, wird in Beispiel 21 beschrieben. Das Plasmid pDAB354, welches ein Gen für Hygromycinresistenz trägt, wird in Beispiel 25 beschrieben.
  • 2. Reistransformation. Die Produktion von transgenen Reispflanzen wurde in Beispiel 9 beschrieben.

B. Expressionsanalyse.

Die Analyse der GUS-Expression und Southern-Analysenverfahren wurden in Beispiel 9 beschrieben. Diese Ergebnisse sind in Tabelle 21 für 30 unabhängige transgene Ereignisse zusammengefasst, welche mit UGP232-4 und 8 unabhängigen Ereignissen mit dem Kontrollplasmid pDAB1518 (in Beispiel 28 beschrieben) erhalten wurden.

  • * Das erwartete Fragment mit 3,9 kb wurde nicht erhalten, sondern stattdessen wurde eine Reihe von 2 bis 4 anderen Hybridisierungsbanden bemerkt.
  • n.d. = nicht bestimmt

Bei beiden Konstrukten wurde ein großes Ausmaß an Variabilität der GUS-Expression sowohl in Wurzeln als auch Blättern beobachtet. Obwohl einige wenige Ereignisse mit dem UGP-Konstrukt eine höhere GUS-Expression zeigten, waren die Expressionsmengen insgesamt unter Verwendung der per5-3'UTR vergleichbar mit den Mengen bei der nos-3'UTR. Eine Southern-Analyse von Pflanzen der 30 UGP232-4-Ereignisse bestätigte bei der die Mehrzahl der Ereignisse mit der GUS-Sonde ein entsprechendes Fragment mit 3,9 kb.

Insgesamt zeigte die per5-3'UTR die Fähigkeit, die Expression zu steigern, ebenso gut wie oder besser als die nos-3'UTR. Die per5-3'UTR ist auch verwendet worden, um das GUS-Reportergen in stabil transformiertem Mais (Beispiel 16) zu exprimieren. Deshalb besitzt diese Sequenz eine breite Verwendung als 3'UTR für die Expression von transgenen Produkten in Monokotyledonen und wahrscheinlich in Dikotyledonen.

Verschiedene Kombinationen der regulatorischen Sequenzen des per5-Gens haben sich beim Steuern der Expression von transgenen Produkten in mehreren Anbaupflanzen als nützlich erwiesen. Tabelle 22 fasst die transienten und stabilen Expressionsmuster zusammen, welche bei jedem der in Mais untersuchten Konstrukte beobachtet wurde, und die stabilen Expressionsmuster, welche in Reis beobachtet wurden. Diese Daten zeigen die Fähigkeit von jedem der per5-Promotoriterationen, die Transgenexpression zu steuern. Ein unerwarteter Befund war der, dass Introns die Gewebespezifität der Transgenexpression in stabil transformierten Maispflanzen signifikant beeinflussen, die Expression in Reis aber nicht auf ähnliche Art und Weise beeinflussen. In stabil transformierten Maispflanzen unterstützte das AdhI-Intron die Expression in allen Geweben, wohingegen das per5-Intron ein Gewebe-bevorzugendes Expressionsmuster unterstützte. Schließlich konnte die per5-3'UTR die transgene Expression unterstützen, wenn sie in Kombination mit dem per5-Promotor oder anderen heterologen Promotoren in Mais oder Reis verwendet wurde.

  • n.d.= nicht bestimmt

Beispiel 24 pDAB305

Das Plasmid pDAB305 ist ein Plasmid mit 5800 bp, welches einen Promotor enthält, welcher eine Tandemkopie des CaMV-35S (35S)-Enhancers, eine deletierte Version des AdhI-Introns 1 und den nicht translatierten Leader vom Hüllprotein des MSV ("Maize Streak Mosaik Virus") enthält, fusioniert mit dem &bgr;-Glucuronidasegen, welches dann von der nos-3'UTR gefolgt wird.

A. Konstruktion eines zweifach verstärkenden CaMV 35S-Promotors.

Dieser Abschnitt beschreibt die molekulare Manipulation, welche eine Duplikation des Expressions-Enhancer-Elements eines Pflanzenpromotors ergibt. Es ist gezeigt worden, dass diese Duplikation eine verstärkte Expression von Markergenen, deren Expression durch solch einen modifizierten Promotor gesteuert wird, in Tabakpflanzen ergibt (Kay et al. (1987)). [Anmerkung: Die in dieser Diskussion genannten Sequenzen stammen von dem Cabb S-Stamm des CaMV („Cauliflower Mosaic Virus"). Sie sind erhältlich als die MACSTRAS-Sequenz der Genbank, welche veröffentlicht ist (Franck et al., 1980). Alle DNA-Sequenzen sind in der konventionellen 5'-3'-Richtung angegeben. Das Ausgangsmaterial ist das Plasmid pUC13/35S (-343), wie von Odell et al. (1985) beschrieben. Dieses Plasmid umfasst beginnend am 3'-Ende der SmaI-Stelle von pUC13 (Messing (1983)) und lesend auf dem Strang, welcher benachbart ist zu dem nicht condierenden Strang des IacZ-Gens von pUC13, die Nukleotide 6495-6972 von CaMV, gefolgt von der Linkersequenz CATCGATG (welche eine ClaI-Erkennungsstelle enthält), gefolgt von den CaMV-Nukleotiden 7089-7443, gefolgt von der Linkersequenz CAAGCTTG, wobei die letztere Sequenz die Erkennungsstelle für HindIII umfasst, welche dann gefolgt wird vom Rest der pUC13-Plasmid-DNA.

  • 1. pUC13/35S(-343)-DNA wurde mit ClaI und NcoI verdaut, das große Fragment mit 3429 Basenpaaren (bp) wurde von dem kleinen Fragment mit 66 bp durch Agarosegelelektrophorese abgetrennt und dann durch Standardverfahren gereinigt.
  • 2. pUC13/35S(-343)-DNA wurde mit ClaI verdünnt und die vorstehenden Enden wurden durch Behandlung mit T4 DNA-Polymerase geglättet. Die DNA mit glatten Enden wurde dann mit künstlichen Oligonukleotidlinkern mit der Sequenz CCCATGGG ligiert, welche eine NcoI-Erkennungsstelle enthält. Die Ligationsreaktion wurde in kompetente Escherichia coli-Zellen transformiert, und ein Transformant wurde identifiziert, welcher ein Plasmid (mit dem Namen pOO#1) enthielt, welches an Position der früheren ClaI-Stelle eine NcoI-Stelle aufwies. Die DNA von pOO#1 wurde mit NcoI verdaut und die kompatiblen Enden des großen Fragments wurden wieder ligiert, was die Deletion von 70 bp aus pOO#1 ergibt, um das Zwischenplasmid pOO#1 Nco&Dgr; zu erzeugen.
  • 3. pOO#1 Nco&Dgr;-DNA wurde mit EcoRV verdaut und die glatten Enden wurden mit ClaI-Linkern mit der Sequenz CATCGATG ligiert. Ein E.coli-Transformant wurde identifiziert mit einem Plasmid, welches eine neue ClaI-Stelle an der Position der vorigen EcoRI-Stelle enthielt, und das Plasmid wurde pOO#1 Nco&Dgr; RV>Cla genannt.
  • 4. DNA von pOO#1 Nco&Dgr; RV>Cla-DNA wurde mit ClaI und NcoI verdaut, und das kleine (268 bp) Fragment wurde aus einem Agarosegel gereinigt. Dieses Fragment wurde dann mit dem 3429 bp-ClaI/NcoI-Fragment von pUC13/35S(-343) ligiert, welches oben in Schritt 1 hergestellt wurde, und ein E.coli-Transformant wurde identifiziert, welcher ein Plasmid mit den ClaI/NcoI-Fragmenten 3429 und 268 bp enthielt. Dieses Plasmid wurde pUC13/35S En genannt.
  • 5. pUC13/35S En-DNA wurde mit NcoI verdaut und die vorstehenden Enden wurden durch Behandlung mit T4 DNA-Polymerase geglättet. Die behandelte DNA wurde dann mit SmaI geschnitten und wurde mit BgllI-Linkern mit der Sequenz CAGATCTG ligiert. Es wurde ein E.coli-Transformant identifiziert, welcher ein Plasmid enthielt, in welchem das 416 bp SmaI/NcoI-Fragment mit mindestens zwei Kopien der BgllI-Linker ersetzt worden war, und wurde p35S En2 genannt. [Anmerkung: Die Verzweifachung dieser BgllI-Linker erzeugt neben den BgllI-Erkennungsstellen auch PstI-Erkennungsstellen, CTGCAG].

Die DNA-Struktur von p35s En2 ist wie folgt: Beginnend mit dem Nukleotid, welches dem dritten C-Rest der SmaI-Stelle auf dem Strang benachbart zum nicht codierenden Strang des lacZ-Gens von pUC13 folgt, die Linkersequenz CAGATCTGCAGATCTGCATGGGCGATG (SEQ ID NO:28), gefolgt von den CaMV-Nukleotiden 7090 bis 7344, gefolgt von der ClaI-Linkersequenz CATCGATG, gefolgt von den CaMV-Nukleotiden 7089 bis 7443, gefolgt von der HindIII-Linkersequenz CAAGCTT, gefolgt von dem Rest der pUC13-Sequenz. Diese Struktur besitzt das Merkmal, dass die Enhancersequenzen des CaMV 35S-Promotors, welche in der Region stromaufwärts der EcoRV-Stelle im viralen Genom liegen (Nukleotide 7090-7344) dupliziert worden sind. Dieses Promotorkonstrukt enthält die native 35S-Transkriptionsstartstelle, welche 11 Nukleotide stromaufwärts des ersten A-Rests der HindIII-Stelle liegt.

B. Plasmide unter Verwendung des 35S-Promotors und der nos-poly-A-Seguenzen von Agrobacterium

Das Ausgangsmaterial für das erste Konstrukt ist das Plasmid pBI221, bezogen von Clontech (Palo Alton, CA). Dieses Plasmid enthält eine leicht modifizierte Kopie des CaMV 35S-Promotors, wie von Bevan et al. (1985), Baulcombe et al. (1986), Jefferson et al. (1986) und Jefferson (1987) beschrieben. Beginnend am 3'-Ende der PstI-Stelle von pUC19 (Yanisch-Perron et al. (1985)), und unter Lesen des gleichen Strangs wie der Strang, welcher für das lacZ-Gen von pUC19 codiert, umfasst die Sequenz die Linkernukleotide GTCCCC, gefolgt von den CaMV-Nukleotiden 6605-7439 (wie in 24A beschrieben), gefolgt von der Linkersequenz GGGGACTCTAGAGGATCCCCGGGTGGTCAGTCCCTT (SEQ ID NO:29), worin die unterstrichenen Basen die BamHI-Erkennungssequenz darstellen. Diese Basen werden dann von 1809 Basenpaaren gefolgt, welche die codierende Sequenz des E.coli-uidA-Gens umfassen, welches für das &bgr;-Glucuronidase (GUS)-Protein codiert, und von 55 Basenpaaren der 3'-flankierenden Basen, welche vom E.coli-Genom stammen (Jefferson, 1986), gefolgt von der SacI-Linkersequenz GAGCTC, welche dann von der Linkersequenz GAATTTCCCC (SEQ ID NO:30) gefolgt wird. Diese Basen werden gefolgt von denSequenzen der RNA-Transkriptionstermination/dem Polyadenylierungssignal, welche vom Nopalinsynthase (nos)-Gen aus Agrobacterium tumefaciens stammen und das 256 bp-Sau3A I-Fragment umfassen, welches den Nukleotiden 1298-1554 von DePicker et al. (1982) entspricht, gefolgt von zwei C-Resten, der EcoRI-Erkennungssequenz GAATTC, und dem Rest von pUC19.

  • 1. pBI221-DNA wurde mit EcoRI und BamHI verdaut, und dann wurde das 3507 bp-Fragment aus einem Agarosegel gereinigt. pRAJ275 (Clontech, Jefferson, 1987)-DNA wurde mit EcoRI und SalI verdaut, und das 1826 bp-Fragment wurde aus einem Agarosegel gereinigt. Diese zwei Fragmente wurden zusammengemischt und es wurden komplementäre künstliche Oligonukleotide mit der Sequenz GATCCGGATCCG (SEQ ID NO:31) und TCGACGGATCCG (SEQ ID NO:32) zugegeben. [Diese Oligonukleotide haben beim Annealing vorstehende einzelsträngige Enden, welche mit den durch BamHI und SalI erzeugten vorstehenden Enden kompatibel sind.] Die Fragmente wurden miteinander ligiert und ein E.coli-Transformant wurde durch Restriktionsenzymanalyse identifiziert, welcher ein Plasmid mit der entsprechenden DNA-Struktur enthielt. Die DNA dieses Plasmids mit dem Namen pKA881 wurde mit BalI und EcoRI verdaut, und das Fragment mit 4148 bp wurde aus einem Agarosegel isoliert. DNA von pBI221 wurde auf ähnliche Art und Weise verdaut und das 1517 bp-Fragment von EcoRI/BalI wurde gelgereinigt und mit dem obigen pKA881-Fragment ligiert, um das Plasmid pKA882 zu erzeugen.
  • 2. pKA882-DNA wurde mit SacI verdaut, die vorstehenden Enden wurden durch Behandlung mit T4 DNA-Polymerase geglättet und das Fragment wurde mit künstlichen BamHI-Linkern mit der Sequenz CGGATCCG ligiert. Es wurde ein E.coli-Transformant identifiziert, welcher ein Plasmid mit den BamHI-Fragmenten von 3784 und 1885 Basenpaare enthielt, und es wurde pKA882B genannt.
  • 3. pKA882B-DNA wurde mit BamHI verdaut und das Gemisch der Fragmente wurde ligiert. Es wurde ein E.coli-Transformant identifiziert und p35S/nos genannt, welcher ein Plasmid enthielt, welches beim Verdau mit BamHI ein einzelnes Fragment mit 3783 bp ergab. Dieses Plasmid besitzt die wesentliche DNA-Struktur von pBI221, außer dass die codierenden Sequenzen des GUS-Gens deletiert worden sind. Deshalb werden die CaMV-Nukleotide 6605 bis 7439 durch die Linkersequenz GGGGACTCTAGAGGATCCCGAATTTCCCC (SEQ ID NO:33) gefolgt, worin die einfach unterstrichenen Basen eine XbaI-Stelle und die doppelt unterstrichenen Basen eine BamHI-Stelle darstellen. Die Linkersequenz wird dann von den nos-Polyadenylierungssequenzen und dem Rest von pBI221 gefolgt.
  • 4. p35S/nos-DNA wurde mit EcoRV und PstI verdaut und das 3037 bp-Fragment wurde gereinigt und mit dem 534 bp-Fragment ligiert, welches von dem Verdau der p35S En2-DNA mit EcoRV und PstI erhalten wurde. Es wurde ein E.coli-Transformant identifiziert, welcher ein Plasmid enthielt, welches beim Verdau mit EcoRV und PstI die Fragmente 3031 und 534 bp erzeugte, und das Plasmid wurde p35S En2/nos genannt. Dieses Plasmid enthält die verdoppelte 35S-Promotorenhancerregion, welche in Beispiel 25A Schritt 5 für p35S En2 beschrieben wurde, wobei die Promotorsequenzen von den nos-Polyadenylierungssequenzen durch Linkersequenzen getrennt sind, welche unikale XbaI- und BamHI-Stellen enthalten.

C. Konstruktion eines künstlichen nicht translatierten Leaders.

Dieses Beispiel beschreibt die molekulare Manipulation, welche zur Konstruktion eines DNA-Fragments verwendet wurde, welches Sequenzen enthält, die den 5'-nicht translatierten Leaderteil des „Major Rightward"-Transkripts des MSV („Maize Streak Virus")-Genoms umfasst. Die genomische MSV-Sequenz wurde von Mullineaux et al. (1984) und Howell (1984) publiziert, und das Transkript wurde von Fenoll et al. (1988) beschrieben. Die vollständige Sequenz, welche 154 bp umfasst, wurde durch Zusammensetzen von Blöcken von künstlichen Oligonukleotiden in 3 Stufen konstruiert (A, B und C).

  • 1. Der A-Block: Komplementäre Oligonukleotide mit der Sequenz GATCCAGCTGAAGGCTCGACAAGGCAGATCCACGGAGGAGCTGATATTTG GTGGACA (SEQ ID NO:34) und AGCTTGTCCACCAAATATCAGCTCCTCCGTGGATCTGCCTTGTCCAGCCTT CAGCTG (SEQ ID NO:35) wurden durch Standardverfahren synthetisiert und gereinigt. Ein Annealing dieser Nukleotide in doppelsträngige Strukturen hinterläßt 4 Basen lange einzelsträngige vorstehende Enden [hierin nachfolgend als "klebrige Enden" bezeichnet], welche mit denjenigen Enden kompatibel sind, welche durch BamHI an einem Ende des Moleküls (GATC) erzeugt werden, und mit den durch HindIII erzeugten einzelsträngigen Enden am anderen Ende des Moleküls (AGCT). Solche aneinandergelagerten Moleküle wurden in das Plasmid Bluescript® II SK- ligiert, welches mit BamHI und HindIII verdaut worden war. Die Sequenz dieser Oligonukleotide ist so, dass bei Ligation mit den entsprechenden klebrigen BamHI- und HindIII-Enden die Sequenzen der entsprechenden Erkennungsstellen beibehalten werden. Es wurde ein E.coli-Transformant mit einem Plasmid identifiziert, welches die Oligonukleotidsequenz enthielt, und das Plasmid wurde pMSV A genannt.
  • 2. Der B-Block: Komplementäre Oligonukleotide mit den Sequenzen AGCTGTGGATAGGAGCAACCCTATCCCTAATATACCAGCACCACCAAGTCA GGGCAATCCCGGG (SEQ ID NO:36) und TCGACCCGGGATTGCCCTGACTTGGTGGTGCTGGTATATTAGGGATAGGG TTGCTCCTATCCAC (SEQ ID NO:37) wurden synthetisiert und durch Standardverfahren gereinigt. Die unterstrichenen Basen stellen die Erkennungssequenz der Restriktionsenzyme SmaI und XmaI dar. Eine Aneinanderlagerung dieser Nukleotide in doppelsträngige Strukturen belässt 4 Basen lange klebrige Enden, welche kompatibel sind mit denjenigen Enden, welche durch HindIII an einem Ende des Moleküls (AGCT) erzeugt werden, und mit den durch SalI erzeugten klebrigen Enden am anderen Ende des Moleküls (TCGA). Die Sequenz dieser Oligonukleotide ist so, dass bei Ligation auf die klebrigen HindIII-Enden die Erkennungssequenz für HindIII zerstört wird.

DNA von pMSV A wurde mit HindIII und SalI verdaut und wurde in die oben aneinandergelagerten Oligonukleotide ligiert. Es wurde durch Restriktionsenzymkartierung ein E.coli-Transformant identifiziert, welcher ein Plasmid mit den neuen Oligonukleotiden enthält, und er wurde pMSV AB genannt.

  • 3. Der C-Block: Komplementäre Oligonukleotide mit den Sequenzen CCGGGCCATTTGTTCCAGGCACGGGATAAGCATTCAGCCATGGGATATCA AGCTTGGATCCC (SEQ ID NO:38) und TCGAGGGATCCAAGCTTGATATCCCATGGCTGAATGCTTATCCCGTGCCTG GAACAAATGGC (SEQ ID NO:39) wurden synthetisiert und gemäß Standardverfahren gereinigt. Die Oligonukleotide enthalten Basen, welche die Erkennungsstellen (unterstrichen) für NcoI (CCATTG), EcoRV (GATATC), HindIII (AAGCTT) und BamHI (GGATCC) umfassen. Eine Aneinanderlagerung dieser Nukleotide zu doppelsträngigen Strukturen belässt 4 Basen lange klebrige Enden, welche mit den Enden kompatibel sind, welche an einem Ende des Moleküls durch XmaI erzeugt werden (CCGG) und mit den klebrigen durch XhoI erzeugten Enden am anderen Ende des Moleküls (TCGA). Solche aneinandergelagerten Moleküle wurden in pMSV AB-DNA ligiert, welche mit XmaI und XhoI verdaut worden war. Es wurde ein E.coli-Tranformant durch Restriktionsenzymanalyse identifiziert, welcher ein Plasmid mit der Oligonukleotidsequenz enthält, und die DNA-Struktur wurde durch Sequenzanalyse bestätigt. Das Plasmid wurde pMSV CPL genannt; es enthält den A-, B- und C-Block der Nukleotide in der Reihenfolge ABC. Zusammen umfassen diese die 5'-nicht translatierte Leadersequenz ("L") des MSV-HüllProtein ("CP")-Gens. Diese entsprechen den Nukleotiden 167 bis 186 und 188 bis 317 der MSV-Sequenz von Mullineaux et al. (1984), und werden am 5'-Ende von der BamHI-Linkersequenz GGATCCAG und am 3'-Ende von der Linkersequenz GATATCAAGCTTGGATCCC (SEQ ID NO:40) flankiert. [Anmerkung: Ein A-Rest entsprechend der Base 187 der Wildtyp-MSV-Sequenz wurde während der Klonierung versehentlich deletiert.]
  • 4. Insertion der BgllI-Stelle: pMSV CPL-DNA wurde an der SmaI-Stelle entsprechend der Base 277 der genomischen MSV-Sequenz verdaut und die DNA wurde mit BgllI-Linkern mit der Sequenz CAGATCTG ligiert. Es wurde ein E.coli-Transformant identifiziert, welcher ein Plasmid mit der unikalen BgllI-Stelle an der Position der früheren SmaI-Stelle enthielt, und durch DNA-Sequenzanalyse bestätigt, und das Plasmid wurde pCPL-Bgl genannt.

D. Konstruktion einer deletierten Version des Alkoholdehydrogenase I (AdhI)-Introns 1 aus Mais

Das Ausgangsmaterial ist das Plasmid pVW119, welches von V. Walbot, Stanford University, Standford, CA erhalten wurde. Dieses Plasmid enthält die DNA-Sequenz des Mais-AdhI.S-Gens, einschließlich Intron 1, von den Nukleotiden 119 bis 672 [Nummerierung von Dennis et al. (1984)], und wurde von Callis et al. (1987) beschrieben. In pVW119 ist die Sequenz nach Base 672 von Dennis et al. (1984) GACGGATCC, worin die unterstrichenen Basen eine BamHI-Erkennungsstelle darstellen. Die gesamte Intron 1-Sequenz mit 14 Basen von Exon 1 und 9 Basen von Exon 2 kann von diesem Plasmid auf einem 556 bp-Fragment nach Verdau mit Bcll und BamHI erhalten werden.

  • 1. DNA vom Plasmid pSG3525a(Pst) wurde mit BamHI und Bcll verdaut und das 3430 bp-Fragment wurde aus einem Agarosegel gereinigt. [Anmerkung: Die Struktur von Plasmid pSG3525a(Pst) ist nicht direkt relevant für das Endergebnis dieser Konstruktionsreihe. Es wurde während einer nicht damit zusammenhängenden Reihe konstruiert und wurde ausgewählt, weil es Restriktionserkennungsstellen sowohl für Bcll als auch BamHI enthält und keine HindIII- und Stul-Stellen. Fachleute realisieren, dass andere Plasmide an diesem Schritt mit entsprechenden Ergebnissen eingesetzt werden können.] DNA des Plasmids pVW119 wurde mit BamHI und Bcll verdaut und das gelgereinigte Fragment mit 546 bp wurde mit dem 3430 bp-Fragment ligiert. Ein E.coli-Transformant wurde identifiziert, welcher ein Plasmid enthielt, welches beim Verdau mit BamHI und Bcll Fragmente mit 3430 und 546 bp ergibt. Dieses Plasmid wurde pSG AdhA1 genannt.
  • 2. DNA von pSG AdhA1 wurde mit HindIII [welches zwischen den Basen 209 und 210 der Sequenz von Dennis et al. (1984), unterer Strang, schneidet] und mit Stul verdaut, welches zwischen den Basen 554 und 555 schneidet. Die Enden wurden durch T4-DNA-Polymerasebehandlung geglättet und dann ligiert. Es wurde ein E.coli-Transformant identifiziert, welcher ein Plasmid ohne HindIII- und Stul-Stellen enthielt, und die DNA-Struktur wurde durch Sequenzanalyse bestätigt. Das Plasmid wurde pSG AdhA1&Dgr; genannt. In diesem Konstrukt sind 344 bp der DNA vom Inneren des Intron 1 deletiert worden. Der Verlust dieser Basen beeinflusst das Splicing dieses Introns nicht. Die funktionellen Intronsequenzen werden nach Verdau mit Bcll und BamHI auf einem 213 bp-Fragment erhalten.
  • 3. DNA des Plasmids pCPL-Bgl (Beispiel 24C Schritt 4) wurde mit BgllI verdaut und die linearisierte DNA wurde mit dem 213 bp Bell/BamHI-Fragment ligiert, welches die deletierte Version der AdhI.S-Intronsequenz von pSG AdhA1&Dgr; enthält. [Anmerkung: Die durch Verdau der DNA mit BglII, BclII und BamHI erzeugten klebrigen Enden sind kompatibel, aber eine Ligation der klebrigen BamHI- oder Bcll-Enden mit Enden, welche durch BglII erzeugt werden, erzeugt eine Sequenz, welche durch keines dieser drei Enzyme gespalten werden kann.] Es wurde ein E.coli-Transformant identifiziert durch Restriktionsenzymstellenkartierung, welcher ein Plasmid enthielt, welches die in die BglII-Stelle ligierten Intronsequenzen enthielt, in der Orientierung, so dass sich die BglII/Bcll-Verbindung am nächsten zum 5'-Ende der MSV CPL-Leadersequenz befand, und sich die BglII/BamHI-Verbindung am nächsten zum 3'-Ende des CPL befand. Diese Orientierung wurde durch DNA-Sequenzanalyse bestätigt. Das Plasmid wurde pCPL A111&Dgr; genannt. Die MSV-Leader/Intronsequenzen können von diesem Plasmid durch Verdau mit BamHI und NcoI, und Reinigung des 373 bp-Fragments erhalten werden.

E. Konstruktion von Pflanzenexpressionsvektoren auf Grundlage des verstärkten 35S-Promotors. dem MSV CPL und der deletierten Version des AdhI-Introns 1

  • 1. DNA des Plasmids p35S En2/nos wurde mit BamHI verdaut und das lineare 3562 bp-Fragment wurde in ein 171 bp-Fragment ligiert, welches von der pMSV CPL-DNA hergestellt worden war, welche mit BamHI verdaut wurde. Dieses Fragment enthält die gesamte MSV CPL-Sequenz, welche in Beispiel 7C beschrieben ist. Es wurde ein E.coli-Transformant durch Restriktionsenzymstellenkartierung identifiziert, welcher ein Plasmid enthielt, welches diese Sequenzen in einer solchen Orientierung enthielt, dass die NcoI-Stelle in der Nähe der nos-Poly-A-Sequenzen angeordnet war. Dieses Plasmid wurde p35S En2 CPL/nos genannt. Es enthält die verbesserte Version des 35S-Promotors direkt benachbart zu den MSV-Leadersequenzen, so dass das abgeleitete Transkript die MSV-Sequenzen in dem 5'-nicht translatierten Anteil enthält.
  • 2. DNA des Plasmids pKa882 (siehe Beispiel 24B Schritt 1) wurde mit HindIII und NcoI verdaut, und das große 4778 bp-Fragment wurde in ein 802 bp-HindIII/NcoI-Fragment ligiert, welches die verbesserten 35S-Promotorsequenzen und MSV-Leadersequenzen von p35S En2 CPL/nos enthält. Es wurde ein E.coli-Transformant identifiziert und pDAB310 genannt, welcher ein Plasmid enthält, welches nach Verdau mit HindIII und NcoI Fragmente von 4778 und 802 bp ergab. In diesem Plasmid wird die verbesserte Version des 35S-Promotors verwendet, um die Expression des GUS-Gens zu kontrollieren bzw. steuern. Der Anteil des 5'-nicht translatierten Leaders des Transkripts enhält die Leadersequenz des MSV-HüllProteingens.
  • 3. DNA des Plasmids pDAB310 wurde mit NcoI und SacI verdaut. Das große 3717 bp-Fragment wurde aus einem Agarosegel gereinigt und mit komplementären künstlichen Oligonukleotiden mit den Sequenzen CGGTACCTCGAGTTAAC (SEQ ID NO:41) und CATGGTTAACTCGAGGTACCGAGCT (SEQ ID NO:42) ligiert. Diese Oligonukleotide erzeugen bei Aneinanderlagerung in doppelsträngige Strukturen Moleküle mit klebrigen Enden, welche mit denjenigen Enden kompatibel sind, die durch SacI an einem Ende des Moleküls und durch NcoI am anderen Ende des Moleküls erhalten werden. Außer dass die Sequenzen für Erkennungsstellen für diese zwei Enzyme wiederhergestellt werden, werden neue Stellen für die Enzyme KpnI (GGTACC), XhoI (CTCGAG) und Hpal (GTTAAC) gebildet. Es wurde ein E.coli-Transformant identifiziert, welcher ein Plasmid enthielt, welcher Stellen für diese Enzyme enthielt, und die DNA-Struktur wurde durch Sequenzanalyse bestätigt. Dieses Plasmid wurde pDAB1148 genannt.
  • 4. Die DNA des Plasmids pDAB1148 wurde mit BamHI und NcoI verdaut, das große 3577 bp-Fragment wurde aus einem Agarosegel gereinigt und mit einem 373 bp-Fragment ligiert, welches nach Verdau mit BamHI und NcoI aus pCPL A111_ (Beispiel 24D Schritt 3) gereinigt wurde. Es wurde ein E.coli-Transformant identifiziert, welcher ein Plasmid mit BamHI und NcoI enthielt, und das Plasmid wurde pDAB303 genannt. Dieses Plasmid besitzt die folgende DNA-Struktur: Beginnend mit der Base nach dem letzten G-Rest der PstI-Stelle von pUC19 (Base 435) und lesend am Strang benachbart zum codierrenden Strang des lacZ-Gens, die Linkersequenz ATCTGCATGGGTG (SEQ ID NO:43), Nukleotide 7093 bis 7344 der CaMV-DNA, die Linkersequenz CATCGATG, die Nukleotide 7093 bis 7439 von CaMV, die Linkersequenz GGGGACTCTAGAGGATCCAG (SEQ ID NO:44), Nukleotide 167 bis 186 von MSV, Nukleotide 188 bis 277 von MSV, ein C-Rest nach den Nukleotiden 119 bis 209 von AdhI.S, Nukleotide 555 bis 672 von Mais-AdhI.S, die Linkersequenz GACGGATCTG, Nukleotide 278 bis 317 von MSV, die Polylinkersequenz GTTAACTCGAGGTACCGAGCTCGAATTTCCCC (SEQ ID NO:45), welche Erkennungsstellen für Hpal, XhoI, KpnI und SacI enthält, Nukleotide 1298 bis 1554 von nos und ein G-Rest, gefolgt von dem Rest der pUC19-Sequenz (einschließlich der EcoRI-Stelle). Es ist zu beachten, dass die Verbindung zwischen Nukleotid 317 von MSV und der langen Polylinkersequenz eine NcoI-Erkennungsstelle erzeugt.
  • 5. DNA des Plasmids pDAB303 wurde mit NcoI und SacI verdaut und das 3939 bp-Fragment wurde mit dem 1866 bp-Fragment ligiert, welches die GUScodierende Region enthält, hergestellt durch eine ähnlich verdaute DNA von pKA882. Das entsprechende Plasmid wurde durch Restriktionsenzymstellenkartierung identifiziert wurde pDAB305 genannt. Dieses Plasmid weist den verbesserten Promotor, MSV-Leader und eine AdhI-Intronanordnung von pDAB303 in einer Anordnung auf, dass die Expression des GUS-Gens kontrolliert bzw. gesteuert werden kann.

Beispiel 25 Plasmid pDAB354

Alle Verfahren waren Standardverfahren, entnommen von Maniatis et al. (1982).

Schritt 1: Das Plasmid pIC19R (Marsh et al., (1984) wurde zur Vollständigkeit mit dem Restriktionsenzym SacI verdaut, das Enzym wurde durch Hitzebehandlung inaktiviert und die Plasmid-DNA wurde auf Eis über Nacht mit einem 80-fachen Überschuss von nicht phosphoryliertem Oligonukleotidlinker mit der Sequenz 5'-GAGTTCAGGCTTTTTCATAGCT-3' (SEQ ID NO:46) ligiert, wobei AGCT komplementär mit den überhängigen Enden ist, erzeugt durch den SacI-Verdau. Die mit dem Linker versehene DNA wurde dann vollständig mit dem Enzym HindIII geschnitten, das Enzym wurde inaktiviert und die DNA wurde mit Ethanol präzipitiert.

Schritt 2: Das Plasmid pLG62 enthält ein 3,2 kb SalI-Fragment, welches das von Gritz und Davies (1983) beschriebene Hygromycin B-Phosphotransferase (Resistenz)-Gen enthält. 1 &mgr;g dieses Fragments wurde aus einem Agarosegel isoliert und vollständig mit dem Restriktionsenzym Hph 1 verdaut, um Fragmente von 1257 bp Länge zu erzeugen. Das Enzym wurde inaktiviert und die 3'-Enden der DNA-Fragmente wurden durch Behandlung mit T4-DNA-Polymerase bei 37°C für 30 min in Abwesenheit von zugegebenen Desoxynukleotidtriphosphaten herausgeschnitten.

Schritt 3: Nach einer Inaktivierung der Polymerase und einer Ethanolpräzipitation der DNA wurden die in Schritt 2 präparierten Fragmente in Nick-Translationssalzen (Maniatis et al. 1982) mit dem in Schritt 1 präparierten mit dem Linker versehenen Vektor gemischt, 5 min bei 65°C erwärmt und langsam auf 37°C abgekühlt. Die nicht aneinanderlagernden Enden wurden geglättet und einzelsträngige Regionen durch Behandlung mit dem Klenow-Fragment von Escherichia coli-DNA-Polymerase durch Inkubation bei 37°C für 45 min aufgefüllt, und dann wurde das Gemisch über Nacht bei 15°C ligiert. Nach einer Transformation in E.coli-MC1061-Zellen und Plattieren auf LB-Agar mit jeweils 50 &mgr;g Ampicillin und Hygromycin B wurde ein Isolat identifiziert, welches ein Plasmid enthielt, welches bei Verdau mit EcoRI, PstI oder HindII entsprechend große Fragmente erzeugte. Die DNA-Sequenzbestimmung eines Teils dieses Plasmids (pHYG1) ergab die Sequenz 5'-AGATCTCGTGAGATAATGAAAAAG-3' (SEQ ID NO:47), wobei das unterstrichene ATG das Startcodon des Hygromycin B-Resistenzgens darstellt und AGATCT die BglII-Erkennungsstelle ist. In pHYG1 befinden sich stromabwärts der für Hygromycin B-Resistenz codierenden Region etwa 100 Basen einer nicht bestimmten Sequenz, welche im nächsten Schritt deletiert werden.

Schritt 4: Die DNA des Plasmids pHYG1 wurde vollständig mit dem Restriktionsenzym BamHI verdaut und das so erzeugte lineare Fragment wurde teilweise mit ScaI verdaut. Fragmente mit 3644 bp wurden aus einem Agarosegel isoliert und mit phosphorylierten, aneinanderlagernden komplementären Oligonukleotiden mit den Sequenzen 5'-ACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAA GGAATAGTAAGAGCTCGG-3' (SEQ ID NO:48) und 5'-GATCCCGAGCTCTTACTATTCCTTTGCCCTCGGACGAGTGCTGGGGCGT CGGTTTCCACTATCGGCGAGT-3' (SEQ ID NO:49) ligiert. Bei einer Aneinanderlagerung weisen diese Oligonukleotide einen vorstehenden 4 Basen langen Überhang an einem Ende auf, welcher mit dem komplementär ist, welcher von BamHI erzeugt wird. Nach der Transformation des Ligationsgemischs in E.coli-DHSa-Zellen und Selektion auf einem LB-Medium mit 50 &mgr;g/ml Ampicillin wurde ein Tranformant identifiziert, welcher ein Plasmid enthielt, welches beim Verdau mit BamHI, BglII, EcoRI oder SacI die erwarteten Fragmente erzeugte. Dieses Plasmid wurde pHYG1 3'&Dgr; genannt. Die Sequenz dieses Plasmids stromabwärts des Stoppcodons der für die Hygromycin B-Resistenz codierenden Region (in obiger Sequenz als TAG unterstrichen, Gritz und Davies, 1983) codiert für die Erkennungsstelle für SacI.

Schritt 5. DNA des Plasmids pDAB 309 wurde vollständig mit dem Restriktionsenzym Bsml verdaut und die Enden wurden durch Behandlung mit T4-DNA-Polymerase geglättet. Das Plasmid pDAB309 besitzt die gleiche Grundstruktur wie pDAB305, an anderer Stelle beschrieben, außer dass eine für eine Kanamycinresistenz (NPTII) codierende Region die in pDAB305 vorliegende GUS-codierende Region ersetzt. Diese DNA wurde dann mit phosphorylierten aneinandergelagerten Oligonukleotid-BglII-Linkern mit der Sequenz 5'-CAGATCTG-3' ligiert. Eine transformierte Kolonie von DH5&agr;-Zellen wurde identifiziert, welche ein Plasmid enthielt, welches nach einem BglII-Verdau entsprechend große Fragmente erzeugte. Dieses Plasmid wurde pDAB309(Bg) genannt. DNA des Plasmids pDAB309(Bg) wurde vollständig mit SacI geschnitten und die linearisierten Fragmente wurden teilweise mit BglII verdaut. Fragmente mit 3938 bp (mit durch BglII und SacI erzeugten Enden) wurden aus einem Agarosegel isoliert.

Schritt 6. DNA des Plasmids pHYG1 3'&Dgr; wurde vollständig mit BglII und SacI verdaut. Die 1043 bp-Fragmente wurden aus einem Agarosegel isoliert und ligiert mit den 3938 bp-BglII/SacI-Fragmenten von pDAB309(Bg), oben hergestellt. Nach der Transformation in E.coli-DH5&agr;-Zellen und Selektion auf Ampicillin wurde ein Transformant identifiziert, welcher ein Plasmid enthielt, welches mit BglII plus SacI, PstI oder EcoRI die entsprechend großen Restriktionsfragmente erzeugte. Dieses Plasmid wurde pDAB354 genannt. Die Expression der für die Hygromycin B-Resistenz codierende Region ist unter die Kontrolle von im Wesentlichen den gleichen Elementen gestellt wie die GUScodierende Region in pDAB305.

Beispiel 26 Plasmid pDeLux

Die Produktion des GUS-Proteins von Genen, welche durch unterschiedliche Promotorversionen kontrolliert bzw. gesteuert werden, wurde oft mit einem inneren Kontrollgen verglichen, welches Leuchtkäfer-Luciferase produzierte. Dealet et al. (1987). Ein Plasmid (pT3/T7-1 LUC), enthaltend die für Luciferase (LUC) codierende Region wurde von Clontech (Palo Alto, CA) bezogen, und die codierende Region wurde an ihren 5'- und 3'-Enden durch Standardverfahren modifiziert. Kurz gesagt, die Sequenzen um das Translationsstart (ATG)-Codon wurden modifiziert, um eine NcoI-Stelle (CCATGG) und ein Alanincodon (GCA) an der zweiten Position zu enthalten. Am 3'-Ende wurde eine SspI-Erkennungsstelle, welche 42 bp stromabwärts des Stoppcodons der für Luciferase codierenden Region positioniert war, mit T4-DNA-Polymerase geglättet und mit künstlichen Oligonukleotidlinkern ligiert, welche die BglII-Erkennungssequenz codieren. Diese Modifikationen ermöglichen die Isolierung der intakten für Luciferase codierenden Region auf einem 1702 bp-Fragment nach Verdau mit NcoI und BglII. Dieses Fragment wurde verwendet, um das GUS-Gen des Plasmids pDAB305 (siehe Beispiel 24E, Schritt 5) zu ersetzen, so dass die für Luciferase codierende Region durch den verbesserten 35S-Promotor exprimiert wurde, was das Plasmid pDeLux ergab. Der 5'-nicht translatierte Leader des Primärtranskripts umfasste die modifizierte MSV-Leader/Adh-Intronsequenz.

Beispiel 27 Plasmid pDAB367

Das Plasmid pDAB367 besitzt die folgende DNA-Struktur: Beginnend mit der Base nach dem letzten C-Rest der SphI-Stelle von pUC19 (Base 441) und lesend entlang des Strangs benachbart zum lacZ-Gen codierenden Strang, die Linkersequenz CTGCAGGCCGGCCTTAATTAAGCGGCCGCGTTTAAACGCCCGGGCATTTA AATGGCGCGCCGCGATCGCTTGCAGATCTGCATGGGTG (SEQ ID NO:50), die Nukleotide 7093 bis 7344 der CaMV-DNA (Frank et al. (1980)), die Linkersequenz CATCGATG, die Nukleotide 167 bis 186 von MSV (Mullineaux et al. (1984)), die Nukleotide 188 bis 277 von MSV (Mullineaux et al. (1984)), ein C-Rest, gefolgt von den Nukleotiden 119 bis 209 der Adh 1S enthaltenden Teile von Exon 1 und Intron 1 von Mais (Denis et al. (1984)), die Nukleotide 555 bis 672, enthaltend Teile des Adh 1S-Introns 1 und Exon 2 (Denis et al. (1984)), die Linkersequenz GACGGATCTG (SEQ ID NO:51) und die Nukleotide 278 bis 317 von MSV. Dies wird gefolgt von einer modifizierten BAR codierenden Region von plJ4104 (White et al. (1990)), wobei das AGC-Serincodon in der zweiten Position durch das GCC-Alanincodon ersetzt ist, und das Nukleotid 546 der codierenden Region von G nach A verändert wurde, um die BglII-Stelle zu eliminieren. Neben der Linkersequenz TGAGATCTGAGCTCGAATTTCCCC (SEQ ID NO:52) die Nukleotide 1298 bis 1554 von nos (DePicker et al. (1982)) und ein G-Rest, gefolgt von dem Rest der pUC19-Sequenz (einschließlich der EcoRI-Stelle).

Beispiel 28 Plasmid pDAB1518

pDAB1518 besitzt die folgende DNA-Struktur: Die Sequenz CCGCGG, die Basen –899 bis +1093 des Maisubiquitin 1 (Ubi1)-Promotors und ein Ubi1-Intron, beschrieben von Christensen et al. (1992), einen Polylinker bestehend aus der Sequenz GGTACCCCCGGGGTCGACCATGG (SEQ ID NO:53) (mit Restriktionsstellen für KpnI, SmaI, SalI und NcoI, wobei die NcoI-Stelle die translationale Fusion ATG enthält), die Basen 306 bis 2157 des &bgr;-Glucuronidasegens von pRAJ220, beschrieben von Jefferson et al. (1986), die Sequenz GGGAATTGGAGCTCGAATTTCCCC (SEQ ID NO: 54), die Basen 1298 bis 1554 von nos (DePicker et al. (982)) und die Sequenz GGGAAATTAAGCTT (SEQ ID NO: 55), gefolgt von der pUC18 (Yanisch-Perron et al., 1985)-Sequenz von Base 398 bis Base 399 (gelesen auf dem Strang gegenüber zu dem zum lacZ-Gen codierenden Strang benachbarten Strang).

Beispiel 29 Plasmid pDAB1538

pDAB1538 besitzt die folgende DNA-Struktur: die Sequenz AGCGGCCGCATTCCCGGGAAGCTTGCATGCCTGCAGAGATCCGGTACCC GGGGATCCTCTAGAGTCGAC (SEQ ID NO: 56), die Basen –899 bis +1903 des Maisubiquitin 1 (Ubi1)-Promotors und das Ubi1-Intron, beschrieben von Christensen et al. (1992), einen Polylinker bestehend aus der Sequenz GGTACCCCCGGGGTCGACCATGGTTAACTCGAGGTACCGAGCTCGAATTT CCCC (SEQ ID NO: 57), die Basen 1298 bis 1554 von nos (DePicker et al. (1982)), und die Sequenz GGGAATTGGTTTAAACGCGGCCGCTT (SEQ ID NO: 58), gefolgt von der pUC19 (Yanisch-Perron et al., 1985)-Sequenz beginnend bei Base 400 und endend bei Base 448 (gelesen auf dem Strang gegenüber zu dem zum lacZ-Gen codierenden Strang benachbarten Strang). Die NcoI-Stelle in der Ubi1-Sequenz beginnend bei Base 143 wurde durch die Sequenz CCATGCATGG (SEQ ID NO: 59) ersetzt.

Literaturhinweise

  • Anderson (1984), Science, 226:401.
  • Armstrong et al. (1991), Maize Genet. Coop. New Lett. 65:92.
  • Austin, G. D. (1994), U. S. Patent no. 5,362,865.
  • Ausubel et al. (1987) Current Protocols in Molecular Biology, John Wiley and Sons, New York, NY.
  • Baulcombe et al., (1986). Nature 321:446-449.
  • Beaucage et al. (1981), Tetrahedron Letters, 22:1859-1962).
  • Benfey P. N., L. Ren und N.-H. Chua. (1989), EMBO Journal 8:2195-2202.
  • Benfey, P. N., und Nam-Hai Chua. (1990), Science 250:959-966.
  • Bevan et al. (1985), EMBO J. 4:1921-1926.
  • Bevan et al. (1986) Nukleinsäures Res. 14 (11), 4675-4638.
  • Bohlmann und Apel (1991), Annu. Rev. Plant Physiol Plant Mol. Biol., 42:227-240.
  • Bradford (1976) Anal. Biochem. 72: 248-254.
  • Brewbaker et al. (1985), Journal of Heredity, 76:159-167.
  • Buffard et al. (1990), Proc. Natl. Acad. Sci., 87:8874-8878.
  • Callis J., M. Fromm, und V. Walbot. (1987), Gene Dev. 1:1183-1200.
  • Cammue et al. (1992), J. Biol. Chem, 267:2228-2233.
  • Caruthers (1983) in: Methodology of DNA and RNA, (ed.) Weissman.
  • Christensen, et al. (1992) Plant Mol. Biol. 18: 675-689.
  • Chu (1978), Proc. Symp. Plant Tissue Culture, Peking Press, p43-56.
  • Conkling et al. (1990), Plant Physiol., 93(3), 1203-1211.
  • Crossway, et al. (1986), Mol. Gen. Genet. 202:179-185.
  • Croy, et al., WO 9113992
  • Datla, R.S.S. et al. (1993), Plant Science 94:139-149.
  • De Framond, EPO Application Number 452 269
  • Deikman et al. (1988), Embo J. 7 (11) 3315.
  • Dennis et al. (1984), Nucl. Acids Res. 12:3983-4000.
  • DePicker et al. (1982), J. Molec. Appl. Genet. 1: 561-573.
  • Dealet et al. (1987), Molec. Cell Biol. 7:725-737.
  • Dityatkin, et al. (1972), Biochimica et Biophysica Acta, 281:319-323. EP 0 405 696.
  • Erlich (ed.)(1989)).PCR Technology: Principles and Applications for DNA Amplification.
  • Fenoll et al. (1988), EMBO J. 7:1589-1596.
  • Fraley, et al. (1986), CRC Crit. Rev. Plant Sci., 4:1-46.
  • Frank et al. (1980) Cell 21:285-294.
  • Fu et al. (1995), The Plant Cell, 7:1387-1394.
  • Fujiyama et al. (1988), Eur. J. Biochem., 173:681-687.
  • Gallie et al. (1989), The Plant Cell, 1:301-311.
  • Gamborg et al. (1968), Exp. Cell Res. 50: 151-158.
  • Gaspar et al. (1982), Peroxidases: A Survey of Their Biochemical and Physiologica Roles in Higher Plant (Univ. of Geneva Press, Geneva).
  • Gritz et al. (1983), Gene 25:179-188.
  • Grunstein, M. (1992), Scientific American, October 68-74.
  • Hertig et al. (1991), Plant Mol. Biol., 16:171-174.
  • Hiatt, et al. (1989), Nature, 342:76-78.
  • Higuchi et al. (1988), Nucl. Acids Res., 16:7351.
  • Higuchi et al. (1988), Nucl. Acids Res., 16:7351-7367.
  • Ho et al. (1989), Gene, 77:51-59.
  • Hofte und Whitely (1989), Microbiol. Rev., 53:242-255.
  • Horton et al. (1989), Gene, 77:61.
  • Howell (1984). Nucl. Acids Res. 12:7359-7375.
  • Hultmark et al. (1982), EUR. J. Biochem., 127:207-217.
  • Hultmark et al. (1983), EMBO J., 2:571-576.
  • Jackson und Standart (1990), Cell 62:15-24.
  • Jefferson (1987) Plant Molec. Biol. Reporter 5:387.
  • Jefferson et al. (1986), Proc. Natl. Acad. Sci. 83:8447-8451.
  • Jefferson et al. (1987), EMBO J. 6: 3901.
  • Kaiser et al. (1987), Ann. RevBiophys. Biophys. Chem., 16:561-581).
  • Kat et al. (1987), Science 236:1299.
  • Katsu et al. (1988), Biochim. Biophys. Acta, 939:57-63.
  • Kay et al. (1987), Science 236 1299-1302.
  • Knott et al. (1985), Science, 230:37.
  • Knowles et al. (1987), Biochim. Biophys. Acta 924:509-518.
  • Kozak (1986), Cell 44:283-292.
  • Kriz, A. L. et al. (1987), Molecular and General Genetics 207: 90-98.
  • Lagrimini et al. (1987), Plant Physiol., 84:438-442.
  • Lagrimini et al. (1987), Proc. Natl. Acad. Sci., 84:7542-7546.
  • MD.
  • Lee, K. und A. H. C. Huang. (1994), Plant Molecular Biology 26:1981-1987.
  • Lewah et al. (1991), J. Biol. Chem., 266:1564-1573.
  • Li et al. (1993), Plant Cell Rep. 12: 250-255.
  • Linthorst (1991), Critical Rev. Plant Sci., 10:123-150.
  • Lis et al. (1986), Ann. Rev. Biochem., 55:35-68.
  • Luehrsen, K. R. und V. Walbot. (1994), Plant Cell Reports 13:454-458.
  • Mandel und Higa (1972), J. Mol. Biol., 53:159.
  • Maniatis et al., eds. (1982) Molecular Cloning, First Edition, Cold Spring Harbor Press.
  • Marsh et al. (1984), Gene 32:481.
  • Matzke et al. (1993), Ann. Rev. Plant Physiol. Plant Mol. Biol. 44: 53-76.
  • Mazza und Welinder (1980), Eur. J. Biochem. 108:481-489.
  • McElroy, D. und R. S. Brettell. (1994), Trends Biotechnology 12:62-68.
  • Messing et al. (1983) in:Genetic Engineering of Plants, (Kosuga et al. eds.), Plenum Press, pp. 211-227).
  • Miller, et al. (1988), Proc. Natl. Acad. Sci. USA, 85:856-860;
  • Morgens et al. (1990), Plant Mol. Biol., 14:715.
  • Mullineaux et al. (1984), EMBO J. 3:3063.
  • Mullis et al. (1987), Meth. Enz., 155:335.
  • Murashige and Skoog (1962), Physiol. Plant, 15: 473.
  • Nakagawa et al., (1985) J. Am. Chem. Soc., 107:7087;
  • Nakamura et al. (1988), Plant Physiol., 88:845.
  • Odell et al. (1985), Nature 313: 810-812.
  • Oiki et al. (1988), PNAS USA, 85:2393-2397.
  • Pain (1986), Biochem. J., 235:625-637.
  • Pear et al. (1989), Plant Mol. Biol. 13: 639.
  • Powell, et al (1988), Appl. Environ. Microbiol., 54:655-660.
  • Raju, S. S. D. et al (1993), Plant Science 94: 139-149.
  • Rothnie et al. (1994), EMBO Journal, 13:2200-2210.
  • Ryan (1990), Annu Rev. Phytopathol., 28:425.
  • Saghai-Maroof et al. (1984), Proc. Natl. Acad. Sci. USA 81:8014.
  • Samac et al. (1990), Plant Physiol. 93: 907-914
  • Sambrook et al. (1989), Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Press, Cold Spring Harbor, NY.
  • Shigekawa and Dower (1988), Biotechniques, 6:742.
  • Southern, E. (1975), J. Mol. Biol. 98:503.
  • Southern, E. (1980), Methods Enzymol. 69:152.
  • Sullivan, M. L and P. Green (1993), Plant Molecular Biology 23: 1091-1104.
  • Tierney et al. (1987), Planta 172: 356.
  • Tobkes et al. (1985), Biochem. 24:1915-1920.
  • Uchidaz, et al. (1980), in: Introduction of Macromolecules Into Viable Mammalian Cells, (Baserga et al. ,eds.) Wistar Symposium Series, Vol. 1, A.ÊR. Liss Inc., NY, pp.Ê169-185.
  • Uchimiya, et al. (1982), in: Proc. 5th Intl. Cong. Plant Tissue and Cell Culture, (Fujiwara, ed.), Jap. Assoc. for Plant Tissue Culture, Tokyo, 507.
  • Vain, P.et al. (1996), Plant Cell Reports 15:489-494.
  • Vain et al. (1993), Plant Cell Rep. 12: 84.
  • Van Parijis et al. (1991), Planta, 183:258.
  • Vigers et al. (1992), Plant Sci., 83:155.
  • Viret, J.-F. et al. (1994), Proc. Nat Acad. Sci. 91:8577-8581.
  • Walbot et al. (1991), ISPMB Third International Congress, Tucson, AZ. Abstract No. 30.
  • White et al. (1990), Nucl. Acids. Res. 18: 1062.
  • Wigler, et al. (1979), Cell, 16:77.
  • Wilmink et al. (1995), Plant Molecular Biology 28:949-955.
  • Woloscuk et al. (1991), The Plant Cell, 3:619-628.
  • Xu et al (1994), Plant Physiol. 106:459-467.
  • Yamamoto et al. (1991), Plant Cell, 3(4):371-382.
  • Yanisch-Perron et al.(1985), Gene 33:103-119.
  • Zasloff (1987), PNAS USA, 84:5449-5453.
  • Zoller et al. (1984), DNA, 3:479.


Anspruch[de]
Isoliertes DNA-Molekül, welches ausgewählt ist aus den folgenden per5-Promotorsequenzen:

bp 4086 bis 4148 der SEQ ID NO:1,

bp 4086 bis 4200 der SEQ ID NO:1,

bp 4086 bis 4215 der SEQ ID NO:1,

bp 3187 bis 4148 der SEQ ID NO:1,

bp 3187 bis 4200 der SEQ ID NO:1,

bp 3187 bis 4215 der SEQ ID NO:1,

bp 2532 bis 4148 der SEQ ID NO:1,

bp 2532 bis 4200 der SEQ ID NO:1,

bp 2532 bis 4215 der SEQ ID NO:1,

bp 1 bis 4148 der SEQ ID NO:1,

bp 1 bis 4200 der SEQ ID NO:1 und

bp 1 bis 4215 der SEQ ID NO:1,

oder ein Fragment, eine genetische Variante oder Deletion einer solchen Sequenz, welche die Fähigkeit beibehält, in Pflanzenzellen als ein Promotor zu wirken.
Isoliertes DNA-Molekül, welches ausgewählt ist aus den folgenden per5-Intronsequenzen:

bp 4426 bis 5058 der SEQ ID NO:1,

bp 4420 bis 5064 der SEQ ID NO:1,

bp 5251 bis 5382 der SEQ ID NO:1,

bp 5245 bis 5388 der SEQ ID NO:1,

bp 5549 bis 5649 der SEQ ID NO:1 und

bp 5542 bis 5654 der SEQ ID NO:1.
Isoliertes DNA-Molekül, welches der per5-Transkriptionsterminationssequenz entspricht und die Sequenz der bp 6068 bis 6431 der SEQ ID NO:1 aufweist. Rekombinante Genkassette zum Bewirken der Expression eines Gens von Interesse in einer transformierten Pflanzenzelle, worin die Genkassette

einen Promotor,

eine nicht translatierte Leadersequenz,

das Gen von Interesse, worin das Gen von Interesse ein anderes Gen als per5 ist und

einen per5 -3'-UTR, umfassend die bp 6068 bis 6431 der SEQ ID NO:1 umfasst.
Rekombinante Genkassette nach Anspruch 4, worin der Promotor ausgewählt ist aus der Gruppe bestehend aus dem 35T-Promotor, dem Ubiquitin-Promotor und einem per5-Promotor, umfassend die bp 2532 bis 4148 der SEQ ID NO:1. DNA-Konstrukt, umfassend

a) einen Promotor, umfassend die bp 4086 bis 4148 der SEQ ID NO:1,

b) eine nicht translatierte Leadersequenz,

c) ein Gen von Interesse, welches natürlicherweise nicht mit dem Promotor verbunden ist,

d) eine 3'-UTR

welche in der 5'-3'-Richtung operativ verbunden sind.
DNA-Konstrukt nach Anspruch 6, worin der Promotor und die nicht translatierte Leadersequenz zusammen die bp 4086 bis 4200 der SEQ ID NO:1 umfassen. DNA-Konstrukt nach Anspruch 6, worin der Promotor die bp 3187 bis 4148 der SEQ ID NO:1 umfasst. DNA-Konstrukt nach Anspruch 6, worin der Promotor die bp 2532 bis 4148 der SEQ ID NO:1 umfasst. DNA-Konstrukt nach Anspruch 6, worin der Promotor die bp 1 bis 4148 der SEQ ID NO:1 umfasst. DNA-Konstrukt nach Anspruch 6, worin die 3'-UTR die nos-3'-UTR ist. DNA-Konstrukt nach Anspruch 6, worin die 3'-UTR die Sequenz der bp 6066 bis 6550 der SEQ ID NO:1 aufweist. DNA-Konstrukt, umfassend

a) einen Promotor, umfassend die bp 4086 bis 4148 der SEQ ID NO:1,

b) ein Intron, ausgewählt aus der Gruppe bestehend aus dem Adh1-Intron 1 und den bp 4426 bis 5058 der SEQ ID NO:1,

c) ein Gen von Interesse, welches natürlicherweise nicht mit dem Promotor verbunden ist,

d) eine 3'-UTR

welche in der 5'-3'-Richtung operativ verbunden sind.
DNA-Konstrukt nach Anspruch 13, worin die 3'-UTR ausgewählt ist aus der Gruppe bestehend aus nos und den bp 6067 bis 6340 der SEQ ID NO:1. DNA-Konstrukt nach Anspruch 13, worin die 3'-UTR ausgewählt ist aus der Gruppe bestehend aus nos und den bp 6067 bis 6439 der SEQ ID NO:1. DNA-Konstrukt, umfassend in der 5'-3'-Richtung

a) einen Promotor, welcher zumindest als einen Teil seiner Sequenz die bp 4086 bis 4148 der SEQ ID NO:1 aufweist,

b) ein Intron, ausgewählt aus der Gruppe bestehend aus dem Adh1-Intron 1 und den bp 4426 bis 5058 der SEQ ID NO:1,

c) eine Klonierungsstelle,

d) eine 3'-UTR.
DNA-Konstrukt nach Anspruch 16, worin die 3'-UTR ausgewählt ist aus der Gruppe bestehend aus nos und den bp 6067 bis 6340 der SEQ ID NO:1. DNA-Konstrukt, umfassend

a) einen Promotor, welcher zumindest als einen Teil seiner Sequenz die bp 4086 bis 4148 der SEQ ID NO:1 aufweist,

b) eine nicht translatierte Leadersequenz, umfassend die bp 4149 bis 4200 der SEQ ID NO:1,

c) ein Intron, welches ausgewählt ist aus der Gruppe bestehend aus dem Adh1-Gen-Intron und den bp 4426 bis 5058 der SEQ ID NO:1,

d) ein Gen von Interesse und

e) eine 3'-UTR

welche operativ in der 5'-3'-Richtung verbunden sind.
DNA-Konstrukt, umfassend in der 5'-3'-Richtung

a) einen Promotor, welcher zumindest als einen Teil seiner Sequenz die bp 4086 bis 4148 der SEQ ID NO:1 aufweist,

b) eine nicht translatierte Leadersequenz,

c) ein Intron, welches ausgewählt ist aus der Gruppe bestehend aus dem Adh1-Gen-Intron und den bp 4426 bis 5058 der SEQ ID NO:1,

d) eine Klonierungsstelle und

e) eine 3'-UTR.
Plasmid, umfassend einen Promotor, welcher die bp 4086 bis 4148 der SEQ ID NO:1 umfasst. Plasmid nach Anspruch 20, worin der Promotor die bp 3187 bis 4148 der SEQ ID NO:1 umfasst. Plasmid nach Anspruch 21, worin der Promotor die bp 2532 bis 4148 der SEQ ID NO:1 umfasst. Plasmid nach Anspruch 20, worin der Promotor die bp 1 bis 4148 der SEQ ID NO:1 umfasst. Plasmid, umfassend ein DNA-Konstrukt nach einem der Ansprüche 6 bis 19. Transformierte Pflanze, welche zumindest eine Pflanzenzelle umfasst, welche ein DNA-Konstrukt nach einem der Ansprüche 6 bis 19 enthält. Samen oder Saatkorn, welches ein DNA-Konstrukt nach einem der Ansprüche 6 bis 19 enthält.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com