PatentDe  


Dokumentenidentifikation DE69834199T2 14.12.2006
EP-Veröffentlichungsnummer 0001015565
Titel BIOLOGISCHE SYSTEME ZUR HERSTELLUNG VON POLYHYDROXYALKANOATE POLYMEREN DIE 4-HYDROXYSÄURE ENTHALTEN
Anmelder Metabolix, Inc., Cambridge, Mass., US
Erfinder HUISMAN, W., Gjalt, San Carlos, CA 94070-3419, US;
SKRALY, A., Frank, Boston, MA 02215, US;
MARTIN, P., David, Arlington, MA 02174, US;
PEOPLES, P., Oliver, Arlington, MA 02174, US
Vertreter Andrae Flach Haug, 83022 Rosenheim
DE-Aktenzeichen 69834199
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 18.09.1998
EP-Aktenzeichen 989483847
WO-Anmeldetag 18.09.1998
PCT-Aktenzeichen PCT/US98/19659
WO-Veröffentlichungsnummer 1999014313
WO-Veröffentlichungsdatum 25.03.1999
EP-Offenlegungsdatum 05.07.2000
EP date of grant 12.04.2006
Veröffentlichungstag im Patentblatt 14.12.2006
IPC-Hauptklasse C12N 9/10(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 15/54(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/70(2006.01)A, L, I, 20051017, B, H, EP   C12R 1/19(2006.01)A, L, I, 20051017, B, H, EP   C12P 1/04(2006.01)A, L, I, 20051017, B, H, EP   C12P 7/00(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
Hintergrund der Erfindung

Diese Anmeldung beansprucht die Priorität der US-Serial No. 60/059 373, eingereicht am 19. September 1997 unter dem Titel "Biological Systems for the Manufacture of Polyhydroxyalkanoate Polymers containing 4-Hydroxyacids" von Gjalt W. Huisman, Frank A. Skraly, David P. Martin und Oliver P. Peoples.

Poly[(R)-3-hydroxyalkanoate] (PHAs) sind biologisch abbaubare und biokompatible thermoplastische Materialien, erzeugt aus erneuerbaren Quellen, mit einer Vielzahl industrieller und biomedizinischer Anmeldungen (Williams und Peoples, 1996, Chemtech 26: 38–44). In den vergangenen Jahren hat sich, was als ein einziges Polymer, Poly-&bgr;-hydroxybutyrat (PHB), angesehen wurde, zu einer großen Klasse von Polyestern mit unterschiedlichen Monomerzusammensetzungen und einem weiten Bereich an physikalischen Eigenschaften entwickelt. Bis heute sind ungefähr 100 verschiedene Monomere in die PHA-Polymere eingearbeitet worden (Steinbüchel & Valentin, 1995, FEMS Microbiol. Lett. 128: 219–228). Es hat sich als hilfreich erwiesen, die PHAs in Abhängigkeit von der Länge ihrer Seitenketten und ihren Biosynthesewegen grob in zwei Gruppen einzuteilen. Diejenigen mit kurzen Seitenketten wie Polyhydroxybutyrat (PHB), ein Homopolymer aus R-3-Hydroxybuttersäureeinheiten, wobei n gleich 0 oder eine ganze Zahl ist und R1, R2, R3 und R4 jeweils ausgewählt sind aus gesättigten und ungesättigten Kohlenwasserstoffgruppen, halogen- und hydroxysubstituierten Gruppen, Hydroxygruppen, Halogengruppen, stickstoffsubstituierten Gruppen, sauerstoffsubstituierten Gruppen und Wasserstoffatomen,

sind kristalline thermoplastische Materialien, während PHAs mit langen Seitenketten stärker elastomer sind. Die ersteren kennt man seit ungefähr siebzig Jahren (Lemoigne & Roukhelman, 1925), während die letzteren Materialien erstmals in den frühen 1980er Jahren identifiziert wurden (deSmet et al., 1983, J. Bacteriol. 154: 870–878). Bereits vorher waren jedoch PHAs mikrobiellen Ursprungs, die sowohl (R)-3-Hydroxybuttersäureeinheiten als auch eine oder mehrere längere Seitenkette(n) aus Hydroxysäureeinheiten von fünf bis sechzehn Kohlenstoffatomen enthalten, identifiziert worden (Steinbüchel und Wiese, 1992, Appl. Microbiol. Biotechnol. 37: 691–697, Valentin et al., 1992, Appl. Microbiol. Biotechnol. 36: 507–514, Valentin et al., 1994, Appl. Microbiol. Biotechnol. 40: 710–716, Lee et al., 1995, Appl. Microbiol. Biotechnol. 42: 901–909, Kato et al., 1996, Appl. Microbiol. Biotechnol. 45: 363–370, Abe et al., 1994, Int. J. Biol. Macromol. 16: 115–119, Valentin et al., 1996, Appl. Microbiol. Biotechnol. 46: 261–267, US-Patent 4 876 331). Eine Kombination der beiden Biosynthesewege liefert wahrscheinlich die Hydroxysäuremonomere. Diese letzteren Copolymere lassen sich als PHB-co-HX ausdrücken. Ein nützliches Beispiel für ein spezifisches Copolymer aus zwei Komponenten ist PHB-co-3-hydroxyhexanoat (Brandl et al., 1989, Int. J. Biol. Macromol. 11: 49–55, Amos und McInerey, 1991, Arch. Microbiol. 155: 103–106, Shiotani et al., 1994, US-Patent 5 292 860). Es wurden auch chemische Syntheseverfahren zur Herstellung razemischer PHB-Copolymere dieses Typs für Testungen bezüglich bestimmter Anwendungen eingesetzt (WO 95/20614, WO 95/20615 und WO 96/20621).

Zahlreiche Mikroorganismen haben die Fähigkeit zur Akkumulation intrazellulärer Reserven an PHA-Polymeren. Da Polyhydroxyalkanoate natürliche thermoplastische Polyester sind, werden sie meistens als ein Ersatz für petrochemische Polymere eingesetzt, die derzeit für Verpackungen und Beschichtungen verwendet werden. Der sehr breite Bereich der physikalischen Eigenschaften der PHA-Familie der Polymere stellt, zusätzlich zur Erweiterung der Leistungsfähigkeit, die durch das Kompoundieren und Mischen, wie es herkömmlicherweise in der Polymerindustrie durchgeführt wird, einen entsprechend breiten Bereich an potenziellen Endanwendungen bereit. Die PHAs können als eine Vielzahl verschiedener Typen erzeugt werden, in Abhängigkeit von der Zusammensetzung aus den Hydroxysäuremonomeren (Steinbüchel und Valentin, 1995, FEMS Microbiol. Lett. 128: 219–228). Dieser breite Bereich an Polymerzusammensetzungen spiegelt einen ebenso breiten Bereich an physikalischen Eigenschaften der Polymere wider, zu denen gehören: ein Bereich der Schmelztemperaturen von 40°C–180°C, Glasübergangstemperaturen von –35 bis 5°C, Kristallinitäten von 0% bis 80%, gekoppelt mit der Fähigkeit zur Steuerung der Kristallisationsgeschwindigkeit, und eine Dehnung beim Reißen von 5 bis 500%. Poly(3-hydroxybutyrat), zum Beispiel, hat Eigenschaften, die denjenigen von Polypropylen ähnlich sind, während sich Typen wie Poly(3-hydroxyoctanoat) (ein Copolymer von (R)-3-Hydroxyoctanoat und (R)-3-Hydroxyhexanoat eher wie Elastomere verhalten, und PHAs mit längenen Seitenketten verhalten sich eher wie Wachse. Die PHAs können auch mit Weichmachern versehen und mit anderen Polymeren oder Agenzien gemischt werden. Eine besonders nützliche Form ist ein Latex aus PHA in Wasser.

Die Zusammensetzung aus den Monomeren beeinflusst auch die Löslichkeit in organischen Lösemitteln, was die Wahl unterschiedlichster Lösemittel ermöglicht. Die Löslichkeitseigenschaften von Copolymeren von (R)-3-Hydroxybutyrat und anderen Hydroxysäure-Comonomeren unterscheiden sich beträchtlich von denjenigen des PHB-Homopolymers.

Bis jetzt waren PHAs nur eingeschränkt kommerziell verfügbar, wobei nur das Copolymer Poly(3-hydroxybutyrat-co-3-hydroxyvalerat) (PHBV) in nennenswerten Mengen verfügbar war. Dieses Copolymer wird über die Fermentation des Bakteriums Ralstonia eutropha (früher Alcaligenes eutrophus) erzeugt. Es wurden Fermentationsprozesse für andere PHAs entwickelt (Williams und Peoples, 1996, Chemtech 26: 38–44). Nutzpflanzen werden zur Erzeugung dieser Polymere auch gentechnisch manipuliert, und sie bieten eine Kostenstruktur, die mit der der Pflanzenöle auf einer Linie liegt, sowie die Fähigkeit zum direkten preislichen Wettbewerb mit Polymeren auf Mineralölbasis (Williams und Peoples, 1996, Chemtech 26: 38–44). Herkömmlichere Ansätze für die Polymersynthese sind ebenfalls untersucht worden, einschließlich einer direkten Kondensations- und Ringöffnungspolymerisation der entsprechenden Lactone (Jesudason und Marchessault, 1994, Macromolecules 27: 2595–2602, US 5 286 842, US 5 563 239, US-Patent Nr. 5 516 883, US-Patent Nr. 5 461 139, Kanadische Patentanmeldung 2 006 508).

Die Synthese von PHA-Polymeren, die das Monomer 4-Hydroxybutyrat enthalten (PHB4HB, Doi, Y., 1995, Macromol. Symp. 98: 585–599), oder von PHA-Polyestern, die 4-Hydroxyvalerat und 4-Hydroxyhexanoat enthalten, wurde beschrieben (Valentin et al., 1992, Appl. Microbiol. Biotechnol. 36: 507-514 und Valentin et al., 1994, Appl. Microbiol. Biotechnol. 40: 710–716). Diese Polyester wurden unter Einsatz von Verfahren hergestellt, die den ursprünglich für PHBV beschriebenen ähnlich sind, bei denen die Mikroorganismen mit einem relativ teuren, nicht aus Kohlenhydrat bestehenden Ausgangsmaterial gefüttert wurden, um die Inkorporation des Monomers in den PHA-Polyester zu erzwingen. Zum Beispiel wurde die Bildung von PHB4HB durch das Füttern von Glucose und 4-Hydroxybutyrat oder eines Substrats, das in 4-Hydroxybutyrat überführt wird, an A. eutrophus erreicht (Kunioka, M., Nakamura, Y. und Doi, Y., 1988, Polym. Commun. 29: 174, Doi, Y., Segawa, A. und Kunioka, M., 1990, Int. J. Biol. Macromol. 12: 106, Nakamura, S, Doi, Y. und Scandola, M., 1992, Macromolecules 25: 423), A. latus (Hiramitsu, M., Koyama, N. und Doi, Y., 1993, Biotechnol. Lett. 15: 461), Pseudomonas acidovorans (Kimura, H., Yoshida, Y. und Doi, Y., 1992, Biotechnol. Lett. 14: 445) und Comomonas acidovorans (Saito, Y. und Doi, Y., 1994, Int. J. Biol. Macromol. 16: 18). Substrate, die in 4-Hydroxybutyrat überführt werden, sind 1,4-Butandiol, 1,6-Hexandiol, 1,8-Octandiol, 1,10-Decandiol, 1,12-Dodecandiol und 1,4-Butyrolacton. Die PHB4HB-Copolymere können mit unterschiedlichen Monomerzusammensetzungen erzeugt werden, die wiederum unterschiedliche Polymereigenschaften bereitstellen. Insbesondere sinkt, wenn die 4HB-Menge über 10 Gew.-% ansteigt, die Schmelztemperatur (Tm) auf unter 130°C, und die Dehnung beim Reißen steigt auf über 400% (Saito, Y., Nakamura, S., Hiramitsu, M. und Doi, Y., 1996, Polym. Int. 39: 169).

Die Bildung von 4HB-haltigen Polymeren wurde auch mit rekombinanten Stämmen in Studien untersucht, die auf eine verbesserte Bildung von PHB-4HB in Ralstonia eutropha oder E. coli abzielten. Es wurden Mutanten von R. eutropha H16 selektiert, die 4-Hydroxybutyrat nicht als Kohlenstoffquelle verwenden können. Wenn solche Mutanten bezüglich einer Bildung von Copolymeren getestet wurden, wurden bis zu 84% 4HB in das akkumulierte PHA inkorporiert (Kitamura, S. und Y. Doi, 1994, in Biodegradable Plastics and Polyesters, 12, S. 373–378). Durch die Einführung zusätzlicher Kopien der phb-Gene wurde die Akkumulation von PHB-4HB verstärkt (Lee, Y.-H., Park. J.-S. und Huh, T.-L., 1997, Biotechnol. Lett. 19: 771–774).

Es ist wünschenswert, kosteneffektivere Wege zur Erzeugung von 4HB-haltigen PHAs durch biologische Systeme zu entwickeln. Mehrere Faktoren sind für die ökonomische Erzeugung von PHA kritisch: die Kosten für das Substrat, die Fermentationszeit und dir Effizienz der Weiterverarbeitung. Eine generelle Eigenschaft der oben beschrieben Bakterien besteht darin, dass ihre Wachstumsgeschwindigkeit niedrig ist, dass sie oft schwer aufzubrechen sind, und dass sie nur begrenzt für genetische Manipulationen zugänglich sind. Deshalb wurden Prozesse entwickelt, die die ökonomische Erzeugung von PHAs über den Einsatz transgener Organismen verbessern. Die Bildung von PHB4HB wurde in E. coli über den Einsatz des 4-Hydroxybutyrat-Wegs von C. kluyveri erreicht (Hein, S., Söhling, B., Gottschalk, G. und Steinbüchel, A. 1997, FEMS Microbiol. Lett. 153: 411–418). In diesen Untersuchungen wurde sowohl die 4-Hydroxybutyryl-CoA-Transferase als auch die PHA-Synthase durch Plasmide codiert. Anschließende Arbeiten zeigten, dass der 4-Hydroxybutyrat-Weg von C. kluyveri die Bildung von PHB-4HB in E. coli in Mengen von bis zu 50% des Trockengewichts der Zellen aus Glucose als einziger Kohlenstoffquelle unterstützt, wobei 2,8% der Monomere 4HB sind. Das 4HB-Monomer in diesen Stämmen leitet sich höchstwahrscheinlich von Succinat ab, einem Zwischenprodukt des Zitronensäurecyclus (Valentin, H.E. und Dennis, D., 1997, J. Biotechnol. 58: 33–38). Diese Untersuchungen basierten auf Escherichia coli als rekombinantem Organismus für die Erzeugung und auf Genen der PHA-Biosynthese von PHA-Produzenten wie R. eutropha.

Es ist ein Ziel der vorliegenden Erfindung, rekombinante Prozesse bereitzustellen, durch die weitere Gene in transgene PHB-Erzeuger eingeführt werden können, um neue Stämme zu schaffen, die Monomere wie 4HB für alternative PHAs synthetisieren.

Ein weiteres Ziel der vorliegenden Erfindung besteht darin, Techniken und Verfahren für die Herstellung stabiler transgener Organismen bereitzustellen, die PHAs synthetisieren, die 4-Hydroxybutyrat entweder als einzigen Bestandteil oder als Comonomer enthalten.

Es ist auch ein Ziel der vorliegenden Erfindung, Systeme zum Screening auf neue, für die 4-Hydroxybutyryl-CoA-Transferase codierende Gene bereitzustellen.

Es ist ein weiteres Ziel der vorliegenden Erfindung, Techniken und Verfahren für die gentechnologische Konstruktion neuer Wege in biologischen Systemen für die endogene Synthese alternativer PHA-Monomere bereitzustellen.

Zusammenfassung der Erfindung

Es sind verbesserte Prozesse für die Produktion 4HB-haltiger PHAs über den Einsatz transgener Stämme entwickelt worden. Es werden transgene E.-coli-Stämme beschrieben, bei denen die erforderlichen phb-Gene in das Chromosom integriert wurden. Weitere Gene für die Synthese des 4HB-Monomers sind ebenfalls in das Chromosom integriert. Die letzteren Gene können aus vielen verschiedenen Organismen gewonnen werden, die eine 4-Hydroxybutyryl-CoA-Transferase enthalten, und sie können über das Screenen auf diese Aktivität in den hier beschriebenen genetisch manipulierten E.-coli-Stämmen identifiziert werden. Außerdem wird eine endogene E.-coli-Aktivität offenbart, die zur Erzielung von 4HB-CoA-Transferase-Aktivität weiter verbessert werden kann. Es werden auch neue Wege zur Bereitstellung von Zwischenprodukten der Biosynthesewege von 4HB, wie &agr;-Ketoglutarat und &ggr;-Aminobutyrat, offenbart. Die Vielfalt dieser Wege ist wichtig für die erfolgreiche Erzeugung von 4HB-haltigen PHAs aus billigen Kohlenstoffquellen, wie Zuckern und Fettsäuren.

Kurze Beschreibung der Zeichnungen

1A zeigt die Ausrichtung der OrfZ-Sequenz von C. kluyveri an der N-terminalen Sequenz und an internen Sequenzen der 4-Hydroxybutyryl-CoA-Transferase (4HBCT) von C. aminobutyricum (SEQ ID Nos. 1 und 2). Identische Reste sind gekennzeichnet, ähnliche Reste sind durch * gekennzeichnet. Die 1B und 1C zeigen die Nucleotidsequenz des orfZ-Gens von C. kluyveri. Die 1D zeigt die Aminosäuresequenz des orfZ-Gens von C. kluyveri.

2 ist eine schematische Darstellung der endogenen Synthese von 4-Hydroxybutyryl-CoA aus &agr;-Ketoglutarat über den GABA-Shunt. 1. &agr;-Ketoglutarataminotransferase, 2. Glutamatdecarboxylase, 3. GABA-Transaminase, 4. Succinsemialdehydreduktase, 5. 4-Hydroxybutyryl-CoA-Transferase.

3 ist eine schematische Darstellung der endogenen Synthese von 4-Hydroxybutyryl-CoA aus GABA-Vorläufern. GABA ist ein Zwischenprodukt des Abbaus von Aminosäuren wie Arginin, Glutamin und Prolin. Gene des Argininabbaus werden von speA, adi, speB, pat und prr codiert, Gene des Glutaminabbaus werden von gltBD und gadB codiert, Gene des Prolinabbaus werden von putA und gadB codiert. GABA wird durch die Genprodukte von gabT, 4hbD und hbcT in 4-Hydroxybutyryl-CoA überführt.

4 ist eine schematische Darstellung der endogenen Synthese von 4-Hydroxybutyryl-CoA aus Succinat. 1. Succinyl-CoA-CoA-transferase, 2. Succinsemialdehyddehydrogenase, 3. 4-Hydroxybutyratdehydrogenase, 4. 4-Hydroxybutyryl-CoA-Transferase.

5 ist eine schematische Darstellung der Konstruktion der Plasmide für die Integration des Gens der PHB-Synthase (phbC) von Z. ramigera in das Chromosom von E. coli und anderen gramnegativen Bakterien.

6 und 6A sind eine schematische Darstellung der Konstruktion von Plasmiden für die Integration der Gene der 3-Ketoacyl-CoA-Thiolase (phbA) und der Acetoacetyl-CoA-Reduktase (phbB) von Z. ramigera in das Chromosom von E. coli und anderen gramnegativen Bakterien.

7 ist eine schematische Darstellung des Metabolismus und der Genetik des gentechnisch manipulierten Biosynthesewegs für die 4-Hydroxybutyryl-CoA-Synthese. Die Genprodukte von gabT, 4hbD und hbcT werden für diesen Weg benötigt, gadAB und gdhA sind hilfreich, während die Genprodukte von aspC, sad und gabD vorzugsweise fehlen oder inaktiv sind.

8 ist eine schematische Darstellung der Konstruktion der Plasmide pMSX-TD und pMSXTp1-TD, das Enzyme exprimiert, die &agr;-Ketogtutarat in 4-Hydroxybutyryl-CoA überführen.

9 ist eine schematische Darstellung der Konstruktion der Plasmide pMSX-ABT, pMSXTp1-ABT und pMSXTp1-BT, das Enzyme exprimiert, die &agr;-Ketogtutarat in 4-Hydroxybutyryl-CoA überführen.

10 ist eine schematische Darstellung der Konstruktion der Plasmide pMSX-ABT und pMSX-ABT-TD, das Enzyme exprimiert, die &agr;-Ketogtutarat in 4-Hydroxybutyryl-CoA überführen.

11 ist eine schematische Darstellung der Konstruktion des Plasmids pMSX-T1DD, das Enzyme exprimiert, die Succinat in 4-Hydroxybutyryl-CoA überführen.

Detaillierte Beschreibung der Erfindung

Es sind die biologischen Mindestanforderungen bezüglich der Synthese von Poly(3-hydroxybutyrat-co-4-hydroxybutyrat) definiert worden. Die enzymatische Synthese der Substrate für die PHA-Synthase von R. eutropha wurde über die Inkubation äquimolarer Mengen von (R)-3-Hydroxybutyrat und 4-Hydroxybutyrat mit 4-Hydroxybutyrat-CoA-Transferase erreicht. Die In-situ-Synthese der Monomer-CoA-Verbindung gekoppelt mit der direkten enzymatischen Polymerisation führt zur Bildung eines PHB-4HB-Copolmers, wie über eine 1H-NMR-Analyse des resultierenden Polymers bestimmt wurde. Es wurden Techniken und Verfahren zur Konstruktion gentechnisch veränderter transgener Organismen entwickelt, die PHAs, die 4-Hydroxybutyrat entweder als einzigen Bestandteil oder als Comonomer enthalten, synthetisieren. In diesen Systemen ist der transgene Organismus entweder ein Bakterium, z.B. Escherichia coli, K. pneumoniae, Ralstonia eutropha (früher Alcaligenes eutrophus), Alcaligenes latus, oder ein anderer Mikroorganismus, der imstande ist, PHAs zu synthetisieren, oder eine höhere Pflanze oder eine Pflanzenkomponente, wie der Samen einer Ölpflanze (Brassica, Sonnenblume, Soja, Mais, Saflor, Flachs, Palme oder Kokosnuss), oder eine stärkeakkumulierende Pflanze (Kartoffel, Tapioka, Cassava). Es wurden ein Screeningverfahren zur Identifizierung von Genen, die für Enzyme codieren, die imstande sind, 4-Hydroxybuttersäure in 4-Hydroxybutyryl-CoA zu überführen, und Verfahren zum Umleiten des Flusses normaler zellulärer Metaboliten, z.B. von Bernsteinsäure und/oder Glutaminsäure, in 4-Hydroxybuttersäure entwickelt. Es wurde das für eine 4-Hydroxybutyryl-CoA-Transferase codierende Gen des grampositiven, strikt anaeroben Bakteriums Clostridium kluyveri identifiziert und dazu verwendet, diese Enzymaktivität in einem transgenen Organismus zu exprimieren, um 4-Hydroxybuttersäure in 4-Hydroxybutyryl-CoA zu überführen, was zur Akkumulation von Poly(4-hydroxybutyrat) in E. coli führt. Es werden ein Bakterium, das eine funktionelle PHA-Synthase von einem Transgen exprimiert, sowie Verfahren zur Expression dieser Gene in transgenen Nutzpflanzen beschrieben.

Systeme zum Screening auf neue, für die 4-Hydroxybutyryl-CoA-Transferase codierende Gene werden ebenfalls beschrieben. Es wurden transgene E.-coli-Stämme entwickelt, bei denen ein für die PHA-Synthase codierendes Gen in das Chromosom integriert ist und in einem Ausmaß exprimiert wird, das die PHA-Synthese unterstützt. Mit diesen transgenen Stämme kann mit genomischen Bibliotheken aus unterschiedlichen biologischen Quellen auf Aktivitäten gescreent werden, die alternative PHA-Vorläufer, wie 4-Hydroxybutyrat, in entsprechende Substrate für die PHA-Synthase überführen.

Es werden Techniken und Verfahren zur gentechnologischen Konstruktion neuer Wege für die endogene Synthese alternativer PHA-Monomere in biologischen Systemen bereitgestellt. Der Metabolismus eines beliebigen PHA-erzeugenden Organismus, einschließlich von Bakterien und Nutzpflanzen, kann durch ein metabolisches Engineering so umgeleitet werden, dass er spezifische Metaboliten für die PHA-Synthese liefert. Damit dieser Ansatz effektiv wird ist es erforderlich, neue biochemische Wege zu entwickeln, die von einem der üblichen metabolischen Zwischenprodukte zum gewünschten Monomer führen. Es ist nicht erforderlich, dass diese Wege in einem Organismus vorkommen, da die einzelnen Schritte bei der Erzeugung des gewählten Organismus über den Einsatz gentechnologischer Verfahren rekonstituiert werden können.

Die Inkorporation alternativer Monomere, die aus supplementierten Ausgangsmaterialien stammen, hat spezifische Nachteile. Erstens sind zusätzliche Einspeisungen in einen Fermenter kostspielig, da sie die Infrastruktur aufweiten und eine zusätzliche Qualitätskontrolle erforderlich machen. Zweitens muss die Zugabe der Monomervorläufer genau gesteuert werden, damit eine konstante Zusammensetzung der Monomerpools und der PHA-Zusammensetzung erreicht wird. Verfahren zur gentechnischen Manipulation von E. coli, so dass die Synthese von P(4HB) oder PHB-co-4HB ausgehend von kostengünstigen Kohlenhydratausgangsmaterialien, wie Glucose, Saccharose, Xylose und Lactose als einziger Kohlenstoffquelle, erfolgt. Enzymaktivitäten im 4-Hydroxybutyrat-Shunt werden erhöht, während Enzymaktivitäten, die Zwischenprodukte aus diesem Shunt abziehen, erniedrigt werden. Ein alternativer Weg führt zu 4HB aus Succinat. Einer ähnlicher Ansatz eines metabolischen Engineering kann die Erzeugung von 4HB-haltigen PHAs in Organismen wie A. eutrophus, A. latus und Comamonas, die derzeit imstande sind, 4-Hydroxybutyrat-Copolymere aus Cosubstraten zu erzeugen, unterbringen, sowie in Systemen aus transgenen Mikroorganismen und Kulturpflanzen, die eine PHA-Synthese von einem heterologen PHA-Synthase-Gen oder von heterologen PHA-Synthase-Genen exprimieren.

Es ist für eine effektive PHA-Synthese in rekombinanten E.-coli-Stämmen essentiell, dass die Expression aller am Weg beteiligten Gene adäquat ist. Um das zu erreichen können die interessierenden Gene von extrachromosomalen DNA-Molekülen, wie Plasmiden, exprimiert werden, was dann zu einem Kopienzahleffekt führt und dementsprechend zu hohen Expressionen, oder sie können, bevorzugter, vom Chromosom exprimiert werden. Für Fermentationen im großen Maßstab für Artikel vom Typ der Gebrauchsgüter ist allgemein bekannt, dass plasmidbasierte Systeme aufgrund der zusätzlichen Belastung, die Plasmide erhalten zu müssen, und wegen des Problems einer stabilen Expression unbefriedigend sind. Diese Nachteile können über den Einsatz chromosomal codierter Enzyme überwunden werden, indem die Signale für die Transkription und die Translation, die dem interessierenden Gen vorangehen, so verbessert werden, dass die Expression ausreichend ist und stabil erfolgt.

Produktion von 4HB-Copolymeren

Gerngross und Martin berichteten, dass für Substrate der PHA-Synthase das Vorhandensein einer Coenzym-A-Gruppe (CoA-Gruppe) erforderlich ist (Gerngross, T.U. und Martin, D.P. (1955) Proc. Natl. Acad. Sci. USA 92: 6279). Der für die Inkorporation von 4HB erforderliche Vorläufer ist deshalb 4HB-CoA. Zur Bestimmung der Mindestanforderungen bezüglich der Synthese von 4-Hydroxybutyrat-haltigen PHAs wurde eine Mischung von 4-Hydroxybutyrat, 3-Hydroxybutyrat, aus Clostridium acetobutylicum gereinigter 4-Hydroxybutyrat-CoA-Transferase (Willadsen und Buckel, FEMS Microbiol. Lett. (1990) 70: 187–192) und PHB-Synthase (gereinigt wie bei Gerngross et al. (1994), Biochemistry 33: 9311) in vitro unter Bedingungen inkubiert, wie sie bei Gerngross und Martin beschrieben wurden (Gerngross, T.U. und Martin, D.P. (1995), Proc. Natl. Acad. Sci. USA 92: 6279). Das Produkt der Reaktion wurde isoliert, und die Inkorporation von 4-Hydroxybutyrat wurde durch 1H-NMR bestätigt.

Durch das Etablieren der Mindestanforderungen bezüglich der Synthese von 4-Hydroxybutyrat-haltigem PHA in vitro wird klar, dass die Mindestanforderungen bezüglich der Synthese dieser PHAs in vivo ein Gen, das für eine 4-Hydroxybutyrat-CoA-Transferase oder eine ähnliche Aktivität codiert, und 4-Hydroxybutyrat umfassen. Das Substrat 4-Hydroxybutyrat kann dem PHA-erzeugenden Mikroorganismus zugeführt werden, oder es kann in vivo über gentechnologisch konstruierte Biosynthesewege aus geeigneten Substraten synthetisiert werden. Die Aminosäuresequenz der gereinigten 4-Hydroxybutyrat-CoA-Transferase wurde bestimmt (Scherf und Buckel, Appl. Environ. Microbiol. (1991) 57: 2699–2701). Das gereinigte Protein wurde einem enzymatischen Verdau gefolgt von einer Analyse der Aminosäuresequenz von dreien der resultierende Peptide unterzogen. Die Aminosäuresequenz dieser Peptide und der N-Terminus des intakten Proteins wiesen eine bemerkenswerte Homologie zum OrfZ-Genprodukt auf (1A, 1B, 1C und 1D), dessen Identität und Funktion nicht bekannt waren, wodurch orfZ als das Gen identifiziert wurde, das für die 4-Hydroxybutyryl-CoA-Transferase in C. kluyveri codiert. Dieses Gen wurde in hbcT umbenannt.

Die Bestätigung, dass die Einführung dieses Gens in einen E.-coli-Stamm, der die PHB-Synthase exprimiert, für die Synthese von 4-Hydroxybutyrat-haltigem PHA ausreicht, wurde wie folgt erhalten. Die PHB-Synthase von Z. ramigera wird von einer chromosomal integrierten Kopie dieses Gens im E.-coli-Stamm MBX379 exprimiert. Nach der Einführung eines für hbcT codierenden Plasmids und der Bereitstellung von 4-Hydroxybutyrat im Wachstumsmedium wurde in den Zellen PHA gebildet. In Abwesenheit von Genen, die andere Enzyme des PHB-Wegs bereitstellen, ist das akkumulierte PHA P4HB. Der E.-coli-Stamm MBX777 enthält die Gene, die für die &bgr;-Ketothiolase, die Acetoacetyl-CoA-Reduktase und die PHB-Synthase von Z. ramigera codieren. Nach der Einführung eines für hbcT codierenden Plasmids und der Bereitstellung von 4-Hydroxybutyrat im Wachstumsmedium wurde ein PHB-4HB-Copolymer gebildet.

Die weitere Entwicklung eines PHB-4HB-erzeugenden Systems wird erreicht über das genetische Manipulieren der Metabolismuswege des transgenen Organismus, so dass 4-Hydroxybutyrat aus endogenen Zwischenprodukte synthetisiert wird, statt dass es extern bereitgestellt wird. Zwei biochemische Wege zum Vorläufer 4HB-CoA können in einem Organismus für die Erzeugung von 4HB-haltigen PHAs etabliert werden. Der erste Weg geht von &agr;-Ketoglutarat aus, der zweite von Succinat. Substrate für beide Wege können auch über den Aminosäureabbau bereitgestellt werden.

Weg zu 4-Hydroxybutyryl-CoA ausgehend von &agr;-Ketoglutarat

Ein Weg, der die Überführung von &agr;-Ketoglutarat in 4-Hydroxybutyryl-CoA ermöglicht, ist in der 2 gezeigt. An diesem Weg beteiligte Enzyme sind die &agr;-Ketoglutarattransaminase, die Glutamatdehydrogenase, die Glutamatdecarboxylase, die 4-Hydroxybutyratdehydrogenase und die 4-Hydroxybutyrat-CoA-Transferase.

Gene, die für diese Aktivitäten codieren, können aus mehreren Quellen erhalten werden:

gdhA-Gen, codierend für die Glutamatdehydrogenase: E. coli (Valle et al., Gene (1984) 27: 193–199 und Valle et al., Gene (1983) 23: 199–209), Klebsiella aerogenes (Mountain et al., Mol. Gen. Genet. (1985) 199: 141–145), Pyrococcus furiosus (DiRuggiero et al., Appl. Environ. Microbiol. (1995) 61: 159–164, Eggen et al., Gene (1993) 132: 143–148), Sulfolobus shibatae (Benachenhou et al., (1994) Gene 140: 17–24), Rumonococcus flavefaciens (Duncan et al., Appl. Environ. Microbiol. (1992) 58: 4032–4037), Pseudomonas fluorescens (Miyamoto et al., J. Biochem. (1992) 112: 52–56), Clostridium symbiosum (Teller et al., Eur. J. Biochem. (1992) 206: 151–159), Synechocystis (Plant Mol. Biol. (1995) 28: 173–188), Corynebacterium glutamicum (Bormann et al., Mol. Microbiol. (1992) 6: 301–308), Peptostreptococcus asaccharolyticus (Snedecor et al., J. Bacteriol. (1991) 173: 6162–6167), Salmonella typhimurium (Miller et al., J. Bacteriol. (1984) 157: 171–178), Chlorella sorokiniana (Cock et al., Plant Mol. Biol. (1991) 17: 1023–144), Saccharomyces cerevisiae (Nagasu et al., Gene (1984) 37: 247–253), Neurospora crassa (Kinnaird et al., Gene (1983) 26: 253–260), Giardia lamblia (Yee et al. (1992) J. Biol. Chem. 267: 7539–7544).

gadA und/oder gadB, codierend für die Glutamat-Succinsemialdehydtransaminase: E. coli (Metzer und Halpern, J. Bacteriol. (1990) 172: 3250–3256 und Bartsch et al., J. Bacteriol. (1990) 172: 7035–7042) oder S. cerevisiae (Andre und Jauniaux, Nucl. Acid Res. (1990) 18: 3049).

4hbD-Gen, codierend für die 4-Hydroxybutyratdehydrogenase: C. kluyveri (Söhling und Gottschalk, J. Bacteriol. (1996) 178: 871–880).

4-Hydroxybutyryl-CoA-Transferase-Gen: C. aminobutyricum (Willadsen und Buckel, FEMS Microbiol. Lett. (1990) 70: 187–192) oder C. kluyveri (Söhling und Gottschalk, J. Bacteriol. (1996) 178: 871–880).

Zusätzlich zu den aufgeführten Mikroorganismen weitere Quellen für diese Gene, die aus Säugetieren oder Pflanzen stammen:

Glutamatdehydrogenase: (Syntichaki et al., (1996) Gene 168: 87–92), Mais (Sakakibara et al. (1995), Plant Cell Physiol. 36: 789–797), Mensch (Tzimagiogis et al. (1993), Hum. Genet. 91: 433–438), Maus (Tzimagiogis et al. (1991), Biochim. Biophys. Acta 1089: 250–253, Amuro et al. (1990), Biochim. Biophys. Acta 1049: 216–218).

&agr;-Ketoglutarattransaminase: (Park et al. (1993), J. Biol. Chem. 268: 7636–7639), Kwon et al. (1992), J. Biol. Chem. 267: 7215–7216), Ratte (Thakur et al. (1988), Biochem. Int. 16: 235–243), Kaninchen (Kirby et al. (1985), Biochem. J. 230: 481–488).

Glutamatdecarboxylase: Tomate (Gallego et al. (1995), Plant Mol. Biol. 27: 1143–1151), Mensch (Bu et al. (1994), Genomics 21: 222–228), Katze (Chu et al. (1994), Arch. Biochem. Biophys. 313: 287–295), Pflanze (Baum et al. (1993), J. Biol. Chem. 268: 19610–19617).

Die Regulation der Expression der Glutamatdehydrogenase wurde in erster Linie in E. coli untersucht. Das entsprechende gdhA-Gen wird in Glucose/Ammoniak-Minimalmedium hoch exprimiert und unterliegt einer mäßigen Katabolitenrepression. Überschüssiges Glutamat wird durch die Aspartataminotransferase (codiert durch aspC) abgebaut. Zwei REP-Sequenzen stromabwärts des Glutamatdehydrogenase-Gens sind an einer mRNA-Stabilisierung beteiligt. Das Glutamatdehydrogenase-Gen von P. fluorescens zeigt eine ähnliche Regulation durch Glucose. Die Glutamatdehydrogenase sowohl von P. furiosus als auch von C. glutamicum werden in E. coli exprimiert, weil sie eine gdhA-Mutation komplementieren.

Das gab-Gencluster wird aufgrund einer Katabolitenrepression durch Glucose und Ammoniak konstitutiv nur auf niedrigem Niveau exprimiert. Wenn eine schlechte Quelle für Stickstoff oder Succinat als Kohlenstoffquelle bereitgestellt wird, dann wird das Operon dereprimiert. So regulieren sowohl cAMP/CRP als auch NtrC den Promotor, zusätzlich zu einem spezifischen, von gabC codierten Repressor. Der Promotor, der gabT reguliert, ist stromaufwärts von gabD lokalisiert. Succinatsemialdehyddehydrogenasen werden durch gabD und sad codiert. Diese Aktivitäten könnten für eine Erzeugung von P4HB oder PHB-4HB schädlich sein, auch wenn zu erwarten ist, dass ihre Expression durch die Gegenwart ausreichender Glucose- und Stickstoffquellen reprimiert wird. Die Glutamatdecarboxylase ist bei den Enterobacteriacea ein seltenes Enzym. Es ist abhängig von Pyridoxalphosphat und wird bei niedrigem pH gut exprimiert.

Wege zu 4-Hydroxybutyryl-CoA ausgehend von Arginin, Putrescin, Glutamin und Prolin über GABA

Bakterien wie Escherichia coli sind imstande, wenigstens vier verschiedene Aminosäuren (Arginin, Prolin, Glutamin und Glutamat) unter Bildung von GABA abzubauen, das dann, wie oben beschrieben, in 4-Hydroxybutyryl-CoA überführt werden kann. Diese katabolischen Wege sind in der 3 dargestellt.

E. coli enthält wenigstens zwei Aktivitäten, codiert durch speA und adi, die Arginin zu Agmatin decarboxylieren können. Putrescin und Harnstoff werden aus Agmatin über die Wirkung der Agmatinureohydrolase, die durch speB codiert wird, gebildet. Putrescin gibt eine Aminogruppe an &agr;-Ketoglutarat ab, unter Bildung von 4-Aminobutyraldehyd und Glutamat, in einer Reaktion, die vom Produkt des pat-Gens, der Putrescinaminotransferase, katalysiert wird.

Der 4-Aminobutyraldehyd wird durch die von prr codierte Aminobutyraldehyddehydrogenase zu GABA oxidiert. Die Synthese der Agmatinureohydrolase, der Putrescinaminotransferase und der Aminobutyraldehyddehydrogenase wird zweifach gesteuert, über eine Katabolitenrepression und über die Stickstoffverfügbarkeit. Die Katabolitenrepression der Agmatinureohydrolase, aber nicht der Putrescinaminotransferase oder Aminobutyraldehyddehydrogenase, kann durch cAMP gemildert werden. Die Synthese der Agmatinureohydrolase wird durch Arginin und Agmatin induziert. Die Synthese der Arginindecarboxylase ist nicht gegenüber einer Katabolitenrepression oder einer Stimulation durch eine Stickstofflimitierung empfindlich, und sie unterliegt auch keiner Induktion durch das Substrat (Shaibe et al., J. Bacteriol. 163: 938, 1995). Es gibt eine zweite Arginindecarboxylase in E. coli, die anscheinend auf den Katabolismus und nicht auf die Biosynthese von Arginin spezialisiert ist, und dieses Protein wird durch das adi-Gen codiert (Stim und Bennett, J. Bacteriol. 175: 1221, 1993). Es wird unter Bedingungen eines sauren pH, einer Anaerobiose und eines reichhaltigen Mediums induziert.

Prolin wird in E. coli durch das Produkt des putA-Gens abgebaut, das aufeinanderfolgende Oxidationen von Prolin zu Pyrrolin-5-carboxylat und dann zu Glutamat katalysiert. Der erste Schritt ist FAD-abhängig, und somit ist das PutA-Protein membranassoziiert. Das gleiche Protein wirkt in Abwesenheit von Prolin auch als ein Repressor des put-Operons. Das put-Operon unterliegt einer Katabolitenrepression (McFall und Newman, S. 358–379 in Neidhardt, Hrsg., Escherichia coli and Salmonella typhimurium: cellular and molecular biology, ASM Press, Washington, D.C., 1996).

Glutamin wird in E. coli in Glutamat überführt durch die Glutamatsynthase, das Produkt der gltB- und gltD-Gene. Zwei Moleküle Glutamat werden durch die Abgabe einer Aminogruppe von Glutamin an &agr;-Ketoglutarat gebildet. Die Aktivität der Glutamatsynthase von E. coli ist hoch, wenn man diesen Organismus in ammoniakhaltigem Minimalmedium wachsen lässt, und niedrig, wenn man ihn in Gegenwart von Glutamat oder glutamatbildenden Stickstoffquellen, wenn Stickstoff limitierend ist, wachsen lässt (Reitzer, S. 391–407 in Neidhardt, Hrsg., Escherichia coli and Salmonella typhimurium: cellular and molecular biology, ASM Press, Washington, D.C., 1996).

Diese Wege können zur Erzeugung von Poly(4-hydroxybutyrat) in einem Organismus wie E. coli realisiert werden, indem man sich auf die dem Organismus eigenen Gene verlässt, oder indem man derartige Gene von einer anderen Quelle in den interessierenden Organismus importiert. Diese Gene können von vielen Organismen erhalten werden, zum Beispiel:

speA, codierend für die Arginindecarboxylase: Escherichia coli (Moore und Boyle, J. Bacteriol. 172:4631, 1990), Synechocystis sp. (Kaneko et al., DNA Res. 3: 109, 1996), Helicobacter pylori (Tomb et al., Nature 388: 539, 1997), Ackerwinde (Arabidopsis thaliana) (Watson et al., Plant Physiol. 114: 1569, 1997), Soja (Glycine max) (Nam et al., Plant Cell Physiol. 38: 1156, 1997), Gartennelke (Dianthus caryophyllus) (Chang et al., Plant Physiol. 112: 863, 1996), Erbse (Pisum sativum) (Perez-Amador et al., Plant Mol. Biol. 28: 997, 1995), Tomate (Lycopersicon esculentum) (Rastogi et al., Plant Physiol. 103: 829, 1993), Hafer (Avena sativa) (Bell und Malmberg, Mol. Gen. Genet. 224: 431, 1990), Pflanzen der Familie Brassicaceae (Barbarea vulgaris, Nasturtium officinale, Arabis drummondii, Aethionema grandiflora, Capsella bursa-pastoris, Arabidopsis arenosa, Sisymbrium altissimum, Thellungiella salsuginea, Polanisia dodecandra, Stanleya pinnata, Carica papaya, Brassica oleracea, Brassica nigra, Theobroma cacao) (Galloway et al., Mol. Biol. Evol. 15: 1998) und Ratte (Morrissey et al., Kidney Int. 47: 1458, 1995).

adi, codierend für die biodegradative Arginindecarboxylase: Escherichia coli (Stim und Bennett, J. Bacteriol. 175: 1221, 1993).

speB, codierend für die Agmatinureohydrolase: Escherichia coli (Szumanski und Boyle, J. Bacteriol. 172: 538, 1990), Streptomyces clavuligerus (Aidoo et al., Gene 147: 41, 1994), Bacillus subtilis (Presecan et al., Microbiology 143: 3313 1997), Synechocystis sp. (Kaneko et al., DNA Res. 3: 109, 1996), Methanobacterium thermoautotrophicum (Smith et al., J. Bacteriol. 179: 71–35, 1997), Archaeoglobus fulgidus (Klenk et al., Nature 390: 364, 1997).

pat, codierend für die Putrescinaminotransferase, und prr, codierend für die Aminobutyraldehyddehydrogenase: Escherichia coli (Shaibe et al., J. Bacteriol. 163: 938, 1985).

gltBD, codierend für die Glutamatsynthase: Escherichia coli (Oliver et al., Gene 60: 1 (1987), Aquifex aeolicus (Deckert et al., Nature 392: 353, 1998), Azospirillum brasilense (Pelanda et al., J. Biol. Chem. 268: 3099 1993), Luzerne (Medicago sativa) (Gregerson et al., Plant Cell 5: 215 1993), Bäckerhefe (Saccharomyces cerevisiae) (Filetici et al., Yeast 12: 1359, 1996, Cogoni et al., J. Bacteriol. 177: 792, 1995), Methanococcus jannaschii (Bult et al., Science 273: 1058, 1996), Methanobacterium thermoautotrophicum (Smith et al., J. Bacteriol. 179: 7135, 1997), Bacillus subtilis (Petit et al., Mol. Microbiol. 29:261, 1998), Azospirillum brasilense (Mandal und Ghosh, J. Bacteriol. 175: 8024 1993).

putA, codierend für die Pyrrolin-5-carboxylatreduktase: Streptomyces coelicolor (Redenbach et al., Mol. Microbiol. 21: 77, 1996), Mycobacterium tuberculosis (Cole et al., Nature 393: 537, 1998), Haemophilus influenzae (Fleischmann et al., Science 269: 496, 1995), Escherichia coli (Blattner et al., Science 277: 1453 1997), Bäckerhefe (Saccharomyces cerevisiae) (Science 265: 2077, 1994), Vibrio alginolyticus (Nakamura et al., Biochim. Biophys. Acta 1277: 201, 1996), Pseudomonas aeruginosa (Savoiz et al., Gene 86: 107, 1990), Klebsiella pneumoniae (Chen und Maloy, J. Bacteriol. 173: 783, 1991), Salmonella typhimurium (Allen et al., Nucleic Acids Res. 21: 1676, 1993), Agrobacterium tumefaciens (Cho et al., J. Bacteriol. 178: 1872, 1996), Sinorhizobium meliloti (Jimenez-Zurdo et al., Mol. Microbiol. 23: 85, 1997), Rhodobacter capsulatus (Keuntje et al., J. Bacteriol. 177: 6432, 1995), Bradyrhizobium japonicum (Straub et al., Appl. Environ. Microbiol. 62: 221, 1996), Synechocystis sp. (Kaneko et al., DNA Res. 3: 109, 1996), Shewanella sp. (Kato et al., J. Biochem. 120: 301, 1996), Photobacterium leiognathi (Lin et al., Biochem. Biophys. Res. Commun. 219: 868, 1996), Helicobacter pylori (Tomb et al., Nature 388: 539, 1997), gezüchtete Pilze (Agaricus bisporus) (Schaap et al., Appl. Environ. Microbiol. 63: 57, 1997), Soja (Glycine max) (Delauney und Verma, Mol. Gen. Genet: 221: 299, 1990) und Mensch (Homo sapiens) (Campbell et al., Hum. Genet. 101: 69, 1997).

Das Arginin, Prolin, Glutamin oder Glutamat kann dem Poly(4-hydroxybutyrat)erzeugenden Organismus exogen bereitgestellt werden, oder es kann im Wirt aus einer anderen Kohlenstoffquelle synthetisiert werden, vorzugsweise aus einer billigen wie Glucose. E. coli, zum Beispiel, synthetisiert alle dieser Verbindungen aus Glucose, aber generell nur in einer Menge, die für das Wachstum ausreicht.

Es wurden E.-coli-Stämme, die diese Verbindungen überproduzieren, entwickelt. Tujimoto et al. (US-Patent 5 378 616) beschreiben eine E.-coli-Mutante, die Glutamat akkumuliert. Momose et al. (US-Patent 4 430 430) beschreiben die Überexpression des argA-Gens in E. coli, die zur Akkumulation von Arginin führt. Prolin-resistente Mutanten von E. coli, die Gene der Prolinsynthese überexprimieren, können Prolin akkumulieren (Wang et al., Chin. J. Biotechnol. 6:27 1990). Für Tabakpflanzen, die bakterielle Gene der Prolinsynthese überexprimieren, wurde ebenfalls gezeigt, dass sie Prolin akkumulieren (Sokhansandzh et al., Genetika 33: 906, 1997). Außerdem akkumulieren E. coli und anderen Bakterien Glutamat, GABA und Prolin als Reaktion auf eine hohe Osmolalität des Mediums (McLaggan et al., J. Biol. Chem. 269: 1911, 1994, Measures, J.C., Nature 257: 398, 1975, Schleyer et al., Arch. Microbiol. 160: 424 1993, Botsford et al., Appl. Environ. Microbiol. 60: 2568, 1994).

Weg zu 4-Hydroxybutyryl-CoA ausgehend von Succinat

Der vollständige biochemische Weg zur Überführung von Succinat in 4HB-CoA (4) wurde für Clostridium kluyveri charakterisiert (Söhling und Gottschalk, 1993, Eur. J. Biochem. 212, 121–127, Wolff et al., 1993, Appl. Environ. Microbiol. 59, 1876–1882, Schert et al., 1994, Arch. Microbiol. 161: 239–245). Etwas später wurden die Gene identifiziert, die für die Succinyl-CoA:CoA-Transferase (cat1), die Succinatsemialdehyddehydrogenase (sucD) und die 4-Hydroxybutyratdehydrogenase (4hbD) von C. kluyveri codieren (Söhling und Gottschalk, 1996 J. Bacteriol. 178, 871–880). Diese Gene sind in einem zusammenhängenden DNA-Abschnitt auf dem Chromosom von C. kluyveri lokalisiert, und sie werden von drei Genen unbekannter Funktion (orfZ, orfY und sigL) flankiert. Es sieht so aus, dass die Gene durch Succinat im Wachstumsmedium induziert werden. Das Gen, das für die 4-Hydroxybutyryl-CoA-Transferase codiert, wurde in diesen Untersuchungen nicht identifiziert.

Identifizierung alternativer Gene, die für Enzyme codieren, die an der Synthese von 4-Hydroxybutyrat mitwirken

Alternative Gene, die für Enzyme codieren, die an der Überführung von entweder &agr;-Ketoglutarat oder Succinat in 4HB mitwirken, können über Komplementierungs- oder Expressionsuntersuchungen isoliert werden: Die Gene der Glutamat-Succinisemialdehydtransaminase können aus Genbibliotheken isoliert werden aufgrund der Fähigkeit dieses Gens, eine gabT-Mutation von E. coli zur Ausnützung von &ggr;-Aminobuttersäure als Stickstoffquelle zu komplementieren. Ähnlich können Mutationen der Gene der Glutamatdehydrogenase und der Glutamatdecarboxylase in E. coli komplementiert werden. Die Expression alternativer 4-Hydroxybutyratdehydrogenase-Gene ermöglicht es E. coli, 4-Hydroxybutyrat als Kohlenstoffquelle zu verwenden. Enzymhomologiesuchen mittels des BLASTP-Programms und der GenBank-Datenbank legen dias Vorkommen von Homologen der 4-Hydroxybutyratdehydrogenase im Genom von E. coli nahe. Diese Proteine wurden mit den Genetic Index Numbers gi | 1788795 und gi | 1790015 identifiziert

Bedeutung der Integration; Screenen auf eine Polymerproduktion

Für eine effiziente PHA-Produktion ist es wichtig, dass die Stämme während der Dauer der Inokulationsreihe und des Produktionslaufs nicht die Fähigkeit zur Synthese des Biopolymers verlieren. Der Verlust eines beliebigen der phb-Gene führt zum Verlust des Produkts, während der Verlust eines beliebigen der Gene, die neue Monomere bereitstellen, zur Bildung eines heterogenen Produkts führt. Beides ist unerwünscht, und es wird deshalb ein stabiles Wachstum des Stammes benötigt. Unglücklicherweise kommt es, wenn man das für die Transferase oder Synthese codierende Gen einfach integriert, nicht zu einer signifikanten Polymerbildung. Es ist erforderlich, die Enzymexpression über eine Veränderung der Promotorregion oder durch eine Mutagenese oder andere bekannte Techniken zu verstärken, gefolgt von einem Screenen auf eine Polymerbildung. Mittels dieser Techniken wurde bestimmt, dass die Integration der Gene in den Stämmen, die in den Beispielen beschrieben werden, für wenigstens 50 Generationen stabil war, was für eine Produktion in Behältern von 100 000 L ausreichend ist.

Das Wachstum und die Morphologie dieser rekombinanten PHA-Produzenten werden durch das Vorliegen der phb-Gene auf dem Chromosom nicht beeinträchtigt. Bei den Selektionsverfahren werden einzelne Integranten auf Platten mit Minimalmedium selektiert, wodurch die Isolierung auxotropher Stämme umgangen wird. Die Wachstumsgeschwindigkeiten der unterschiedlichen phb-Integranten waren denjenigen der E.-coli-Stämme vom Wildtyp, von denen die PHB-Produzenten abstammten, ähnlich. Das Hinzufügen der phb-Gene zum Chromosom von E. coli beeinflusste die Weiterverarbeitung dieser Stämme nicht, da sie mit herkömmlichen Verfahren immer noch leicht lysiert werden konnten.

Die vorliegende Erfindung wird durch die Bezugnahme auf die folgenden, nichteinschränkenden Beispiele noch klarer werden.

Beispiel 1: Minimalanforderungen für eine Synthese von PHB-4HB

Es wurde bereits früher gezeigt, dass die Minimalanforderungen für die Synthese von Poly-(R-3-hydroxybutyrat) (PHB) die gereinigte PHA-Synthase von A. eutrophus und das Substrat (R)-3-Hydroxybutyryl-CoA sind. 4-Hydroxybutyryl-CoA kann in situ aus Acetyl-CoA und 4-Hydroxybutyrat über eine Transthioveresterungsreaktion hergestellt werden, die durch das aus Clostridium aminobutyricum isolierte Enzym 4-Hydroxybutyryl-CoA-Transferase katalysiert wird. Dieses Enzym katalysiert auch die Bildung von (R)-3-Hydroxybutyryl-CoA aus der freien Säure und Acetyl-CoA. Somit würden die Minimalanforderungen für die In-situ-Synthese von 4-Hydroxybutyryl-CoA und seine Copolymerisation mit (R)-3-Hydroxybutyryl-CoA unter Bildung von P(3HB-co-4HB) die PHA-Synthase, (R)-3-Hydroxybuttersäure, 4-Hydroxybuttersäure, Acetyl-CoA und die 4-Hydroxybutyryl-CoA-Transferase in einer gepufferten wässrigen Lösung beinhalten. Das wurde wie folgt demonstriert:

Zu Kaliumphosphatpuffer (1 mL, 100 mM, pH 7,5) wurde das Folgende gegeben:

Acetyl-CoA (0,5 mL, 30 mM)

4-Hydoxybuttersäure, Natriumsalz (50 &mgr;L, 2 M)

(R)-3-Hydroxybuttersäure, Natriumsalz (100 &mgr;L, 1 M)

4-Hydroxybutyryl-CoA-transferase (10 mg, 25 Einheiten)

PHA-Synthase (0,05 mg)

Man ließ die Reaktionsmischung über Nacht bei Raumtemperatur stehen. Es wurde die Bildung unlöslicher PHA-Körnchen beobachtet. Das unlösliche Material wurde abzentrifugiert und gefriergetrocknet (0,65 mg). Dieses Material hatte eine klebrige Konsistenz. Das organische Material wurde mit CDCl3 extrahiert und mittels 1H-NMR analysiert. Die NMR-Analyse bestätigte die Bildung von Poly-((R)-3-hydroxybutyrat-co-4-hydroxybutyrat), das ungefähr 20% 4-Hydroxybuttersäure enthielt. Das NMR-Spektrum stimmt mit einem Spektrum von Poly-((R)-3-hydroxybutyrat-co-4-hydroxybutyrat) aus der Literatur überein (Doi, Y. et al., Macromolecules 1988, 21: 2722–2727).

Beispiel 2: Synthese von Poly(4-hydroxybutyrat) (P4HB) in E. coli über einen von einem Plasmid codierten Weg

Das hbcT-Gen von C. kluyveri wurde in E. coli mit Hilfe molekularbiologischer Standardtechniken exprimiert. Das Gen wird in einem geeigneten Vektor hinter einem starken Promotor angeordnet, und unter Bedingungen, die die Expression dieses Promotors antreiben, wird 4HBCT gebildet.

E.-coli-Stämme wurden mit dem Plasmid pFS30 versehen, das die Gene enthält, die für die 4-Hydroxybutyryl-CoA-Transferase von C. kluyveri und die PHB-Synthase von R. eutropha codieren. Von diesen Genen wird erwartet, dass sie 4-Hydroxybuttersäure in 4-Hydroxybutyryl-CoA überführen, das anschließend zu Poly(4-hydroxybutyrat) polymerisiert wird. Man ließ die Stämme in 250-mL-Erlenmeyerkolben wachsen, die 50 bis 100 mL 10%iges flüssiges LB-Medium mit 4-Hydroxybutyrat, allein oder in Kombination mit Glucose, als Kohlenstoffquelle enthielten. Die Kulturen wurden unter Schütteln mit 150 oder 200 Upm bei 30 bis 33°C inkubiert. Die Kulturen wurden nach 24 Stunden Inkubation geerntet und auf PHA analysiert. E. coli MBX1177 (eine Spontanmutante des Stammes DH5&agr;, die anhand ihres Wachstums auf 4HB-Minimalmedium selektiert worden war) mit pFS30 akkumuliert 67% des Trockengewichts der Zellen in Form eines P4HB-Homopolymers.

Beispiel 3: Synthese von Poly(4-hydroxybutyrat) (P4HB) in E. coli unter Einsatz einer plasmidcodierten PHA-Synthase

E.-coli-Stämme wurden mit dem Plasmid pFS16 versehen, das das Gen enthält, das für die 4-Hydroxybutyryl-CoA-Transferase von C. kluyveri codiert. Von diesem Gen wird erwartet, dass es 4-Hydroxybuttersäure in 4-Hydroxybutyryl-CoA überführt, das anschließend von einer chromosomal codierten PHB-Synthase zu P4HB polymerisiert wird. Man ließ die Stämme in 250-mL-Erlenmeyerkolben wachsen, die 50 bis 100 mL flüssiges 10%iges oder 100%iges LB-Medium mit 4-Hydroxybutyrat, allein oder in Kombination mit Glucose, als Kohlenstoffquelle enthielten. Die Kulturen wurden unter Schütteln mit 0 bis 250 Upm bei 32 bis 37°C inkubiert. Die Kulturen wurden nach 24 Stunden Inkubation geerntet und auf PHA analysiert. E. coli MBX769 mit pFS16 akkumuliert 67% des Trockengewichts der Zellen in Form eines P4HB-Homopolymers. Die Bildung von 4HB-haltigen PHAs hängt demnach nicht von einer plasmidcodierten PHB-Synthase ab.

Beispiel 4: Konstruktion von Plasmiden für die chromosomale Integration von phb-Genen

Das Plasmid pMUXC5cat enthält das phbC-Gen von Z. ramigera auf einem transponierbaren Element für die Integration dieses Gen in das Chromosom eines Empfängerstammes (5). Starke translationale Sequenzen wurden von pKPS4 erhalten, das phaC1, das für die PHA-Polymerase von P. oleovorans codiert, im pTrc-Vektor (Pharmacia) enthält. In diesem Konstrukt geht dem phaC1 eine starke Ribosomenbindungsstelle, AGGAGGTTTTT(-ATG), voran. Das phaC1-Gen, einschließlich der stromaufwärts liegenden Sequenzen, wurde als ein EcoRI-HindIII-Fragment mit stumpfen Enden in die SmaI-Stelle von pUC18Sfi kloniert, wodurch pMSXC3 erhalten wurde. Eine cat-Gen-Kassette mit stumpfen Enden wurde anschließend in die Sse8387II-Stelle mit stumpfen Enden kloniert, was zu pMSXC3cat führte. An diesem Punkt wurde der gesamte codierende Bereich von phaC1 mit Ausnahme der 27 5'-lokalisierten Basenpaare als ein PstI-BamHI-Fragment entfernt und durch das entsprechende Fragment des phbC-Gens von Z. ramigera ersetzt. Das resultierende Plasmid pMSXC5cat codiert für ein hybrides PHB-Polymerase-Enzym, bei dem die 9 aminoterminalen Reste von der PHA-Polymerase von P. oleovorans stammen und der Rest von Z. ramigera stammt. Die C5cat-Kassette wurde dann als ein AvrII-Fragment ausgeschnitten und in die entsprechenden Stellen von pUTHg kloniert, wodurch der Quecksilberresistenz-Marker dieses Vektors entfernt wurde. Das resultierende Plasmid, pMUXC5cat, enthält ein C5cat-Mini-Transposon, bei dem phbC keine Promotorsequenz vorausgeht. Die Expression der Kassette hängt nach der Integration somit von transkriptionellen Sequenzen ab, die durch die an die Integrationsstelle angrenzende DNA bereitgestellt werden.

pMSXTp1AB5kan2 wurde aus pMSXTp1kan wie folgt konstruiert (6 und 6A). Zuerst wurde pMSXTp1kan mit NdeI verdaut, mit Klenow aufgefüllt und erneut ligiert, wodurch pMSXTp1kan2 erhalten wurde, bei dem die NdeI-Stelle deletiert ist. Diese Deletion führt während späterer Schritte des Klonierungsverfahrens zu einer nur einmal vorkommenden NdeI-Stelle direkt stromaufwärts von phbA von Z. ramigera.

B5 wurde als ein NarI-Fragment von pZT1 kloniert und in die HincII-Stelle von pUC18Sfi kloniert, wodurch pMSXB5 erzeugt wurde. A5 wurde als an FseI/blunt-SalI-Fragment in die Ecl136II-SalI-Stellen eingefügt, was zu pMSXAB5 führte und den Zwischengenbereich AB5 von Z. ramigera wiederherstellte. pMSXAB5cat wurde durch das Einfügen einer promotorlosen cat-Kassette in die HindIII-Stelle von pMSXAB5 erzeugt. Das AB5-Fragment von pMSXAB5cat wurde als ein EcoRI-PstI-Fragment in die SmaI-Stelle of pMSXTp1kan2 kloniert, wodurch pMSXTp1AB5kan2 erhalten wurde.

Die Expression von phbAB5 wurde durch die Einführung eines starken Promotors stromaufwärts dieser Gene verbessert (6 und 6A). Dieser Promotor wurde mit Sets von Oligonucleotiden erzeugt, die stromaufwärts liegende aktivierende Sequenzen, eine –35-Promotorregion, eine –10-Promotorregion mit (einer) Startstelle(n) für die Transkription und mRNA-Sequenzen mit möglichen stabilisierenden Funktionen bereitstellen. Das Plasmid pMSXTp1AB5kan2 wurde mit PstI/XbaI verdaut, und ein Fragment, das die –10-Region des lac-Promotors enthielt, wurde als ein Fragment eingefügt, das erhalten wurde nach dem Hybridisieren der Oligonucleotide

3A (5'GGCTCGTATAATGTGTGGAGGGAGAACCGCCGGGCTCGCGCCGTT)

und

3B (5'CTAGAACGGCGCGAGCCCGGCGGTTCTCCCTCCACACATTATACGA GCCTGCA).

Als nächstes wurde ein Fragment, das eine Konsensus-E.-coli-pho-Box und eine –35-Promotorregion enthielt, in die PstI-Stelle als ein Fragment eingefügt, das erhalten wurde nach dem Hybridisieren der Oligonucleotide 2A (5'TCCCC TGTCATAAAGTTGTCACTGCA) und 2B (5'GTGACAACTTTATGACAGGGG ATGCA). Als nächstes wurde die die Messenger stabilisierende Sequenz, die die Startstelle für die Transkription von AB5 enthielt, in die XbaI-NdeI-Stellen als ein Fragment eingefügt, das erhalten wurde nach dem Hybridisieren der Oligonucleotide 4A (5'CTAGTGCCGGACCCGGTTCCAAGGCCGGCCGCAAGGCTGCCAGA ACTGAGGAAGCACA) und 4B:

(5'TATGTGCTTCCTCAGTTCTGGCAGCCTTGCGGCCGGCCTTGGAACCGGGTCCGGCA). Das resultierende Plasmid ist pMSXp12AB5kan2. Das AvrII-Fragment, das Tp12AB5kan2 enthielt, wurde in mit AvrII geschnittenes pUTHg kloniert und für die Integration in das Genom von MBX379 und MBX245 eingesetzt.

Die Expressionskassette p12AB5kan wurde dann als ein AvrII-Fragment von 2,8 kb ausgeschnitten, in die AvrII-Stelle von pUTHg ligiert und in den E.-coli-Stamm CC118 &lgr;pir transformiert, wodurch das Plasmid pMUXp12AB5kan erhalten wurde. Dieses Plasmid wurde dann in E. coli S17-1&lgr;pir transformiert und für das Einfügen der p12AB5kan-Expressionskassetten in das Chromosom von E.-coli-Stämmen über eine Konjugation eingesetzt (Herrero et al., J. Bacteriol. 1990, 172: 6557–6567).

Beispiel 5: Integration von phb-Genen in das Chromosom von E. coli Materialien und Methoden

Die E.-coli-Stämme ließ man in Luria-Bertani-Medium (Sambrook et al., 1992, Molecular Cloning, a laboratory manual, 2. Auflage, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York) bei 37°C oder 30°C oder in E2-Minimalmedium (Lageveen et al., Appl. Environ. Microbiol. 54: 2924–2932 (1988)) wachsen. Die Manipulationen der DNA wurden mit Plasmid-DNA und chromosomaler DNA durchgeführt, die mit dem Qiagen-Kit für die Plasmidpräparation oder dem Qiagen-Kit für die Präparation chromosomaler DNA entsprechend den Empfehlungen des Herstellers gereinigt wurden. Die DNA wurde mit Restriktionsenzymen entsprechend den Empfehlungen des Herstellers (New England Biolabs, Beverly, Massachusetts) verdaut. Die DNA-Fragmente wurden aus 0,7%igen Agarose-Tris/Acetat/EDTA-Gelen mittels eines Qiagen-Kits isoliert.

Plasmid-DNA wurde über eine Transformation oder Elektroporation in E.-coli-Zellen eingeführt (Sambrook et al., 1992, Molecular Cloning, a laboratory manual, 2. Auflage, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York). Die Transposition von phb-Genen von den pUT-Vektoren wurde durch das Paaren des Plasmid-Donorstammes und des Empfängers erreicht (Herrero et al., J. Bacteriol. (1990) 172:6557). Die eingesetzten Empfängerstämme waren Nalidixinsäure- oder Rifampicin-resistente Spontanmutanten von E. coli, die entweder von LS5218 oder MBX23 stammten. MBX23 ist LJ14 rpoS::Tn10, wobei das rpoS::Tn10-Allel über eine P1-Transduktion aus dem Stamm 1106 (Eisenstark) eingeführt wurde. Empfänger, bei denen phb-Gene in das Chromosom integriert wurden, wurden auf Nalidixinsäure- oder Rifampicinplatten selektiert, die mit dem Antibiotikum supplementiert waren, gegen das die Resistenz durch das Mini-Transposon bestimmt wurde, also Kanamycin oder Chloramphenicol. Oligonucleotide wurden von Biosynthesis oder Genesys bezogen. Die DNA-Sequenzen wurden durch automatisches Sequenzieren mit Hilfe einer Sequenzierapparatur ABI 373A von Perkin-Elmer bestimmt. Die DNA wurde über die Polymerase-Kettenreaktion in einem Volumen von 50 Mikrolitern mit Hilfe eines PCR-Mix von Gibco-BRL (Gaithersburg, Maryland) und einer Ericomp-Apparatur zur DNA-Amplifizierung amplifiziert.

Das akkumulierte PHB wurde mittels einer gaschromatographischen (GC) Analyse wie folgt bestimmt. Ungefähr 20 mg der lyophilisierten Zellmasse wurden einer gleichzeitigen dreistündigen Extraktion und Butanolyse bei 110°C in 2 mL einer Mischung unterzogen, die, in Volumeneinheiten, 90% 1-Butanol und 10% konzentrierte Salzsäure enthielt, wobei 2 mg/mL Benzoesäure als interner Standard zugesetzt wurden. Die wasserlöslichen Bestandteile der resultierenden Mischung wurden durch Extraktion mit 3 mL Wasser entfernt. Die organische Phase (1 &mgr;L in einem Splitverhältnis von 1:50 und einer Gesamtfließgeschwindigkeit von 2 mL/min) wurde auf einem HP-5890-GC mit FID-Detektor (Hewlett-Packard Co., Palo Alto, Kalifornien) unter Verwendung einer SPB-1-Kapillar-GC-Säule aus verschmolzenem Siliciumdioxid (30 m, Innendurchmesser 0,32 mm, Film von 0,25 &mgr;m; Supelco, Bellefonte, Pennsylvania) mit dem folgenden Temperaturprofil analysiert: 80°C, 2 min; mit 10°C pro min auf 250°C; 250°C, 2 min. Der zur Bestimmung der Anwesenheit von 4-Hydroxybutyrateinheiten im Polymer eingesetzte Standard war &ggr;-Butyrolacton, das, wie Poly(4-hydroxybutyrat), bei der Butanolyse n-Butyl-4-hydroxybutyrat bildet. Der zur Bestimmung der 3-Hydroxybutyrateinheiten im Polymer eingesetzte Standard war gereinigtes PHB.

Die Mutagenese mit 1-Methyl-3-nitro-1-nitrosoguanidin (NTG) erfolgte, wie es von Miller (A short course in bacterial genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York) beschrieben wurde, über eine 90minütige Behandlung mit 1 mg/mL NTG, was einer Letalität von 99% entsprach.

Ergebnisse

C5cat wurde in das Chromosom von MBX23 über eine Konjugation unter Verwendung von S17-1 &lgr;pir (pMUXC5cat) als Donorstamm eingeführt. Die Konjugationsmischung wurde auf LB/NI/Cm-Platten ausgebreitet, und es wurden Integranten erhalten, von denen 40% empfindlich gegen Ampicillin waren, was anzeigte, dass in diesen Stämmen kein Plasmid vorhanden war. Fünf Integranten wurden mit pMSXAB5cat (Apr) transformiert und zur Untersuchung der Biosyntheseaktivität der PHB-Polymerase auf LB/Ap/Cm/2% Glucose gezüchtet. MBX326 exprimierte die höchste Synthaseaktivität und wurde in weiteren Untersuchungen eingesetzt. Die Expression der PHB-Polymerase wurde durch das aufeinanderfolgende Ausstreichen von MBX326 auf LB-Platten, die 100, 200, 500 und 1000 &mgr;g/ml Chloramphenicol enthielten, erhöht. Der Stamm MBX379 leitet sich von MBX326 ab und ist gegen bis zu 1000 &mgr;g/ml Chloramphenicol resistent.

E. coli S17-1 &lgr;pir, die pMUXp12AB5kan enthielten, wurden mit MBX379 verpaart. Transgene Stämme, bei denen sich phbAB5kan in das Chromosom integriert hatte, wurden auf LB/NI/Km-Platten selektiert. Die PHB-Produzenten unter den Integranten wurden auf LB/Glucose-Platten identifiziert, und MBX677 (MBX379:: p12AB5kan) wurde für weitere Untersuchungen verwendet. Der PHB-Gehalt in diesem, in Luria-Bertani/2% Glucose-Medium gewachsenen Stamm lag bei 58%, während 38% PHB in mit 2% Glucose supplementiertem Minimalmedium akkumuliert wurden.

Beispiel 6: Mutagenese transgener E.-coli-Stämme für eine erhöhte PHB-Produktion

Es wurde eine Mutagenese mittels NTG oder EMS zur Verbesserung der PHB-Produktion in MBX680 eingesetzt. Die Stämme MBX769 und MBX777 wurden nach der Behandlung von MBX680 mit EMS bzw. NTG selektiert. Diese Stämme sind imstande, in mit 1% Glucose, 0,5% Corn Steep Liquor und 1 mg/mL Chloramphenicol versehenem R2-Medium zu wachsen. Man ließ MBX769 20 bis 26 Stunden in 50 mL R-10-Medium/0,5% CSL mit 2 oder 3% Glucose bei 37°C wachsen. PHB wurde bis auf einen Gehalt von 71% des Trockengewichts der Zellen akkumuliert. Ähnlich ließ man MBX769 in 50 mL LB mit oder ohne 0,375 g/L KH2PO4, 0,875 K2HPO4, 0,25 (NH4)SO4 und insgesamt 50 g/L Glucose (fünf Aliquots wurden im Verlauf der Inkubation zugegeben) wachsen. Nach 63 Stunden Inkubation war das PHB bis auf einen Gehalt von 96% des Trockengewichts der Zellen akkumuliert. Der PHB-Gehalt im in Luria-Bertani/2% Glucose-Medium gewachsenen Stamm MBX777 lag bei 67%, während in mit 2% Glucose supplementiertem Minimalmedium 57% PHB akkumuliert wurden.

Verbesserte transgene E.-coli-Stämme mit einem chromosomalen phbC-Gen wurden über eine P1- Transduktion des C5cat-Allels von MBX379 in LS5218, LS5218 fadAB101::Tn10 und LS5218 fadR+zcf117::Tn10 erhalten. Die resultierenden Stämme sind MBX816, MBX817 bzw. MBX821.

Beispiel 7: Synthese von Poly-(4-hydroxybutyrat) (P4HB) in E. coli mittels einer endogenen 4-Hydroxybutyryl-CoA-Transferase-Aktivität

E. coli enthält ein endogenes Gen, das für ein Enzym mit 4-Hydroxybutyryl-CoA-Transferase-Aktivität codiert. Man ließ die Stämme MBX821 und 1231 in 250-mL-Erlenmeyerkolben wachsen, die 50 bis 100 mL 10%iges flüssiges LB-Medium mit 4-Hydroxybutyrat, allein oder in Kombination mit Glucose, als Kohlenstoffquelle enthielten. MBX1231 ist eine Mutante von MBX821, die nach Behandlung mit 1-Methyl-3-nitro-1-nitrosoguanidin und Selektion auf Platten mit 500 &mgr;g/mL Chloramphenicol erhalten worden war. Die Kulturen wurden bei 32 bis 33°C unter Schütteln mit 200 Upm inkubiert. Die Kulturen wurden nach 24 Stunden Inkubation geerntet und bezüglich PHA analysiert. Die folgende Tabelle zeigt, dass diese Stämme ein P4HB-Homopolymer in einer Menge von 2,5 bis 3,5% des Trockengewichts der Zellen akkumulieren. Die P4HB-Bildung in diesem Stamm ist weder von einer plasmidcodierten PHB-Synthase noch von einer heterolog exprimierten 4-Hydroxybutyryl-CoA-Transferase abhängig. Wenn man diese Stämme auf festem Medium wachsen lässt, dann steigen die P4HB-Gehalte auf ungefähr 11%.

Beispiel 8: Ein Verfahren zum Screenen auf eine gegen Luft unempfindliche 4-Hydroxybutyryl-CoA-Transferase

Die 4-Hydroxybutyryl-CoA-Transferase von C. kluyveri wird offenbar durch Luft gehemmt, höchstwahrscheinlich durch Sauerstoff. Auf sauerstoffunempfindliche Mutanten kann man screenen, indem man Mutanten eines E.-coli-Stammes, der das für die 4-Hydroxybutyryl-CoA-Transferase codierende hbcT-Gen auf einem Plasmid und ein Gen der PHA-Synthase auf dem Chromosom enthält, für eine P4HB-Synthese unter guter Sauerstoffversorgung wachsen lässt und nach weißen Kolonien (die eine PHA-Akkumulation anzeigen) sucht, während der größte Teil der Population graue Kolonien bildet. Es wurden mittels dieses Verfahrens sauerstoffunempfindliche Stämme, MBX240 [pFS16], MBX379 [pFS16] und MBX830 [pFS16] identifiziert. Populationen von Mutanten können in vivo durch das Behandeln des Ausgangsstammes mit chemischen Mutagenen, wie N-Methyl-N'-nitro-N-nitrosoguanidin oder Ethylmethansulfonat, oder durch Bestrahlung mit ultraviolettem Licht erzeugt werden. Alternativ kann ein hbcT-enthaltendes Plasmid in vitro mit Hydroxylamin mutagenisiert werden. Dann werden die Mutanten, die eine funktionellele 4-Hydroxybutyryl-CoA-Transferase exprimieren, auf festem Medium oder in mit viel Sauerstoff versorgtem flüssigem Medium auf eine Bildung von P4HB aus 4-Hydroxybutyrat gescreent.

Beispiel 9: Ein Verfahren zum Screenen auf weitere Gene von E. coli, die für Enzyme der Biosynthese von 4-Hydroxybutyryl-CoA codieren

Die Expression der Enzymaktivität, die in MBX821 oder 1231 4HB in 4HB-CoA überführt, kann durch eine Mutagenese erhöht werden. Das Erscheinen von P4HB in MBX821 und 1231, die man auf festem Medium wachsen ließ, erforderte ungefähr 150 Stunden. Auf Mutanten mit verbesserten Eigenschaften hinsichtlich einer Akkumulation von P4HB kann nach einer Zufallsmutagenese dieser Stämme mit chemischen Mutagenen, wie N-Methyl-N'-nitro-N-nitrosoguanidin oder Ethylmethansulfonat, oder Bestrahlung mit ultraviolettem Licht gescreent werden. Die gewünschten Mutanten bilden innerhalb von 2 bis 5 Tagen Inkubation in Gegenwart von 4-Hydroxybutyrat weiße Kolonien.

Beispiel 10: Ein Verfahren zum Screenen auf andere Gene, die für Enzyme der Biosynthese von 4-Hydroxybutyryl-CoA codieren

Da Anwendungen, die Pflanzensysteme beinhalten, eine DNA mit einem hohen GC-Gehalt erfordern, müssen alternative Gene für die Biosynthese von 4-Hydroxybutyryl-CoA identifiziert und isoliert werden. Der niedrige GC-Gehalt des hbcT-Gens würde es zu einer nützlichen Sonde für die Identifizierung und Isolierung homologer Gene anderer Mikroorganismen, die eine AT-reiche DNA enthalten, machen. HbcT-Gene mit einem hohen GC-Gehalt werden mit diesem Verfahren jedoch nicht identifiziert. E.-coli-Stämme mit einem chromosomal integrierten, für die PHA-Synthase codierenden phbC-Gen können für das Screenen auf derartige Gene eingesetzt werden. Für Anwendungen, bei denen Gene in Pflanzen eingeführt werden, ist es erwünscht, DNA mit einem hohen GC-Gehalt einzusetzen (Perlak F.J. et al., Proc. Natl. Acad. Sci. USA (1991) 88: 3324). Wenn hbcT-Gene zum Beispiel in E. coli MBX379 exprimiert werden, dann ist dieser Stamm imstande, ein P4HB-Polymer auf Agarplatten zu produzieren, die zusätzlich zu den üblichen Nährstoffen 4-Hydroxybutyrat enthalten. Die Bildung von P4HB verleiht der Kolonie einen leicht erkennbaren weißen Phänotyp. Somit werden Genbibliotheken von PHB-co-4HB-produzierenden Organismen, wie R. eutropha, A. latus, P. acidovorans, C. testosteroni und anderen, in MBX379 oder ähnliche Stämme eingeführt und direkt auf 4HB-haltigem Wachstumsmedium ausplattiert. Es werden die weißen Kolonien ausgewählt, und es wird die Zusammensetzung des akkumulierten PHA bestimmt. Genbibliotheken können leicht aus den gewählten Organismen über das Isolieren genomischer DNA und das Klonieren einer repräsentativen Kollektion von DNA-Fragmenten in Plasmidvektoren konstruiert werden. Repräsentative Bibliotheken sollten 5 000 bis 100 000 einzelne Kolonien enthalten. Bibliotheken werden entweder als eine Bibliothek mit einem breiten Wirtsbereich in Vektoren wie pLAFR3 oder als E.-coli-Bibliotheken in Vektoren wie pUC19 und pBR322 hergestellt. In Abhängigkeit vom Typ der Bibliothek und dem Verfahren der Einführung der Bibliothek in den gewählten Wirt sind die Fragmente der genomischen DNA entweder groß (17–30 kb) oder relativ klein (2–6 kb). Bibliotheken werden, in Abhängigkeit vom Wirt und dem verwendeten Vektor, durch eine Elektroporation, Transformation oder Konjugation in die Screeningstämme eingeführt.

Zusätzlich zu alternativen 4-Hydroxybutyryl-CoA-Transferasen werden Acyl-CoA-Synthetasen, die imstande sind, 4-Hydroxybutyrat als Substrat zu verwenden, mittels dieses Verfahrens isoliert werden. Beispiele für Gene, die für Enzyme mit solchen generellen Aktivitäten codieren, sind fadD, das an der Aufnahme von Fettsäuren mit langen Seitenketten beteiligt ist, atoDA, das an der Aufnahme von Acetoacetat und Fettsäuren mit kurzen Seitenketten beteiligt ist, catE, das am Abbau von aromatischen Verbindungen beteiligt ist, aceAB, das für die Succinyl-CoA-Synthetase codiert, acsA und acsB, die für Acetyl-CoA-Synthetasen codieren und Homologe solcher Gene. Alternativ kann die Substratspezifität dieser Enzyme über die Einführung von Plasmiden mit zufällig mutagenisierten Acyl-CoA-Synthetase- oder Transferasegenen so verbreitert werden, dass 4-Hydroxybutyrat mit eingeschlossen ist. Alternativ kann das ygfH-Gen von E. coli, das eine signifikante Homologie mit dem hbcT-Gen von C. kluyveri aufweist, im Hinblick auf eine 4-Hydroxybutyryl-CoA-Aktivität untersucht werden.

Beispiel 11: Endogene Synthese von 4HB-CoA ausgehend von &agr;-Ketoglutarat

&agr;-Ketoglutarat ist ein zellulärer Metabolit, der in 4HB überführt werden kann, wie in der 7 gezeigt ist. Der Weg besteht aus einer zyklischen Reaktion, die durch die Produkte des gabT-, gadA/gadB- und gdhA-Gens katalysiert wird. Die Entstehung von Bernsteinsäuresemialdehyd durch diesen Zyklus ist begünstigt, wenn das Produkt durch die 4HB-Dehydrogenase und die 4HB-CoA-Transferase weiter in 4HB-CoA überführt und durch die PHA-Synthase zu einem PHA polymerisiert wird.

Für diesen Zweck wurden die folgenden Plasmide in pMSXcat konstruiert: 1. pMSX-TD hbcT-4hbD 2. pMSX-ABT gdhA-gadB-gabT 3. pMTX-DBTT 4hbD-gadB-gabT-hbcT 4. PMSX-ABTTD gdhA-gadA-gabT-hbcT-4hbD

1. 4hbD wurde erhalten von pCK3 mittels PCR unter Verwendung der Primer:

4HBD-N: 5'CTCTGAATTCAAGGAGGAAAAAATATGAAGTTATTAAAATTGGC (EcoRI)

4HBD-C: 5'TTTCTCTGAGCTCGGGATATTTAATGATTGTAGG (SacI).

Das PCR-Produkt wurde in pCR2.1 (pMBX-D) kloniert. HbcT wurde als ein SspI-EcoRI-Fragment von pCK3 kloniert und in mit EcoRV/EcoRI verdautes pMBX-D kloniert, wodurch pMBX-TD erhalten wurde. Das künstliche hbcT-4hbD-Operon wurde als ein NotI-KpnI-Fragment aus pMBX-TD ausgeschnitten und in diese Stellen in pUC18Sfi oder pMSX-TP1 (pMSX-TD bzw. pMSX-TP1TD) ligiert (8). Das TD- oder TP1TD-Fragment wurde als ein AvrII-Fragment ausgeschnitten und in AvrII-verdautes pUTkan (pMUX-TD und pMUX-TP1-TD) ligiert: Dieses Plasmid ermöglicht die zufällige Einfügung des TD/TP1-TD-Konstrukts in das Chromosom von E. coli. Die Expression des integrierten TD wird von einem endogenen Promotor angetrieben, während die Expression des integrierten TP1-TD von P1 angetrieben wird. Es wurden Rekombinanten selektiert, in die sich das Konstrukt integriert hatte, bezüglich ihrer Fähigkeit selektiert, auf 4-Hydroxybutyrat als einziger Kohlenstoffquelle wachsen zu können. Es war kein Market für eine Antibiotikumresistenz für das Selektieren der gewünschten Insertionen erforderlich.

Andere Gene, die für Enzyme codieren, die die Überführung von Succinsemialdehyd in 4-Hydroxybutyryl-CoA erleichtern, können routinemäßig über eine Komplementierung isoliert werden. Nach der Einführung von 4hbD-Homologen verleihen solche Gene Wildtyp-E.-coli-Stämmen die Fähigkeit, 4HB als einzige Kohlenstoffquelle zu verwenden.

2. Ein aus gdhA-gadA-gabT bestehendes Operon wurde im Plasmid pUC18Sfi erzeugt und mittels des pUTkan-Vektors in das Chromosom von E. coli eingefügt. Empfänger des Konstrukts wurden auf E2/Glycerol/&ggr;-Hydroxybutyrat/NI-Platten isoliert. Da der Empfängerstamm unfähig ist, &ggr;-Hydroxybutyrat als Stickstoffquelle zu verwenden (aufgrund einer gabT-Mutation), wachsen nur die Stämme, die das Operon exprimieren, auf diesem Medium.

Das gdhA-Gen wurde aus dem Chromosom von E. coli mittels PCR und der folgenden Primer erhalten:

GH-Up: 5'AACGAATTCAATTCAGGAGGTTTTTATGGATCAGACATATTCTCTGGAGTC (EcoRI)

GH-Dn: 5'TTGGGAGCTCTACAGTAAGAAATGCCGTTGG (SacI)

Das gadB-Gen wurde aus dem Chromosom von E. coli mittels PCR und der folgenden Primer erhalten:

GB-Up: 5'TAAGAGCTCAATTCAGGAGGTTTTTATGGATAAGAAGCAAGTAACGGATTT AAGG (SacI)

GB-Dn: 5'TTCCCGGGTTATCAGGTATGCTTGAAGCTGTTCTGTTGGGC (XmaI).

Das gabT-Gen wurde aus dem Chromosom von E. coli mittels PCR und der folgenden Primer erhalten:

GT-Up: 5'TCCGGATCCAATTCAGGAGGTTTTTATGAACAGCAATAAAGAGTTAATGCAG (BamHI)

GT-Dn: 5'GATTCTAGATAGGAGCGGCGCTACTGCTTCGCC (XbaI).

Die zur Konstruktion der obigen Primer verwendeten Informationen zur DNA-Sequenz stammten aus GenBank, Zugangsnummern K02499 (gdhA), M84025 und X71917 (gadB) und M88334 (gabT).

Die drei PCR-Produkte wurden mit den angegebenen Enzymen verdaut und nacheinander in den pUC18Sfi-Vektor kloniert (pMSX-ABT) (9). Das Operon wurde als ein EcoRI-SalI-Fragment ausgeschnitten und in pMSXTP1 kloniert (pMSX-TP1-ABT). Entweder das ABT- oder das TP1-ABT-Insert wurde auf 10 pUTkan verschoben, um das Einfügen des gdhA-gadA-gabT-Operons in das Chromosom einer gabT-Mutante von E. coli MBX245 zu ermöglichen. Erfolgreiche Insertionen wurden auf E2/Glycerol/&ggr;-Hydroxybutyrat/NI-Platten selektiert.

Da die Expression von gabT die Verwendung von &ggr;-Hydroxybutyrat als Stickstoffquelle ermöglicht, können Gene, die diese Funktion exprimieren, leicht auf Platten mit Minimalmedium, in dem &ggr;-Hydroxybutyrat als einzige Stickstoff dient, selektiert werden. Die Expression von gabT am Ende des Operons erfordert die Transkription der stromaufwärts liegenden Gene, für die keine direkte Selektion zur Verfügung steht.

Die Glutamatdehydrogenase fungiert in diesem Weg als eine Quelle zur Bereitstellung von Glutamat in katalytischen Mengen. Wenn genügend Glutamat vorhanden ist, kann es sein, dass keine weitere GdhA-Aktivität erforderlich ist, und die Inkorporation dieses Gens in die beschriebenen Konstrukte ist deshalb optional.

3. Die unter 1 und 2 beschriebenen Operons wurden wie folgt kombiniert: pMSX-TD wurde mit KpnI verdaut, mit T4-Polymerase behandelt und mit XhoI verdaut; pMSX-ABT oder pMSX-BT wurden mit HindIII verdaut, mit Klenow behandelt und mit SalI verdaut; das gereinigte TD-Fragment wurde anschließend in die präparierten Plasmide pMSX-ABT und pMSX-BT ligiert (9).

Beispiel 12: Endogene Synthese von 4HBCoA ausgehend von GABA-Vorläufern

Der verbreitete Metabolit GABA leitet sich von Glutamat ab und wird normalerweise im zentralen Stoffwechsel über Succinsemialdehyd zu Succinat metabolisiert. Es kann wünschenswert sein, die Wege zu GABA zu verbessern, um hohe Konzentrationen der Zwischenprodukte für die Bildung von P4HB zu erzielen. Neben der direkten Überführung von &agr;-Ketoglutarat in Glutamat durch die Glutamatdehydrogenase ist diese Überführung auch ein Bestandteil vieler Transaminierungsreaktionen, zum Beispiel mit Substraten wie Glutamin und anderen Aminosäuren, oder mit Putrescin. Rekombinante und mutierte Organismen, die Arginin (den Vorläufer von Putrescin), Glutamin oder Prolin überproduzieren, haben demnach erhöhte Gehalte an Glutamat und GABA, die mit gabT, 4hbD und hbcT wie oben beschrieben in 4HB-CoA überführt werden können (10).

Beispiel 13: Endogene Synthese von 4HBCoA ausgehend von Succinat

HbcT wird nicht für das Wachstum von E. coli auf 4-Hydroxybutyrat benötigt, wenn cat1, 4hbD und sucD eingeführt werden (Söhling und Gottschalk, 1996, J. Bacteriol. 178: 871–880), möglicherweise weil die Rückreaktion von SucD, 4HBD und Cat1 4HB in Succinat überführt, einen zentralen Metaboliten in E. coli. Im Prinzip ermöglichen diese Gene zusammen die Überführung von Succinat in 4HB. Der Weg, wie er in der 4 dargestellt ist, kann dann aus den Genen cat1, sucD, 4hbD und hbcT von C. kluyveri zusammengesetzt werden. Alternativ können diese Gene aus anderen Clostridium-Species, wie C. aminobutyricum, isoliert werden. E. coli hat zwar selbst eine Succinyl-CoA:CoA-Transferase (sucCD, Mat-Jan et al., Mol. Gen. Genet. (1989) 215: 276–280), aber es ist wünschenswert, dieses Gen aus einer anderen Quelle einzuführen, da diese Aktivität in E. coli nicht besonders ausgeprägt ist (Amarasingham und Davis, J. Biol. Chem. (1965) 240: 3664–3668). Alternativ kann die Expression des Gens von E. coli für die vorliegende Anwendung optimiert werden.

Es wurde ein aus hbcT-cat1-sucD-4hbD bestehendes Operon für die Integration in das Chromosom von E. coli konstruiert. Stämme, bei denen die Integration erfolgreich war, können auf 4HB wachsen, wenn 4hbD exprimiert wird (Söhling und Gottschalk, 1996, J. Bacteriol. 178: 871–880). Die Konstruktion dieses Operons erfolgte wie folgt (11):

Ein BamHI-PstI-Fragment von pCK3, das orfY, cat1, sucD und des 5'-Ende von 4hbD enthielt, wurde in die entsprechenden Stellen von pMSXcat ligiert (pMSX-Y1D). Das 4hbD-Gen wurde durch das Einfügen des PstI-SacI-Fragments von pMSX-D in PstI-SphI-verdautes pMSX-YID vervollständigt (pMSX-Y1DD). Dazu wurden beide Fragmente dieser Ligation nach den Verdauschritten mit SphI und SacI mit T4-Polymerase behandelt, um stumpfe Enden zu erzeugen, ehe ein weiterer Verdau mit PstI begonnen wurde. OrfY in pMSX-Y1DD wurde durch hbcT ersetzt, und zwar durch das Verdauen von pMSX-Y1DD mit BamHI und PacI, gefolgt von einem Versehen der Fragmente mit stumpfen Enden mit Hilfe von Klenow/T4-Polymerase und einer Dephosphorylierung, und die anschließende Ligation des mit SspI/EcoRI und Klenow behandelten hbcT-Fragments in diesen Vektor (pMSX-T1DD). Ein Fragment, das die regulatorischen Sequenzen, den Terminator und den Promotor bereitstellte, wurde als ein Fragment mit stumpfen Enden in die SmaI-Stelle von pMSX-T1DD eingefügt. Ein Integrationsplasmid für dieses Operon wurde konstruiert, indem das Insert von pMSX-T1DD als ein SfiI-Fragment in pUTkan kloniert wurde.

Beispiel 14: Verbesserte endogene Synthese von 4HBCoA

Um ein Abfließen von Zwischenprodukten dieser neuen Wege zu verhindern kann es wünschenswert sein, die Gene zu inaktivieren, die für die Aspartattransaminase (aspC) und die NADP- und NAD-abhängige Succinsemialdehyddehydrogenasen (sad und gabD) codieren. Mutationen in den einzelnen Genen wurden aus unterschiedlichen Quellen erhalten: Ein Stamm, der die aspC13I-Mutation enthält, wurde vom E. coli Genetic Stock Center als Stamm CGSC5799 erhalten. Das aspC-Gen wurde bei 21,1 min kartiert und ist deshalb mit dem Tn10 (Tc)-Marker in CAG12094 (zcc-282 bei 22,25 Minuten) oder CAG18478 (zbj-1230 bei 20,00 Minuten) und dem Tn10Km-Marker in CAG12130 (zcb-3111 bei 21,00 Minuten) verknüpft. Es sind keine Mutationen im gabD-Gen bekannt, und eine Deletion dieser Aktivität kann erreicht werden durch das Klonieren des Gens mittels PCR, das Einfügen eines genetischen Markers, wie einer Antibiotikumresistenz, die Integration unter Verwendung von recBC-Stämmen oder für diesen Zweck konstruierten Vektoren, wie pMAK705, und zuletzt eine Bakteriophagen-P1-Transduktion zur Übertragung des Gens in den gewünschten Wirt.

Beispiel 15: Expression einer PHA-Synthase und einer 4-Hydroxybutyryl-CoA-Transferase in Ölsamenpflanzen

Verfahren zur Identifizierung von Genen, die für Enzyme codieren, die 4-Hydroxybutyryl-CoA aus 4-Hydroxybuttersäure bilden können (d.h. die 4-Hydroxybutyryl-CoA-Transferase-Aktivität haben), und die in einer transgenen Pflanze, die ein PHA-Synthase-Transgen enthält, exprimiert werden können, wurden über Standardtechniken entwickelt. In bestimmten Fällen kann es auch nützlich sein, andere Gene der PHA-Biosythese, wie eine &bgr;-Ketothiolase und/oder eine Acetoacetyl-CoA-Reduktase, in der interessierenden Kulturpflanze zu exprimieren. Verfahren zur Expression eines PHA-Synthase-Transgens in einer Ölsamenpflanze wurden beschrieben (US 5 245 023 und US 5 250 430, US 5 502 273, US 5 534 432, US 5 602 321, US 5 610 041, US 5 650 555, US 5 663 063, WO 9100917, WO 9219747, WO 9302187, WO 9302194 und WO 9412014, Poirier et al., 1992, Science 256: 520–523, Williams und Peoples, 1996, Chemtech 26: 38–44), wobei alle diese Literaturstellen mit der entsprechenden Quellenangabe hier aufgenommen werden. Zur Erreichung dieses Ziels ist es erforderlich, ein Gen oder, im Falle einer PHA-Synthase mit mehr als einer Untereinheit, Gene, das bzw. die für eine PHA-Synthase eines Mikroorganismus codiert bzw. codieren, in Pflanzenzellen zu transferieren und ein geeignetes Ausmaß der Bildung des PHA-Synthase-Enzyms zu erhalten. Außerdem kann es erforderlich sein, weitere Gene der PHA-Biosynthese bereitzustellen, z.B. ein Acetoacetyl-CoA-Reduktase-Gen, ein 4-Hydroxybutyryl-CoA-Transferase-Gen oder andere Gene, die für Enzyme codieren, die für die Synthese der Substrate der PHA-Synthase-Enzyme benötigt werden. In vielen Fällen ist es wünschenswert, die Expression in unterschiedlichen Pflanzengeweben oder -organellen mittels Verfahren zu steuern, die Fachleuten auf diesem Gebiert bekannt sind (Gasser und Fraley, 1989, Science 244: 1293–1299, Gene Transfer to Plants (1995), Potrykus, I. und Spangenberg. G., Hrsg., Springer-Verlag Berlin Heidelberg New York, und "Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins" (1996), Owen, M.R.L. und Pen, J., Hrsg., John Wiley & Sons Ltd., England), wobei alle diese Literaturstellen mit der entsprechenden Quellenangabe hier aufgenommen werden. Das US-Patent Nr. 5 610 041 beschreibt die Expression in der Plastide über das Anfügen eines Leaderpeptids zur Lenkung des vom Kerngen exprimierten Proteins in die Plastide. Eine jüngere Technologie ermöglicht das direkte Einfügen fremder Gene direkt in das Plastidenchromosom über eine Rekombination (Svab et. al., 1990, Proc. Natl. Acad. Sci. USA 87: 8526–8530, McBride et. al., 1994, Proc. Natl. Acad Sci. USA 91: 7301–7305). Die prokaryotische Natur der RNA und der Proteinsynthesemaschinerie der Plastiden ermöglicht die Expression mikrobieller Operons, wie zum Beispiel des phbCAB-Operons von A. eutrophus. Diese Technologie ermöglicht die direkte Inkorporation einer Reihe von Genen, die für einen aus mehreren Enzymen zusammengesetzten Weg codieren, in das Plastidengenom. Es ist auch wichtig, die Bedeutung von 5'-untranslatierten Regionen der Plastidengene für die mRNA-Stabilität und die Translation zu berücksichtigen (Hauser et. al., 1996, J. Biol. Chem. 221: 1486–1497). In einigen Fällen kann es nützlich sein, die 5'-untranslatierten Regionen abzuändern, Elemente einer Sekundärstruktur zu entfernen oder Elemente von hochexprimierten Plastidengenen zur Maximierung der von einem Operon exprimierten Transgene anzufügen.


Anspruch[de]
Rekombinanter Wirtsmikroorganismus, der ein stabil in das Genom integriertes Gen enthält, das für ein heterologes Enzym codiert, das aus der Gruppe ausgewählt ist, die aus einer Polyhydroxyalkanoatsynthase und einer 4-HB-CoA-Transferase besteht. Wirt nach Anspruch 1, der sowohl ein Gen, das für eine Polyhydroxyalkanoatsynthase codiert, als auch ein Gen, das für eine 4-HB-CoA-Transferase codiert, stabil in sein Genom inkorporiert enthält. Wirt nach Anspruch 1, wobei der Wirt Escherichia coli, K. pneumonia, Ralstonia eutropha oder Alcaligenes lactus ist. Wirt nach Anspruch 1, wobei der Wirt Ralstonia eutropha ist. Wirt nach Anspruch 3, wobei der Wirt E. coli ist, das heterologe Enzym eine Polyhydroxyalkanoatsynthase ist und der Wirt ein endogenes Enzym mit 4-HB-CoA-Transferase-Aktivität exprimiert. Wirt nach Anspruch 1, wobei die Polyhydroxyalkanoatsynthase aus Ralstonia eutropha stammt. Wirt nach Anspruch 1, ferner Gene umfassend, die Enzyme exprimieren, die aus der Gruppe ausgewählt sind, die aus der &bgr;-Ketothiolase und der Acetoacetyl-CoA-Reduktase besteht. Verfahren zur Steigerung der Erzeugung von 4-HB-haltigen Polymeren in einem Wirtsmikroorganismus, wobei das Verfahren umfasst das stabile Inkorporieren eines Gens, das für ein heterologes Enzym codiert, das aus der Gruppe ausgewählt ist, die aus einer Polyhydroxyalkanoatsynthase und einer 4-HB-CoA-Transferase besteht, in das Genom des Wirtsmikroorganismus. Verfahren nach Anspruch 8, wobei der Wirtsmikroorganismus sowohl ein Gen, das für eine Polyhydroxyalkanoatsynthase codiert, als auch ein Gen, das für eine 4-HB-CoA-Transferase codiert, stabil in sein Genom inkorporiert enthält. Verfahren nach Anspruch 8, das ferner das Steigern der Expression des heterologen Enzyms durch das Mutieren des Wirts gefolgt von der Bereitstellung von 4-HB als Substrat und dem Screening auf eine Polymererzeugung durch den mutierten Wirt umfasst. Verfahren nach Anspruch 8, das ferner das Bereitstellen eines Wirts umfasst, der Enzyme exprimiert, die aus der Gruppe ausgewählt sind, die aus der &agr;-Ketoglutarattransaminase, der Glutamat-Succinsemialdehydtransaminase, der Glutamatdehydrogenase, der Glutamatdecarboxylase, der 4-Hydroxybutyratdehydrogenase und der 4-Hydroxybutyryl-CoA-Transferase besteht. Verfahren nach Anspruch 8, das ferner das Bereitstellen eines Wirts umfasst, der Enzyme exprimiert, die Arginin, Glutamin oder Prolin abbauen, um Gamma-Aminobuttersäure zu erzeugen. Verfahren nach Anspruch 8, das ferner das Bereitstellen eines Wirts umfasst, der Enzyme für die Umwandlung von Succinat in 4-HB-CoA exprimiert. Vektor, der ein isoliertes Gen umfasst, das für eine 4-HB-CoA-Transferase unter der Kontrolle eines Promotors codiert, zur Steigerung der Expression nach der Integration in das Genom eines heterologen Wirts. Verfahren zur Erzeugung eines 4-HB-haltigen Polymers, wobei das Verfahren das Wachsenlassen eines rekombinanten Wirts gemäß einem beliebigen der Ansprüche 1 bis 7 und das Gewinnen des 4-HB-haltigen Polymers umfasst. Verfahren nach Anspruch 15, wobei man den rekombinanten Wirt auf einem Ausgangsmaterial wachsen lässt, das Kohlenhydrate, Succinat, 4-Hydroxybutyrat, &agr;-Ketoglutarat oder Aminosäuren umfasst. Verfahren nach Anspruch 16, wobei man den rekombinanten Wirt auf einem Kohlenhydrat-Ausgangsmaterial wachsen lässt, das Glucose, Saccharose, Xylose oder Lactose als einzige Kohlenstoffquelle umfasst. Verfahren nach Anspruch 15, wobei man den rekombinanten Wirt in Gegenwart von Fettsäuren als Kohlenstoffquelle wachsen lässt.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com