PatentDe  


Dokumentenidentifikation DE69534849T2 21.12.2006
EP-Veröffentlichungsnummer 0000781327
Titel HERSTELLUNG VON HYDROXYLIERTEN FETTSÄUREN IN GENETISCH VERÄNDERTEN PFLANZEN
Anmelder Carnegie Institution of Washington, Washington, D.C., US;
Monsanto Co., Inc., St.Louis, Mo., US
Erfinder Carnegie Institution of Washington, Washington, D.C., US;
Monsanto Co., Inc., St.Louis, Mo., US
Vertreter Uexküll & Stolberg, 22607 Hamburg
DE-Aktenzeichen 69534849
Vertragsstaaten AT, BE, CH, DE, DK, ES, FR, GB, GR, IE, IT, LI, LU, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 25.09.1995
EP-Aktenzeichen 959344425
WO-Anmeldetag 25.09.1995
PCT-Aktenzeichen PCT/US95/11855
WO-Veröffentlichungsnummer 1996010075
WO-Veröffentlichungsdatum 04.04.1996
EP-Offenlegungsdatum 02.07.1997
EP date of grant 08.03.2006
Veröffentlichungstag im Patentblatt 21.12.2006
IPC-Hauptklasse C12N 9/10(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 15/63(2006.01)A, L, I, 20051017, B, H, EP   C12P 21/06(2006.01)A, L, I, 20051017, B, H, EP   A61K 38/51(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
TECHNISCHES GEBIET

Die vorliegende Erfindung betrifft die Identifizierung von Nukleinsäuresequenzen und Nukleinsäure-Konstrukten und damit in Verbindung stehende Verfahren, sowie die Verwendung dieser Sequenzen und Konstrukte, um genetisch modifizierte Pflanzen zum Zwecke der Veränderung der Fettsäurezusammensetzung von pflanzlichen Ölen, Wachsen und verwandten Verbindungen herzustellen.

DEFINITIONEN

Gegenstand dieser Erfindung ist eine Klasse von Enzymen, die eine Hydroxylgruppe in mehrere verschiedene Fettsäuren einbringen, was zur Herstellung von mehreren verschiedenen Arten von hydroxylierten Fettsäuren führt. Diese Enzyme katalysieren insbesondere die Hydroxylierung von Ölsäure zu 12-Hydroxyölsäure sowie die Hydroxylierung von Icosensäure zu 14-Hydroxyicosensäure. Andere Fettsäuren, wie Palmitoleinsäure oder Erucasäure können ebenfalls Substrate sein. Da es nicht möglich ist, sich auf dieses Enzym durch Hinweis auf ein einzelnes Substrat oder Produkt zu beziehen, wird im Rahmen dieser Anmeldung auf dieses Enzym als kappa-Hydroxylasen Bezug genommen, um klarzustellen, dass das Enzym das Hydroxyl drei Kohlenstoffatome distal (d.h. entfernt vom Carboxylkohlenstoff der Acylkette) von einer Doppelbindung einbringt, die in der Nähe des Zentrums der Acylkette lokalisiert ist.

Die folgenden Fettsäuren sind ebenfalls Gegenstand der Erfindung: Rizinolsäure, 12-Hydroxy-cis-9-octadecensäure (12OH-18:1cis&Dgr;9); Lesquerolsäure, 14-Hydroxy-cis-11-icosensäure (14OH-20:1cis&Dgr;11); Densipolsäure, 12-Hydroxy-cis-9,15-octadecadiensäure (12OH-18:2cis&Dgr;9,15); Auricolsäure, 14-Hydroxy-cis-11,17-icosadiensäure, (14OH-20:2cis&Dgr;11,17); Hydroxyerucasäure, 16-Hydroxy-cis-13-docosensäure (16OH-22:1cis&Dgr;13); Hydroxypalmitoleinsäure, 12-Hydroxy-cis-9-hexadecensäure (12OH-16:1cis&Dgr;9); Icosensäure (20:1cis&Dgr;11). Es wird angemerkt, dass Icosensäure in einigen Ländern Eicosensäure genannt wird.

HINTERGRUND

Ausführliche Analysen der Fettsäurezusammensetzung von Samenölen von verschiedenen Spezies höherer Pflanzen haben dazu geführt, dass mindestens 33 strukturell verschiedene monohydroxylierte Pflanzenfettsäuren und 12 verschiedene polyhydroxylierte Pflanzenfettsäuren identifiziert wurden, die von einer oder von mehreren Pflanzen-Spezies akkumuliert werden (Überblick in van de Loo et al., 1993). Rizinolsäure, der hauptsächliche Bestandteil des Samenöls der Rizinuspflanze Rizinus communis (L.), ist von kommerzieller Bedeutung. Es wurde eine Gen dieser Spezies kloniert, das für eine Fettsäure-Hydroxylase kodiert; dieses Gen wurde dazu verwendet, Rizinolsäure in transgenen Pflanzen einer anderen Spezies zu produzieren. Der wissenschaftliche Beweis, der die Behauptung stützt, wurde 1995 veröffentlicht. Gegenstand dieser Erfindung ist die Verwendung des Rizinus-Hydroxylase-Gens, um damit auch andere hydroxylierte Fettsäuren wie Lesquerolsäure, Densipolsäure, Hydroxypalmitoleinsäure, Hydroxyerucasäure und Auricolsäure in transgenen Pflanzen zu produzieren. Darüber hinaus ist die Identifizierung eines Gens, das für eine homologe Hydroxylase aus Lesquerella fendleri kodiert, sowie die Verwendung dieses Gens zur Herstellung dieser hydroxylierten Fettsäuren in transgenen Pflanzen ebenfalls Gegenstand dieser Erfindung.

Rizinus ist eine kleinere Ölsamenpflanze. Ungefähr 50 % des Samengewichtes besteht aus Öl (Triacylglycerol), in dem 85 bis 90 % der gesamten Fettsäuren aus der hydroxylierten Fettsäure Rizinolsäure bestehen. Öl, das aus Rizinus-Samen gepresst oder extrahiert wurde, hat zahlreiche industrielle Anwendungen, die auf den Eigenschaften basieren, welche von der hydroxylierten Fettsäure herrühren. Die wichtigsten Verwendungen sind die Herstellung von Farben und Lacken, Nylon-artigen synthetischen Polymeren, Harzen, Schmiermitteln und Kosmetika (Atsmon, 1989). Neben dem Öl enthält der Rizinus-Samen das extrem toxische Protein Rizin, allergene Proteine sowie das Alkaloid Rizinin. Diese Bestandteile schließen die Verwendung von unbehandeltem Samen-Mehl (nach Ölextraktion) als Viehfutter aus, was normalerweise eine wichtigen ökonomischen Aspekt der Ölsamenverwendung darstellt. Darüber hinaus hat Rizinus wegen der wechselhaften Beschaffenheit der Rizinuspflanzen und den fehlenden Aufwendungen bei der Züchtung nur wenige agronomisch vorteilhafte Eigenschaften. Aus der Gesamtschau dieser Gründe wird Rizinus in den Vereinigten Staaten nicht mehr angebaut; die Entwicklung einer alternativen, heimischen Bezugsquelle für hydroxylierte Fettsäuren wäre daher attraktiv. Die Herstellung von Rizinolsäure, dem wichtigen Bestandteil des Rizinusöls, in einer etablierten Ölsamenpflanze durch genetische Veränderung würde ein besonders wirksames Mittel zur Erzeugung einer heimischen Bezugsquelle darstellen.

Da es keine praktische Bezugsquelle für Lesquerolsäure, Densipolsäure und Auricolsäure aus Pflanzen gibt, die an moderne landwirtschaftliche Verfahren angepasst sind, werden diese Fettsäuren derzeit von der Industrie nicht im großen Maßstab verwendet. Die Fettsäuren würden jedoch ähnlich wie Rizinolsäure verwendet werden, wenn sie in größeren Mengen hergestellt werden könnten und zu Kosten, die denjenigen der anderen aus Pflanzen erhaltenen Fettsäuren ähneln (Smith, 1985). Pflanzen-Spezies, wie bestimmte Spezies der Gattung Lesquerella, die einen hohen Anteil dieser Fettsäuren akkumulieren, sind nicht domestiziert worden und werden gegenwärtig nicht als praktische Bezugsquelle für Fettsäuren in Betracht gezogen (Hirsinger, 1989). Diese Erfindung stellt einen nützlichen Schritt zur eventuellen Herstellung dieser und anderer hydroxylierter Fettsäuren in transgenen Pflanzen von landwirtschaftlicher Bedeutung dar.

Die taxonomischen Beziehungen zwischen Pflanzen mit ähnlichen oder identischen Arten von ungewöhnlichen Fettsäuren sind untersucht worden (van de Loo et al., 1993). In einigen Fällen treten bestimmte Fettsäuren vorwiegend oder ausschließlich in verwandten Taxa auf. In anderen Fällen scheint es keine direkte Verbindung zwischen taxonomischer Verwandtschaft und dem Auftreten von ungewöhnlichen Fettsäuren zu geben. In diesem Zusammenhang wurde kürzlich Rizinolsäure in 12 Gattungen aus 10 Familien identifiziert (zusammengefasst in van de Loo et al., 1993). Es scheint daher, dass die Fähigkeit zur Synthese hydroxylierter Fettsäuren während der Radiation der Angiospermen mehrere Male unabhängig aufgetreten ist. Dies deutete für uns darauf hin, dass die Enzyme, welche Hydroxyl-Gruppen in Fettsäuren einbringen, durch geringfügige Modifikationen eines verwandten Enzyms entstanden sind. Wie vorliegend tatsächlich gezeigt wird, ist die Sequenzähnlichkeit zwischen &Dgr;12-Fettsäure-Desaturasen und der kappa-Hydroxylase aus Rizinus so hoch, dass es auf Basis der Hinweise in der schriftlichen Literatur nicht möglich ist, eindeutig zu bestimmen, ob ein bestimmtes Enzym eine Desaturase oder eine Hydroxylase ist. Dementsprechend zeigt die Patentanmeldung (WO 94/11516), die behauptet, die Isolierung und Verwendung von &Dgr;12-Fettsäure-Desaturasen zu lehren, nicht, wie man zwischen einer Hydroxylase und einer Desaturase unterscheiden kann. Da es für die genetische Manipulation von Pflanzenölen wichtig ist, diese Aktivitäten unterscheiden zu können, ist die Brauchbarkeit dieser Anmeldung auf diejenigen Beispiele beschränkt, in denen ein direkter experimenteller Beweis (z.B. eine veränderte Fettsäurezusammensetzung in transgenen Pflanzen) geliefert wird, der die Zuweisung zu einer Funktion stützt. Ein Verfahren zur Unterscheidung zwischen Fettsäure-Desaturasen und Fettsäure-Hydroxylasen auf Basis der Aminosäuresequenz des Enzyms ist ebenfalls Gegenstand dieser Erfindung.

Ein Merkmal hydroxylierter oder anderer ungewöhnlicher Fettsäuren ist, dass sie im Allgemeinen auf Samen-Triacylglycerole beschränkt sind, die weitgehend von den polaren Lipiden durch unbekannte Mechanismen ausgeschlossen werden (Battey und Ohlrogge, 1989; Prasad et al., 1987). Dies ist sehr verblüffend, da Diacylglycerol sowohl ein Vorläufer für Triacylglycerol als auch für polare Lipide ist. Von Rizinus-Mikrosomen wurden einige Hinweise darauf erhalten, dass der Pool der Rizinoleoylenthaltenden polaren Lipiden durch eine Präferenz der Diacylglycerol-Acyltransferase für Rizinoleat-enthaltende Diacylglycerole minimiert ist (Bafor et al., 1991). Analysen von vegetativen Geweben haben zu einigen Berichten über ungewöhnliche Fettsäuren geführt, die sich von denen unterscheiden, die in der Cuticula (cuticle) auftreten. Die Cuticula enthält verschiedene hydroxylierte Fettsäuren, die miteinander verestert sind, wobei ein Polyester mit hohem Molekulargewicht gebildet wird, der strukturellen Aufgaben dient. Es gibt eine kleine Anzahl von anderen Ausnahmen, in denen ungewöhnliche Fettsäuren in nicht-Samengeweben vorgefunden werden.

Die Biosynthese von Rizinolsäure aus Ölsäure im sich entwickelnden Endosperm von Rizinus (Ricinus communis) wurde durch eine Vielzahl von Verfahren untersucht. Morris, (1967) zeigte in Doppel-Markierungsstudien, dass die Hydroxylierung unmittelbar durch Hydroxylsubstitution und nicht über einen ungesättigtes Intermediat, ein Keto-Intermediat oder ein Epoxy-Intermediat verläuft. Die Hydroxylierung unter Verwendung von Oleyl-CoA als Vorläufer kann in ungereinigten Präparationen oder Mikrosomen gezeigt werden, wobei jedoch die Aktivität in Mikrosomen nicht stabil und veränderlich ist, und die Isolierung von Mikrosomen einen beträchtlichen und zuweilen sogar vollständigen Verlust der Aktivität mit sich bringt (Galliard und Stumpf, 1966; Moreau und Stumpf, 1981). Ölsäure kann Oleyl-CoA als Vorläufer ersetzen, jedoch nur in Gegenwart von CoA, Mg2+ und ATP (Galliard und Stumpf, 1966), was darauf verweist, dass die Aktivierung zu einem Acyl-CoA notwendig ist. Es konnte jedoch keine Radioaktivität in Rizinoleoyl-CoA (Moreau und Stumpf, 1981) nachgewiesen werden. Diese und andere kürzlich gemachten Beobachtungen (Bafor et al., 1991) sind als Beleg interpretiert worden, dass das Substrat für die Rizinus-Oleat-Hydroxylase Ölsäure ist, die mit Phosphatidylcholin oder einem anderen Phospholipid verestert ist.

Die Hydroxylase ist empfindlich gegenüber Cyanid und Azid, und eine Dialyse gegen Metall-Chelatoren verringert die Aktivität, welche durch Zugabe von FeSO4 wieder hergestellt werden kann, was darauf verweist, dass Eisen an der Enzymaktivität beteiligt ist (Galliard und Stumpf, 1966). Die Synthese von Rizinolsäure erfordert molekularen Sauerstoff (Galliard und Stumpf, 1966; Moreau und Stumpf 1981) und NAD(P)H, um Cytochrom b5 zu reduzieren, von dem man annimmt, dass es sich um den intermediären Elektronendonor der Hydroxylasereaktion handelt (Smith et al., 1992). Kohlenstoffmonoxid inhibiert die Hydroxylierung nicht, was darauf verweist, dass Cytochrom P450 nicht beteiligt ist (Galliard und Stumpf, 1966; Moreau und Stumpf, 1981). Daten einer Untersuchung zur Substratspezifität der Hydroxylase zeigen, dass alle Substratparameter (d.h. Kettenlänge und Doppelbindungsposition in Bezug auf die beiden Enden) wichtig sind; Abweichungen hinsichtlich dieser Parametern verursachen eine relativ zur Ölsäure verringerte Aktivität (Howling et al., 1972). Die Position, an der das Hydroxyl eingebracht wurde, wurde jedoch durch den Teil mit der Doppelbindung bestimmt, und liegt immer 3 Kohlenstoffatome distal. Das Acyl-Hydroxylase-Enzym aus Rizinus kann somit abhängig von der Verfügbarkeit von Substanzen eine Familie von verschiedenen hydroxylierten Fettsäuren produzieren. Das Enzym wird daher der Einfachheit halber im Rahmen der vorliegenden Anmeldung als kappa-Hydroxylase bezeichnet (und nicht als Oleat-Hydroxylase), um auf die breite Substratspezifität zu verweisen.

Die kappa-Hydroxylase aus Rizinus weist zahlreiche oberflächliche Ähnlichkeiten mit den mikrosomalen Fettsäure-Desaturasen auf (Browse und Somerville, 1991). Pflanzen verfügen über eine mikrosomale Oleat-Desaturase, die an der Position &Dgr;12 aktiv ist. Das Substrat dieses Enzyms (Schmidt et al., 1993) und das Substrat der Hydroxylase (Bafor et al., 1991) scheint eine Fettsäure zu sein, die mit der sn-2-Position von Phosphatidylcholin verestert ist. Wenn Oleat das Substrat ist, tritt die Modifikation an derselben Position (&Dgr;12) in der Kohlenstoffkette auf und erfordert dieselben Cofaktoren, nämlich Elektronen von NADH über Cytochrom b5 und molekularen Sauerstoff. Keines der Enzyme wird durch Kohlenstoffmonoxid, dem charakteristischen Inhibitor der Cytochrom P450-Enzyme, inhibiert (Moreau und Stumpf, 1981).

Es scheint keine veröffentlichten biochemischen Studien über die Eigenschaften des Hydroxylase-Enzyms (der Hydroxylase-Enzyme) in Lesquerella zu geben.

WO-A-93/11245 und WO-A-94/11516 offenbaren eine Reihe von Nukleinsäurefragmenten, die für Fettsäure-Desaturasen oder für mit Fettsäure-Desaturasen verwandte Enzyme kodieren, zur Herstellung von transgenen Pflanzen, die in der Lage sind, Öle mit veränderten Mengen an ungesättigten Fettsäuren zu produzieren.

Konzeptionelle Basis der Erfindung

Ein cDNA-Klon aus Rizinus kann für die Herstellung von Rizinolsäure in transgenen Pflanzen verwendet werden. Wie oben erwähnt, haben biologische Untersuchungen anderer vorgeschlagen, dass die Rizinus-Hydroxylase keine strikte Spezifität für Ölsäure aufweisen könnte, sondern auch die Hydroxylierung anderer Fettsäuren, wie Icosensäure (20:1cis&Dgr;11) katalysieren könnte (Howling et al., 1972). Basierend auf diesen Studien würde man erwarten, dass die Expression der Rizinus-Hydroxylase in transgenen Pflanzen von Spezies wie Brassica napus und Arabidopsis thaliana, die Fettsäuren wie Icosensäure (20:1cis&Dgr;11) und Erucasäure (13-Docosensäure; 22:1cis&Dgr;13) akkumulieren, aufgrund der Aktivität der Hydroxylase gegenüber diesen Fettsäuren zur Akkumulierung einiger der hydroxylierten Derivate dieser Fettsäuren führt. Wir haben nunmehr einen weiteren direkten Beleg für eine solche Behauptung erhalten, wobei der Beleg auf der Produktion von Rizinol-, Lesquerol-, Densipol-, und Auricol-Fettsäure in transgenen Arabidopsis-Pflanzen basiert und vorliegend als Beispiel 1 eingefügt wurde.

Der Rizinus-Hydroxylase-Klon und die Rizinus-Hydroxylase-Sequenzen, die von diesem erhalten werden, könnten dazu verwendet werden, andere Hydroxylase-Klone von Pflanzen-Spezies wie Lesquerella fendleri zu erhalten, von denen bekannt ist, dass sie hydroxylierte Fettsäuren in Samenölen akkumulieren. Wir haben ein Beispiel für eine solche Verwendung zur Isolierung eines neuen Hydroxylase-Gens von Lesquerella fendleri bereitgestellt.

Im Hinblick auf den hohen Grad an Sequenzähnlichkeit zwischen &Dgr;12-Fettsäure-Denaturasen und der Rizinus-Hydroxylase (van de Loo et al., 1995) muss die Gültigkeit von Ansprüchen für die Verwendung von Desaturase- oder Hydroxylase-Genen oder davon abgeleiteten Sequenzen zur Identifizierung von Genen mit identischer Funktion aus anderen Arten mit Skepsis betrachtet werden. In dieser Anmeldung wird ein Verfahren gelehrt, durch das Hydroxylase-Gene von Desaturasen unterschieden werden können, und es werden Verfahren beschrieben, durch die &Dgr;12-Denaturasen durch Modifikation des Gens, welches für die Desaturasen kodiert, zu Hydroxylasen umgewandelt werden können. Eine mechanistische Basis für die ähnlichen Reaktionsmechanismen von Desaturasen und Hydroxylasen wurde in einer früheren Patentanmeldung dargestellt. Die vorliegenden Belege verweisen darauf, dass die Fettsäure-Desaturasen einen ähnlichen Reaktionsmechanismus wie das bakterielle Enzym Methan-Monooxygenase aufweisen, das eine Reaktion katalysiert, bei der es zu einem Transfer eines Sauerstoffatoms (CH4 → CH3OH) kommt (van de Loo et al., 1993). Der Cofaktor des Hydroxylase-Bestandteils der Methan-Monooxygenase wird als &mgr;-Oxo-verbrücktes Di-Eisencluster (FeOFe) bezeichnet. Die zwei Eisenatome des FeOFe-Clusters sind durch Stickstoff- oder Sauerstoffatome gebunden (liganded), die von Proteinen stammen, und sie sind über das kovalent-verbrückende Sauerstoffatom streng Redoxgekoppelt. Das FeOFe-Cluster akzeptiert zwei Elektronen, die es zum Di-Eisen (diferrous)-Zustand reduzieren, bevor die Bindung von Sauerstoff erfolgt. Bei der Bindung von Sauerstoff ist es wahrscheinlich, dass auch eine heterolytische Spaltung erfolgt, die zu einer hochvalenten Oxo-Eisen-reaktiven Spezies führt, welche durch Resonanz-Umlagerung stabilisiert wird, die in dem streng gekoppelten FeOFe-Cluster möglich sind. Der stabilisierte hochvalente Oxo-Eisen-Zustand der Methan-Monooxygenase ist in der Lage, Protonen von Methan zu extrahieren, gefolgt von einem Sauerstofftransfer, was zu Methanol führt. Es wurde gezeigt, dass der FeOFe-Cofaktor unmittelbar für die Fettsäuremodifikation bei Pflanzen relevant ist, indem gezeigt wurde, dass die Stearoyl-ACP-Desaturase aus Rizinus diese Art von Cofaktor enthält (Fox et al., 1993).

Auf Basis der obigen Überlegungen haben wir angenommen, dass die Rizinus-Oleat-Hydroxylase eine strukturell modifizierte Fettsäure-Desaturase ist, wobei dies auf drei Argumenten basiert. Das erste Argument betrifft die taxonomische Verteilung von Pflanzen, die Rizinolsäure enthalten. Rizinolsäure wird in 12 Gattungen von 10 Familien höherer Pflanzen gefunden (zusammengefasst in van de Loo et al., 1993). Daher werden Pflanzen, in denen Rizinolsäure auftritt, im gesamten Reich der Pflanzen gefunden, wobei jedoch nahe Verwandte dieser Pflanzen die ungewöhnliche Fettsäure nicht enthalten. Dieses Muster verweist darauf, dass die Fähigkeit Rizinolsäure zu synthetisieren, mehrere Male unabhängig entstanden ist (und verloren wurde) und somit eine recht kürzlich stattgefundene Verzweigung darstellt. Mit anderen Worten ist die Fähigkeit Rizinolsäure zu synthetisieren schnell entstanden, was darauf hindeutet, dass eine verhältnismäßig geringfügige genetische Änderung in der Struktur des Ausgangsenzyms notwendig war, um dies zu erreichen.

Das zweite Argument ist, dass zahlreiche biochemische Eigenschaften der kappa-Hydroxylase aus Rizinus denen von mikrosomalen Desaturasen ähneln, wie oben dargestellt wird (z.B. wirken beide bevorzugt auf Fettsäuren, die mit der sn-2-Position von Phosphatidylcholin verestert sind, beide verwenden Cytochrom b5 als intermediären Elektronendonor, beide werden durch Cyanid gehemmt, beide benötigen molekularen Sauerstoff als Substrat, von beiden wird angenommen, dass sie im endoplasmatischen Retikulum lokalisiert sind).

Das dritte Argument stammt aus der obigen Diskussion bezüglich der Oxygenase-Cofaktoren, in der vorgeschlagen wird, dass die Membran-gebundenen Fettsäure-Desaturasen aus Pflanzen einen &mgr;-Oxo-verbrückten Cofaktor vom Di-Eisen-Cluster-Typ aufweisen, und dass solche Cofaktoren in der Lage sind, sowohl die Fettsäure-Desaturierungen als auch die Fettsäure-Hydroxylierungen abhängig von den Elektronen- und Struktur-Eigenschaften des Aktivitätszentrums des Proteins zu katalysieren.

In der Zusammenschau dieser drei Argumente wurde angenommen, dass die kappa-Hydroxylase aus dem Endosperm von Rizinus homolog zu der mikrosomalen Oleat-&Dgr;12-Desaturase ist, die in allen Pflanzen gefunden wird. Der Beleg, der diese Hypothese unterstützt, ist offenbart worden.

Mehrere Gene, die für mikrosomale &Dgr;12-Desaturasen aus verschiedenen Spezies kodieren, sind kürzlich kloniert worden (Okuley at al., 1994), und wesentliche Informationen bezüglich der Struktur dieser Enzyme sind nunmehr bekannt. Somit wird in der folgenden Erfindung gezeigt, wie die strukturellen Informationen bezüglich der Fettsäure-Desaturasen zu verwenden sind, um kappa-Hydroxylase-Gene gemäß der Erfindung zu isolieren. Dieses Beispiel zeigt das Verfahren, durch das jedes Gen für eine Kohlenstoffmonoxid-insensitive pflanzliche Fettsäure-Hydroxylase durch den Fachmann identifiziert werden kann.

KURZE BESCHREIBUNG DER ERFINDUNG

Zusammenfassend gesagt stellt die vorliegende Erfindung ein isoliertes Nukleinsäurefragment bereit, das eine Nukleinsäuresequenz umfasst, welche für eine Fettsäure-Hydroxylase mit einer Aminosäure-Identität von 60 % oder mehr in Bezug auf die in SEQ ID NO: 4 dargestellte Aminosäuresequenz kodiert.

Die Aminosäuresequenz-Identität ist vorzugsweise 90 % oder mehr in Bezug auf die SEQ ID NO: 4 dargestellte Aminosäuresequenz.

Eine solche Aminosäure-Identität kann 100 % betragen.

Die Erfindung umfasst ein isoliertes Nukleinsäurefragment, das für ein Polypeptid kodiert, welches Fettsäure-Hydroxylase-Aktivität aufweist und eine Nukleinsäuresequenz-Identität von 90 % oder mehr (wahlweise 100 %) in Bezug auf die in SEQ ID NO: 1, 2 oder 3 dargestellte Nukleotidsequenz aufweist.

Bei dem isolierten Nukleinsäurefragment kann es sich um ein solches handeln, das aus einer Öl-produzierenden Pflanzen-Spezies isoliert ist.

Die Erfindung umfasst ein chimäres Gen, das in der Lage ist, veränderte Mengen Rizinolsäure in einer transformierten Pflanzenzelle zu bewirken, wobei das chimäre Gen ein wie oben beschriebenes erfindungsgemäßes Nukleinsäurefragment umfasst, wobei das Fragment in funktionsfähiger Weise mit geeigneten regulatorischen Sequenzen verknüpft ist.

Die Erfindung umfasst ein chimäres Gen, das in der Lage ist, veränderte Mengen Lesquerolsäure in einer transformierten Pflanzenzelle zu bewirken, wobei das chimäre Gen ein wie oben beschriebenes erfindungsgemäßes Nukleinsäurefragment umfasst, wobei das Fragment in funktionsfähiger Weise mit geeigneten regulatorischen Sequenzen verknüpft ist.

Die Erfindung umfasst ein chimäres Gen, das in der Lage ist, veränderte Mengen an Fettsäuren in einer transformierten Pflanzenzelle zu bewirken, wobei das chimäre Gen ein wie oben beschriebenes erfindungsgemäßes Nukleinsäurefragment umfasst, wobei das Fragment in funktionsfähiger Weise mit geeigneten regulatorischen Sequenzen verknüpft ist.

Die Erfindung umfasst Pflanzen, die irgendeines dieser chimären Gene umfassen, z.B. Raps, Crambe, Brassica juncea, Brassica nigra, Sumpfblume, Flachs, Sonnenblume, Distel, Baumwolle, Cuphea, Sojabohne, Erdnuss, Kokosnuss, Ölpalme oder Mais.

Bei dem erfindungsgemäßen isolierten Nukleinsäurefragment kann es sich um ein solches handeln, das von Ricinus communis (L.) (Rizinus) erhältlich ist.

Die Erfindung umfasst ein Verfahren zur Herstellung von Samenöl, das veränderte Mengen an hydroxylierten Fettsäuren enthält, bei dem man:

  • (a) eine Pflanzenzelle einer Öl-produzierenden Spezies mit einem chimären Gen transformiert, das eine wie oben beschriebene erfindungsgemäße isolierte Nukleinsäure enthält;
  • (b) ausgehend von den transformierten Pflanzenzellen von Schritt (a) fertile Pflanzen anzüchtet;
  • (c) Nachkommen-Samen von den fertilen Pflanzen von Schritt (b) auf die gewünschten Mengen hydroxylierter Fettsäuren untersucht; und
  • (d) die Nachkommen-Samen von Schritt (c) weiterverarbeitet, um Samenöl zu erhalten, das veränderte Mengen ungesättigter Fettsäuren enthält.

Die Nutzpflanze kann ausgewählt sein aus der Gruppe bestehend aus Raps, Crambe, Brassica juncea, Canola, Flachs, Sonnenblume, Distel, Baumwolle, Cuphea, Sojabohne, Erdnuss, Kokosnuss, Ölpalme und Mais.

Die Erfindung umfasst ein Triglyceridöl aus einer Pflanze, die ausgewählt ist aus der Gruppe bestehend aus Raps, Crambe, Brassica juncea, Canola, Flachs, Sonnenblume, Distel, Baumwolle, Cuphea, Sojabohne, Erdnuss, Kokosnuss, Ölpalme oder Mais, wobei die Fettsäurezusammensetzung des Öls dahingehend modifiziert wurde, dass sie hydroxylierte Fettsäuren enthält, durch ein Verfahren, bei dem man eine Pflanzenzelle, die ein in ihr Genom integriertes DNA-Konstrukt aufweist, welches eine für eine Hydroxylase kodierende Sequenz gemäß der vorliegenden Erfindung umfasst, unter Bedingungen anzüchtet, die die Transkription und Translation der besagten Pflanzen-Hydroxylase in den Pflanzenzellen erlauben.

Die Erfindung umfasst ein Verfahren zur Isolierung von Nukleinsäurefragmenten, die für eine Fettsäure-Hydroxylase kodieren, bei dem man:

  • (a) SEQ ID NO: 4 und andere Fettsäure-Hydroxylase-Sequenzen und Fettsäure-Desaturasen vergleicht;
  • (b) konservierte Sequenzen von 4 oder mehr Aminosäuren, die in Schritt (a) erhalten werden, identifiziert;
  • (c) auf Basis der in Schritt (b) identifizierten, konservierten Sequenzen degenerierte Oligomere erstellt;
  • (d) die degenerierten Oligomere von Schritt (c) verwendet, um durch Sequenz-abhängige Methoden Sequenzen zu isolieren, die für Fettsäure-Hydroxylasen kodieren;
  • (e) ausgehend von der Nukleotidsequenz des Gens die abgeleitete Aminosäuresequenz des kodierten Genprodukts erhält; und
  • (f) durch Analyse von Aminosäuresequenz-Unterschieden zwischen Fettsäure-Desaturasen und Fettsäure-Hydroxylasen Hydroxylase-Gene von einem Desaturase-Gen unterscheidet.

KURZE BESCHREIBUNG DER ZEICHNUNGEN

Die 1A–D zeigen die Massenspektren von Hydroxyfettsäure-Standards (1A, O-TMS-Methyl-Rizinoleat; 1B, O-TMS-Methyl-Densipoleat; 1C, O-TMS-Methyl-Lesqueroleat; und 1D, O-TMS-Methyl-Auricoleat.

2 zeigt das Fragmentierungsmuster von Trimethylsilylierten Methylestern von Hydroxyfettsäuren.

3A zeigt das Gaschromatogramm von Fettsäuren, die aus Samen von Wildtyp-Arabidopsis-Pflanzen extrahiert wurden. 3B zeigt das Gaschromatogramm von Fettsäuren, die aus Samen von transgenen Arabidopsis-Pflanzen extrahiert wurden, die das fah12-Hydroxylase-Gen enthielten. Die Zahlen verweisen auf die folgenden Fettsäuren: [1] 16:0; [2] 18:0; [3] 18:1cis&Dgr;9; [4] 18:2cis&Dgr;9,12; [5] 20:0; [6] 20:1cis&Dgr;11; [7] 18:3cis&Dgr;9,12,15; [8] 22:1cis&Dgr;13; m [9] 24:1cis&Dgr;13; [10] Rizinolsäure [11] Densipolsäu re, [12] Lesquerolsäure; [13] Auricolsäure.

Die 4A–D zeigen die Massenspektren von neuen Fettsäuren, die in Samen von transgenen Pflanzen gefunden wurden. 4A zeigt das Massenspektrum des Peaks 10 aus 3B. 4B zeigt das Massenspektrum des Peaks 11 aus 3B. 4C zeigt das Massenspektrum von Peak 12 aus 3B. 4D zeigt das Massenspektrum von Peak 14 aus 3B.

5 zeigt die Nukleotidsequenz von pLesg2 (SEQ ID NO: 1).

6 zeigt die Nukleotidsequenz von pLesg3 (SEQ ID NO: 2).

7 zeigt einen Northernblot von Gesamt-RNA aus Samen von L. fendleri, die mit pLesq2 oder pLesq3 als Sonde untersucht wurden. S verweist darauf, dass die RNA aus Samen stammt; L verweist darauf, dass die RNA aus Blättern stammt.

Die 8A–B zeigen die Nukleotidsequenz eines genomischen Klons, der für pLesq-HYD (SEQ ID NO: 3) kodiert sowie die davon abgeleitete Aminosäuresequenz des Hydroxylase-Enzyms, das durch dieses Gen kodiert wird (SEQ ID NO: 4).

Die 9A–B zeigen verschiedene Sequenz-Alignments von abgeleiteten Aminosäuresequenzen für kappa-Hydroxylasen und mikrosomale &Dgr;12-Desaturasen. Die Abkürzungen sind die Folgenden: Rcfah12, fah12, Hydroxylase-Gen aus R. communis (van de Loo et al., 1995); lffah12, kappa-Hydroxylase-Gen aus L. fendleri; Atfad2, fad2, Desaturase aus Arabidopsis thaliana (Okuley et al., 1994); Gmfad2-1, fad2 Desaturase aus Glycine max (GenBank Zugriffsnummer L43920); Gmfad2-2, fad2 Desaturase aus Glycine max (GenBank Zugriffsnummer L43921); Zmfad2, fad2 Desaturase aus Zea mays (WO 94/11516); Rcfad2, Fragment der fad2 Desaturase aus R. communis (WO 94/11516); Bnfad2, fad2 Desaturase aus Brassica napus (WO 94/11516); LFFAH12.AMI, SEQ ID NO: 4; FAH12.AMI, SEQ ID NO: 5; ATFAC2.AMI, SEQ ID NO: 6; BNFAD2.AMI, SEQ ID NO: 7; GMFAD2-1.AMI, SEQ ID NO: 8; GMFAD-2.AMI, SEQ ID NO: 9; ZMFAD2.AMI, SEQ ID NO: 10; und RCFAD2.AMI, SEQ ID NO: 11.

10 zeigt einen Southernblot von genomischer DNA aus L. fendleri, die mit pLesq-HYD als Sonde untersucht wurde. E=EcoRI, H=HindIII, X=XbaI.

11 zeigt eine Kartierung des binären Ti-Plasmids pSLJ44024.

Wie oben dargestellt ist, werden gemäß einer ersten Ausführungsform bestimmte rekombinante DNA-Konstrukte bereitgestellt, die für die Transkription oder für die Transkription und Translation (Expression) der kappa-Hydroxylasesequenz aus Pflanzen sorgen können. Es sind insbesondere Konstrukte bevorzugt, die zur Transkription oder zur Transkription und Translation in Pflanzen-Wirtszellen befähigt sind. Solche Konstrukte können eine Vielzahl von regulatorischen Regionen umfassen, einschließlich transkriptionaler Initiationsregionen, die von Genen erhalten werden, die vorzugsweise im Samengewebe von Pflanzen exprimiert werden. Gemäß eines zweiten Aspekts werden solche Konstrukte in Pflanzenzellen bereitgestellt, insbesondere in Pflanzenzellen, die eine exprimierte Pflanzenkappa-Hydroxylase umfassen.

Eine solche Pflanzen-kappa-Hydroxylase kann in einer Wirtszelle oder in Nachkommen derselben mittels der Expression eines Konstrukts in der Zelle produziert werden. Zellen, die eine Pflanzen-kappa-Hydroxylase als Ergebnis der Produktion der für die Pflanzen-kappa-Hydroxylase kodierenden Sequenz umfassen, werden vorliegend ebenfalls vorgeschlagen.

Gemäß einer weiteren Ausführungsform werden Verfahren zur Verwendung einer für eine Pflanzen-kappa-Hydroxylase kodierenden DNA-Sequenz zur Modifikation eines Teils der hydroxylierten Fettsäuren, die in einer Zelle gebildet werden, insbesondere einer Pflanzenzelle, bereitgestellt. Pflanzenzellen, die eine solche modifizierte Zusammensetzung bezüglich der hydroxylierten Fettsäuren aufweisen, werden vorliegend ebenfalls vorgeschlagen.

Pflanzen-kappa-Hydroxylase-Proteine und damit verwandte Sequenzen, einschließlich Aminosäure- und Nukleinsäuresequenzen werden vorgeschlagen. Die vorliegend beispielhaft angeführte Pflanzen-kappa-Hydroxylase umfasst eine Fettsäure-Hydroxylase aus Lesquerella fendleri. Diese beispielhaft angeführte Fettsäure-Hydroxylase kann verwendet werden, um andere erfindungsgemäße Pflanzen-Fettsäure-Hydroxylasen zu erhalten.

Gemäß eines weiteren Aspektes dieser Erfindung wird eine Nukleinsäuresequenz beschrieben, die die Samen-spezifische Expression einer für ein assoziiertes Polypeptid kodierenden Sequenz steuert. Die Verwendung dieser Nukleinsäuresequenz oder von Fragmenten, die sich davon ableiten, um eine Samenspezifische Expression einer beliebigen kodierenden Sequenz in höheren Pflanzen zu erhalten, wird vorliegend vorgeschlagen.

DETAILLIERTE BESCHREIBUNG DER ERFINDUNG

Eine erfindungsgemäße genetisch transformierte Pflanze, die hydroxylierte Fettsäuren akkumuliert, kann durch Expression der doppelsträngigen DNA-Moleküle, die in dieser Anmeldung beschrieben werden, erhalten werden.

Eine erfindungsgemäße Pflanzen-Fettsäure-Hydroxylase umfasst eine beliebige Aminosäuresequenz (wie beispielsweise ein Protein, Peptid oder Peptidfragment oder Nukleinsäuresequenzen, die für solche Polypeptide kodieren), die aus einer Pflanzen-Bezugsquelle erhältlich ist und die Fähigkeit zeigt, die Herstellung von Rizinolsäure, Lesquerolsäure, Hydroxyerucasäure (16-Hydroxy-cis-13-docosensäure) oder Hydroxypalmitoleinsäure (12-Hydroxy-cis-9-hexadecensäure) aus CoA, ACP oder Lipidgebundenen Monoen-Fettsäuresubstraten unter für ein Pflanzen-Enzym reaktiven Bedingungen zu katalysieren. Mit "für ein Enzym reaktive Bedingungen" ist gemeint, dass sämtliche erforderlichen Bedingungen in einer Umgebung verfügbar sind (d.h. solche Faktoren wie Temperatur, pH, Fehlen von inhibierenden Substanzen), die dem Enzym seine Funktionsfähigkeit erlauben.

Die bevorzugte Aktivität einer Pflanzen-Fettsäure-Hydroxylase gegenüber einem bestimmten Fettsäuresubstrat wird durch Vergleich der Produktmengen an hydroxylierten Fettsäure, die für verschiedene Fettsäuresubstrate erhalten werden, bestimmt. Beispielsweise ist mit "Oleat bevorzugend" gemeint, dass die Hydroxylase-Aktivität der Enzympräparation eine Präferenz für Oleat-enthaltende Substrate im Vergleich mit anderen Substraten zeigt. Obwohl das genaue Substrat für die Fettsäure-Hydroxylase aus Rizinus nicht bekannt ist, wird angenommen, dass es sich um einen einfach ungesättigten Fettsäurerest handelt, der mit einem Phospholipid wie Phosphatidylcholin verestert ist. Es ist jedoch auch möglich, dass die einfach ungesättigten Fettsäuren mit Phosphatidylethanolamin verestert sind; Phosphatidsäure oder ein neutrales Lipid wie Diacylglycerol oder ein Coenzym A-Thioester könnten ebenfalls Substrate sein. Wie oben angemerkt, wurde eine signifikante Aktivität in radioaktiven Markierungsuntersuchungen beobachtet, in denen andere Fettsäuresubstrate als Oleate verwendet wurden (Howling et al., 1972), was darauf verweist, dass die Substratspezifität für eine Familie von verwandten Fettsäure-Verbindungen existiert. Da die Hydroxylase aus Rizinus die Hydroxy-Gruppen 3 Kohlenstoffatome von einer Doppelbindung entfernt einbringt, proximal zum Methyl-Kohlenstoff der Fettsäure, haben wir dieses Enzym der Einfachheit halber als kappa-Hydroxylase bezeichnet. Wir glauben interessanterweise, dass die Rizinus-kappa-Hydroxylase zur Herstellung von 12-Hydroxy-9-octadecensäure (Rizinoleat), 12-Hydroxy-9-hexadecensäure, 14-Hydroxy-11-eicosensäure, 16-Hydroxy-13-docosansäure, 9-Hydroxy-6-octadecensäure verwendet werden könnte, indem man sie in Pflanzen-Spezies exprimiert, die die nicht-hydroxylierten Vorstufen produzieren. Wir streben ferner die Herstellung von zusätzlich modifizierten Fettsäuren, wie 12-Hydroxy-9,15-octadecadiensäure an, die aus der Desaturierung von hydroxylierten Fettsäuren (z.B. 12-Hydroxy-9-octadecensäure in diesem Beispiel) resultieren.

Wir nehmen ferner an, dass zukünftige Fortschritte in der Pflanzengenetik zur Herstellung von Substratfettsäuren wie Icosensäureester und Palmitoleinsäureester in Pflanzen führen werden, die normalerweise solche Fettsäuren nicht akkumulieren. Wir nehmen ferner an, dass die vorliegend beschriebene Erfindung im Zusammenhang mit solchen künftigen Verbesserungen verwendet werden kann, um die erfindungsgemäßen hydroxylierten Fettsäuren in beliebigen Pflanzen-Spezies herzustellen, die geeignet sind, die genetische Modifikation zu steuern. Daher ist die Anwendbarkeit dieser Erfindung nach unserer Vorstellung nicht nur auf diejenigen Spezies beschränkt, die gegenwärtig geeignete Substrate akkumulieren.

Wie oben erwähnt wird eine erfindungsgemäße Pflanzen-kappa-Hydroxylase eine Aktivität gegenüber verschiedenen Fettsäuresubstraten zeigen. Während der Biosynthese von Fetten in einer Pflanzenzelle sind die Fettsäuren üblicherweise kovalent an Acyl-Trägerproteine (ACP), Coenzym A (CoA) oder verschiedene zelluläre Lipide gebunden. Pflanzen-kappa-Hydroxylasen, die eine bevorzugte Aktivität gegenüber Lipid-gebundenen Acylsubstraten aufweisen, sind besonders bevorzugt, weil sie wahrscheinlich eng mit dem normalen Weg der Synthese von Speicherlipiden in unreifen Embryos assoziiert sind. Eine Aktivität gegenüber Acyl-CoA-Substraten und anderen synthetischen Substraten wird jedoch beispielsweise vorliegend ebenfalls vorgeschlagen.

Andere Pflanzen-kappa-Hydroxylasen sind ausgehend von den spezifischen, beispielhaft angeführten Sequenzen, die vorliegend bereitgestellt werden, erhältlich. Des Weiteren wird es ersichtlich sein, dass man natürliche und synthetische Pflanzen-kappa-Hydroxylasen, einschließlich modifizierter Aminosäuresequenzen und Startmaterialien, für das synthetische Protein-Modeling ausgehend von den beispielhaft angeführten Pflanzen-kappa-Hydroxylasen und den Pflanzen-kappa-Hydroxylasen, die durch Verwendung solcher beispielhaft angeführten Sequenzen erhalten werden, erhalten kann. Modifizierte Aminosäuresequenzen umfassen Sequenzen die mutiert, trunkiert, vergrößert usw. wurden, wobei solche Sequenzen partiell oder vollständig synthetisiert sein können. Sequenzen, die tatsächlich aus Pflanzen-Präparationen gereinigt werden, oder die mit diesen identisch sind oder für identische Proteine kodieren, werden unabhängig von dem verwendeten Verfahren zum Erhalt des Proteins oder der Sequenz gleichermaßen als natürlich erhalten angesehen.

Der Fachmann wird somit problemlos erkennen, dass Antikörperpräparation, Nukleinsäure-Sonden (DNA oder RNA) u.ä. hergestellt und verwendet werden können, um "homologe" oder "verwandte" kappa-Hydroxylasen aus einer Vielzahl pflanzlicher Bezugsquellen durchzumustern (Screening) und zu gewinnen. Üblicherweise werden Nukleinsäure-Sonden markiert, um die Detektion zu erlauben, vorzugsweise mittels Radioaktivität, obwohl Enzyme oder andere Verfahren ebenfalls verwendet werden können. Für immunologische Screening-Verfahren werden entweder monoklonale oder polyklonale Antikörper-Präparationen verwendet. Polyklonale Antikörper sind üblicherweise bei der Isolierung von Genen nützlicher, obwohl sie weniger spezifisch sind. Bei der Detektion wird der Antikörper unter Verwendung von Radioaktivität oder mit einem beliebigen aus einer Vielzahl von Systemen aus sekundärem Antikörper/Enzymkonjugat markiert, die kommerziell verfügbar sind.

Homologe Sequenzen werden gefunden, wenn Sequenzidentität vorliegt, und sie können durch Vergleich der Sequenzinformation (Nukleinsäure oder Aminosäure) oder durch Hybridisierungsreaktionen zwischen einer bekannten kappa-Hydroxylase und einer Kandidaten-Bezugsquelle bestimmt werden. Konservative Austausche, wie Glu/Asp, Val/Ile, Ser/Thr, Arg/Lys und Gln/Asn können ebenfalls bei Bestimmung der Sequenzhomologie berücksichtigt werden. Üblicherweise kann eine längere Nukleinsäuresequenz eine geringe Sequenzidentität von nur 50 bis 60 %, und stärker bevorzugt eine Sequenzidentität von mindestens etwa 70 %, zwischen der Zielsequenz und der gegebenen Pflanzen-kappa-Hydroxylase von Interesse aufweisen (wobei jegliche Deletionen, die vorhanden sein können, nicht eingeschlossen sind) und dennoch als verwandt gelten. Aminosäuresequenzen werden bei einer Sequenzidentität von nur 25 % zwischen zwei vollständig reifen Proteinen als homolog angesehen (für einen allgemeinen Überblick siehe Doolittle, R.F., OF URFS and ORFS, University Science Books, CA, 1986).

Eine genomische oder eine andere geeignete Bibliothek, die ausgehend von einer Kandidatenpflanzen-Bezugsquelle von Interesse hergestellt worden ist, kann mit konservierten Sequenzen der Pflanzen-kappa-Hydroxylase als Sonde untersucht werden, um homolog verwandte Sequenzen zu identifizieren. Die Verwendung einer gesamten cDNA oder einer anderen Sequenz ist möglich, wenn kürzere Sonden-Sequenzen nicht identifiziert wurden. Positive Klone werden anschließend durch Restriktionsenzymverdau und/oder Sequenzierung analysiert. Wenn eine genomische Bibliothek verwendet wird, können eine oder mehrere Sequenzen identifiziert werden, wobei sowohl die kodierende Region als auch die transkriptionalen regulatorischen Elemente des kappa-Hydroxylase-Gens aus einer solchen Pflanzen-Bezugsquelle bereitgestellt werden. Sonden können auch beträchtlich kürzer sein als die gesamte Sequenz. Beispielsweise können Oligonukleotide verwendet werden, wobei diese mindestens etwa 10, vorzugsweise mindestens etwa 15, stärker bevorzugt mindestens 20 Nukleotide lang sein sollten. Wenn Regionen kürzerer Länge für den Vergleich verwendet werden, ist ein höherer Grad von Identität erforderlich als bei längeren Sequenzen. Kürzere Sonden sind oftmals insbesondere nützlich bei einer Polymerase-Kettenreaktion (PCR), insbesondere wenn hochkonservierte Sequenzen identifiziert werden können (siehe Gould et al., 1989 für Beispiele der Verwendung einer PCR zur Isolierung von homologen Genen aus taxonomisch verschiedenen Spezies).

Wenn längere Nukleinsäurefragmente als Sonden eingesetzt werden (> 100 bp), insbesondere bei Verwendung von vollständigen oder großen cDNA-Sequenzen, würde man ein Screening bei geringer Stringenz durchführen (beispielsweise bei 40 bis 50°C unter der Schmelztemperatur der Sonde), um ein Signal von der Zielprobe zu erhalten, welche eine Abweichung von 20 bis 50 % aufweist, d.h. homologe Sequenzen (Beltz et al., 1983).

Gemäß einer bevorzugten Ausführungsform wird eine Pflanzen-kappa-Hydroxylase gemäß der vorliegenden Erfindung insgesamt mindestens 60 % Aminosäuresequenz-Ähnlichkeit mit der beispielhaft angeführten Pflanzen-kappa-Hydroxylase aufweisen. Insbesondere werden kappa-Hydroxylasen bevorzugt, die von einer Aminosäure- oder Nukleinsäuresequenz aus Rizinus oder Lesquerella erhältlich sind. Die Pflanzen-kappa-Hydroxylasen können eine bevorzugte Aktivität gegenüber längerkettigen oder kürzerkettigen Fettsäuresubstraten aufweisen. Pflanzen-Fettsäure-Hydroxylasen, die eine Oleat-12-Hydroxylase-Aktivität und eine Eicosenoat-14-Hydroxylase-Aktivität aufweisen, werden beide aufgrund eines in vitro-Belegs (Howling et al., 1972) und aufgrund des vorliegend erbrachten Belegs, dass die Rizinus-kappa-Hydroxylase auf beide Substrate wirkt, als homolog verwandte Proteine angesehen. Die hydroxylierten Fettsäuren können weiteren enzymatischen Modifikationen durch andere Enzyme unterworfen werden, die normalerweise vorhanden sind oder durch biotechnologische Verfahren eingebracht werden. So wird beispielsweise angenommen, dass 14-Hydroxy-11,17-eicosadiensäure, die in einigen Lesquerella-Spezies vorhanden ist (Smith, 1985), durch Desaturierung von 14-Hydroxy-11-eicosensäure hergestellt wird.

Es können nicht nur Gen-Klone und Materialien, die sich von diesen ableiten, zur Identifizierung von homologen Pflanzen-Fettsäure-Hydroxylasen verwendet werden, sondern die resultierenden Sequenzen, die von diesen erhalten werden, können auch ein weiteres Verfahren zum Erhalt von Pflanzen-Fettsäure-Hydroxylasen aus anderen pflanzlichen Bezugsquellen bereitstellen. Die PCR könnte eine besonders nützliche Methode sein, um ausgehend von den vorliegend bereitgestellten Sequenzdaten verwandte Pflanzen-Fettsäure-Hydroxylasen zu erhalten. Der Fachmann wird in der Lage sein, Oligonukleotid-Sonden zu erstellen, die auf Sequenzvergleichen oder Regionen basieren, die eine eine hochkonservierte Sequenz aufweisen. Von besonderem Interesse sind Polymerase-Kettenreaktions-Primer, die auf den konservierten Aminosäuresequenz-Regionen zwischen der Rizinus-kappa-Hydroxylase und der L. fendleri-Hydroxylase (SEQ ID NO: 4) basieren. Details zum Erstellen von Sonden sowie zu Verfahren für eine PCR-Reaktion unter Verwendung dieser Sonden werden in den Beispielen näher beschrieben.

Es sollte ferner angemerkt werden, dass die Fettsäure-Hydroxylasen von einer Vielzahl von Bezugsquellen dazu verwendet werden können, Fettsäure-Hydroxylierungs-Ereignisse in einer großen Vielzahl von Pflanzen und in vivo-Applikationen zu untersuchen. Da alle Pflanzen Fettsäuren über einen gemeinsamen metabolischen Weg synthetisieren, kann die Untersuchung und/oder Anwendung einer Pflanzen-Fettsäure-Hydroxylase mit einem heterologen Pflanzen-Wirt problemlos in einer Vielzahl von Spezies erreicht werden.

Sobald die Nukleinsäuresequenz erhalten wurde, ist die Transkription oder die Transkription und Translation (Expression) der Pflanzen-Fettsäure-Hydroxylasen in einer Wirtszelle angestrebt, um eine einfache Bezugsquelle für das Enzym herzustellen und/oder die Zusammensetzung der Fettsäuren zu modifizieren, die in dieser in Form von freien Fettsäuren, Estern (insbesondere mit Glycerol-Lipiden verestert oder als Bestandteile von Wachs-Estern), Estoliden oder Ethern vorgefunden werden. Andere nützliche Anwendungen können gefunden werden, wenn die Wirtszelle eine Pflanzen-Wirtszelle ist, in vitro und in vivo.

Beispielsweise kann durch Erhöhen der Menge an kappa-Hydroxylase, die der Pflanze zugänglich ist, ein erhöhter Prozentsatz von Rizinoleat oder Lesqueroleat (14-Hydroxy-11-eicosensäure) bereitgestellt werden.

Kappa-Hydroxylase

Die vorliegende Erfindung zeigt einen Mechanismus der Biosynthese von Rizinolsäure in Pflanzen; es wird nämlich gezeigt, dass eine spezifische Pflanzen-kappa-Hydroxylase mit bevorzugter Aktivität gegenüber Fettsäuresubstraten zumindest in einigen Pflanzen-Spezies an der Akkumulierung von hydroxylierten Fettsäuren beteiligt ist. Die Verwendung der Begriffe Rizinoleat oder Rizinolsäure (oder Lesqueroleat oder Lesquerolsäure, Densipoleat usw.) soll die freien Säuren, die ACP- und CoA-Ester, die Salze dieser Säuren, die Glycerol-Lipidester (insbesondere die Triacylglycerolester), die Wachs-Ester, die Estoliden und die Etherderivate dieser Säuren umfassen.

Die Feststellung, dass Pflanzen-Fettsäure-Hydroxylasen an der in vivo-Produktion von hydroxylierten Fettsäuren aktiv beteiligt sind, verweist auf mehrere Möglichkeiten hinsichtlich der Bezugsquellen für das Pflanzenenzym. Tatsächlich werden hydroxylierte Fettsäuren in einigen natürlichen Pflanzen-Spezies im Überschuss vorgefunden. Beispielsweise kommen drei Hydroxy-Fettsäuren, die mit Rizinoleat verwandt sind, in großen Mengen in Samenölen verschiedener Lesquerella-Spezies vor. Besonders interessant ist die Lesquerolsäure, ein Homolog zu Rizinoleat von 20 Kohlenstoffatomen mit zwei zusätzlichen Kohlenstoffatomen am Carboxyl-Ende der Kette (Smith, 1985). Andere natürliche Pflanzen-Bezugsquellen für hydroxylierte Fettsäuren umfassen (sind jedoch nicht beschränkt auf) Samen der Gattung Linum, Samen von Wrightia-Spezies, Lycopodium-Spezies, Strophanthus-Spezies, Convolvulaces-Spezies, Calendula-Spezies und zahlreichen anderen (van der Loo et al., 1993).

Pflanzen mit signifikantem Vorhandensein von Rizinoleat oder Lesqueroleat oder desaturierten anderen oder modifizierten Derivaten dieser Fettsäuren sind bevorzugte Kandidaten, um natürlich abgeleitete kappa-Hydroxylasen zu erhalten. Beispielsweise enthält Lesquerella densipila eine zweifach ungesättigte Fettsäure mit 18 Kohlenstoffatomen mit einer Hydroxyl-Gruppe (van de Loo et al., 1993), von der gemäß der Theorie, auf der diese Erfindung basiert, angenommen wird, dass sie von einem Enzym produziert wird, das mit der Rizinus-kappa-Hydroxylase eng verwandt ist. Darüber hinaus kann ein Vergleich zwischen kappa-Hydroxylasen und zwischen Pflanzen-Fettsäure-Hydroxylasen, die Hydroxyl-Gruppen an anderen Positionen als dem 12-Kohlenstoffatom des Oleats oder dem 14-Kohlenstoffatom des Lesqueroleats einbringen, oder Hydroxyl-Gruppen bei anderen Substraten als Ölsäure und Icosensäure einbringen, Einblicke für das Protein-Modeling und für andere Modifikationen zur Erzeugung synthetischer Hydroxylasen geben, wie oben diskutiert wird. Beispielsweise streben wir an, auf Basis der Informationen, welche aus den strukturellen Vergleichen der &Dgr;12-Desaturasen und der kappa-Hydroxylase erhalten werden, genetische Modifikationen in den Struktur-Genen der &Dgr;12-Desaturasen vorzunehmen, die diese Desaturasen zu kappa-Hydroxylasen umwandeln. Wir streben ferner an, Veränderungen in &Dgr;15-Hydroxylasen vorzunehmen, die diese zu Hydroxylasen umwandeln, welche eine Substrat-Spezifität aufweisen, die mit der der Desaturasen vergleichbar ist (z. B. Konversion von 18:2&Dgr;9,12 zu 15OH-18:2&Dgr;9,12. Da der Unterschied zwischen einer Hydroxylase und einer Desaturase die Anordnung eines Protons betrifft, denken wir, dass diese Veränderung durch systematische Veränderung der geladenen Gruppen im Bereich nahe des aktiven Zentrums des Enzyms bewirkt werden kann.

Von besonderem Interesse sind Fettsäure-Hydroxylasen, die eine Aktivität gegenüber anderen Fettsäure-Substraten als Oleat zeigen oder die Hydroxyl-Gruppe an einer anderen Stelle als dem C12-Kohlenstoffatom einbringen. Wie oben beschrieben ist, können auch andere Pflanzen-Bezugsquellen Bezugsquellen für diese Enzyme bereitstellen, z.B. durch die Verwendung von Proteinreinigung, Nukleinsäure-Sonden, Antikörper-Präparationen, Protein-Modeling oder Sequenzvergleichen. Von besonderem Interesse sind die jeweiligen Aminosäure- und Nukleinsäuresequenzen, die solchen Pflanzen-Fettsäure-Hydroxylasen entsprechen. Wie ebenfalls zuvor beschrieben wurde, können – sobald eine Nukleinsäuresequenz für eine gegebene Pflanzen-Hydroxylase erhalten wird – weitere pflanzliche Sequenzen verglichen und/oder mit Sonden untersucht werden, um zu dieser Nukleinsäuresequenz homolog verwandte DNA-Sequenzen zu erhalten usw.

Verwendungen in Gentechnik-Anwendungen

Wie im Stand der Technik hinreichend bekannt ist, kann ein für eine Pflanzen-kappa-Hydroxylase kodierender cDNA-Klon, sobald er erhalten wurde, dazu verwendet werden, die entsprechenden genomischen Nukleinsäuresequenzen zu diesem zu erhalten.

Die Nukleinsäuresequenzen, die für die Pflanzen-kappa-Hydroxylasen kodieren, können in verschiedenen Konstrukten verwendet werden, z.B. als Sonden, um weitere Sequenzen von derselben oder von anderen Spezies zu erhalten. Alternativ dazu können die Sequenzen in Verbindung mit geeigneten regulatorischen Sequenzen verwendet werden, um die Mengen der jeweiligen Hydroxylase von Interesse in einer Wirtszelle für die Produktion von hydroxylierten Fettsäuren zu erhöhen, oder zur Untersuchung des Enzyms in vitro oder in vivo, oder um die Mengen der jeweiligen Hydroxylase von Interesse bei einigen Anwendungen zu verringern oder zu erhöhen, in denen die Wirtszelle eine Pflanzen-Einheit ist, einschließlich Pflanzenzellen, Pflanzenteilen (einschließlich jedoch nicht beschränkt auf Samen, Schnitte oder Gewebe) und Pflanzen.

Eine Nukleinsäuresequenz, die für eine Pflanzen-kappa-Hydroxylase gemäß der vorliegenden Erfindung kodiert, kann eine genomische, eine cDNA- oder eine mRNA-Sequenz umfassen. Mit "kodierend" ist gemeint, dass die Sequenz einer bestimmten Aminosäuresequenz entspricht, entweder in einer Sense-Orientierung oder in einer Antisense-Orientierung. Mit "rekombinant" ist gemeint, dass die Sequenz eine Modifikation enthält, die gentechnisch durch Manipulation mittels Mutagenese, Restriktionsenzyme und Ähnliches erzeugt wurde. Eine cDNA-Sequenz kann für Prä-Prozessierungssequenzen, wie beispielsweise Transit- oder Signalpeptid-Sequenzen, kodieren oder auch nicht. Transit- oder Signalpeptid-Sequenzen ermöglichen die Bereitstellung des Proteins an ein gegebenes Organell und werden oftmals bei Eintritt in das Organell von dem Polypeptid abgespalten, wobei die "reife" Sequenz freigesetzt wird. Die Verwendung der Vorläufer-DNA-Sequenz ist bei pflanzlichen Zell-Expressions-Kassetten bevorzugt.

Ferner kann wie oben erwähnt die vollständige genomische Sequenz der Pflanzen-kappa-Hydroxylase durch Screening einer genomischen Bibliothek mit einer Sonde, wie beispielsweise einer cDNA-Sonde, und Isolierung derjenigen Sequenzen, die die Expression in Samen-Gewebe regulieren, erhalten werden. Auf diese Weise können Transkriptions- und Translations-Initiationsregionen, Introns, und/oder Transkript-Terminationsregionen der Pflanzen-kappa-Hydroxylase für die Verwendung in einer Vielzahl von DNA-Konstrukten erhalten werden, mit oder ohne kappa-Hydroxylase-Struktur-Gen. Somit können Nukleinsäuresequenzen, die der erfindungsgemäßen Pflanzen-kappa-Hydroxylase entsprechen, auch Signalsequenzen bereitstellen, die für den direkten Transport in ein Organell nützlich sind, 5'-stromaufwärts gelegene nicht-kodierende regulatorische Regionen (Promotoren) mit nützlichen Gewebe- und Timing-Eigenschaften, 3'-stromabwärts gelegene nicht-kodierende regulatorische Regionen, welche als transkriptionale und translationale regulatorische Regionen nützlich sind, und sie können Einblick in andere Eigenschaften des Gens vermitteln.

Sobald die gewünschte Nukleinsäuresequenz der Pflanzen-kappa-Hydroxylase erhalten wird, kann sie auf vielfältige Weise manipuliert werden. Wenn die Sequenz nicht-kodierende flankierende Regionen umfaßt, können die flankierenden Regionen einer Resektion, einer Mutagenese usw. unterworfen werden. Somit können Transitionen, Transversionen, Deletionen und Insertionen bei der natürlich vorkommenden Sequenz durchgeführt werden. Darüber hinaus kann die gesamte Sequenz oder ein Teil der Sequenz synthetisiert werden. Ein oder mehrere Kodons im Struktur-Gen können modifiziert werden, um eine modifizierte Aminosäuresequenz bereitzustellen, oder es können ein oder mehrere Kodon-Mutationen eingebracht werden, um für geeignete Restriktionsschnittstellen zu sorgen, oder aus anderen Gründen, die bei der Konstruktion oder Expression eine Rolle spielen. Das Struktur-Gen kann ferner durch Verwendung synthetischer Adapter oder durch Verwendung von Verbindungsmolekülen zur Einbringung einer oder mehrerer geeigneter Restriktionsschnittstellen o.ä. modifiziert werden.

Die Nukleinsäure- oder Aminosäuresequenz, die für eine Pflanzen-kappa-Hydroxylase gemäß der vorliegenden Erfindung kodiert, kann auf vielfältige Weise mit anderen nicht-nativen (oder "heterologen") Sequenzen kombiniert werden. Mit "heterologen" Sequenzen ist jede beliebige Sequenz gemeint, die natürlicherweise nicht in Verbindung mit der Pflanzen-kappa-Hydroxylase vorgefunden wird, einschließlich z.B. eine Kombination von Nukleinsäuresequenzen aus derselben Pflanze, die natürlicherweise nicht miteinander verbunden vorgefunden werden.

Die DNA-Sequenz, die für eine Pflanzen-kappa-Hydroxylase gemäß der vorliegenden Erfindung kodiert, kann in Verbindung mit allen oder einem Teil der Gen-Sequenzen verwendet werden, die normalerweise mit der kappa-Hydroxylase assoziiert sind. Eine DNA-Sequenz, die für eine kappa-Hydroxylase kodiert, wird in ihren Einzelteilen in ein DNA-Konstrukt kombiniert, das in 5'-3'-Richtung der Transkription eine Transkriptions-Initiations-Kontrollregion umfasst, die in der Lage ist, die Transkription und Translation in einer Wirtszelle zu fördern, die DNA-Sequenz, die für die Pflanzen-kappa-Hydroxylase kodiert, sowie eine die Transkription oder Translation terminierende Region.

Potentielle Wirtszellen umfassen prokaryotische und eukaryotische Zellen. Eine Wirtszelle kann – abhängig von der beabsichtigten Verwendung – einzellig sein oder in einem vielzellig differenzierten oder undifferenzierten Organismus vorkommen. Zellen gemäß dieser Erfindung können dadurch unterschieden werden, dass sie eine Pflanzen-kappa-Hydroxylase aufweisen, die in Bezug auf die Wildtypzelle, in der diese vorliegt, fremd ist, beispielsweise, indem sie ein rekombinantes Nukleinsäurekonstrukt aufweist, das für eine Pflanzen-kappa-Hydroxylase kodiert.

Abhängig vom Wirt werden die regulatorischen Regionen variieren, wobei Regionen aus viralen Genen, aus Plasmid-Genen oder aus chromosomalen Genen oder Ähnlichen eingeschlossen sind. Für die Expression in prokaryotischen oder eukaryotischen Mikroorganismen, insbesondere in einzelligen Wirten, kann eine große Vielzahl von konstitutiven oder regulierbaren Promotoren eingesetzt werden. Die Expression in einem Mikroorganismus kann eine einfache Bezugsquelle für das Pflanzen-Enzym bereitstellen. Unter den beschriebenen Transkriptions-Initiations-Regionen sind Regionen aus bakteriellen Wirten und aus Hefe-Wirten, wie beispielsweise E. coli, B. subtilis, Saccharomyces cerevisiae, wobei Gene wie &bgr;-Galaktosidase, T7-Polymerase, Tryptophan E und Ähnliche eingeschlossen sind.

Die Konstrukte werden meist regulatorische Regionen umfassen, die in Pflanzen funktionstüchtig sind, was für die modifizierte Produktion von Pflanzen-kappa-Hydroxylase sorgt und zu einer Modifikation der Fettsäurezusammensetzung führt. Der offene Leserahmen, der für die Pflanzen-kappa-Hydroxylase oder ein funktionstüchtiges Fragment derselben kodiert, wird an seinem 5'-Ende mit einer regulatorischen Transkriptions-Initiations-Region, wie z.B. der Wildtypsequenz, die natürlicherweise 5'-stromaufwärts vom kappa-Hydroxylase-Struktur-Gen vorkommt, zusammengefügt. Zahlreiche andere Transkriptions-Initiations-Regionen sind verfügbar, die für eine große Vielzahl von konstitutiven oder regulierbaren (z.B. induzierbaren) Funktionen der Transkription des Struktur-Gens sorgen. Unter den Transkriptions-Initiations-Regionen, die für Pflanzen verwendet werden, sind solche Regionen, die beispielsweise mit den Struktur-Genen der Nopalin-Synthase und der Mannopin-Synthase assoziiert sind, oder mit Napin, Sojabohnen-&bgr;-conglycinin, Oleosin, dem 12S-Speicherprotein, den 35S-Promotoren des Blumenkohl-Mosaikvirus und Ähnlichen. Die Transkription/Translation-Initiations-Regionen, die solchen Struktur-Genen entsprechen, werden unmittelbar 5'-stromaufwärts vom jeweiligen Startkodon gefunden. In Ausführungsformen, in denen die Expression des kappa-Hydroxylase-Proteins in einem Pflanzenwirt erwünscht ist, wird die Verwendung des gesamten oder eines Teils des vollständigen Pflanzen-kappa-Hydroxylase-Gens angestrebt; es können dementsprechend alle oder ein Teil der 5'-stromaufwärts gelegenen nicht-kodierenden Regionen (Promotor) gemeinsam mit der Sequenz des Struktur-Gens und den 3'-stromabwärts gelegenen nicht-kodierenden Regionen verwendet werden. Wenn ein anderer Promotor erwünscht ist (wie beispielsweise ein Promotor der in Bezug auf den Pflanzen-Wirt von Interesse nativ ist, oder ein modifizierter Promotor, d.h. mit Transkriptions-Initiations-Regionen, die von einer Gen-Bezugsquelle stammen, und Translations-Initiations-Regionen, die von einer anderen Gen-Bezugsquelle stammen, einschließlich der Sequenz, die für die Pflanzen-kappa-Hydroxylase von Interesse kodiert, oder verstärkende Promotoren, wie die Double-35S-CaMV-Promotoren, können die Sequenzen unter Verwendung von Standardverfahren zusammengefügt werden.

Bei Anwendungen, in denen die 5'-stromaufwärts gelegenen nicht-kodierenden Regionen von anderen während der Samenreifung regulierten Genen erhalten werden, sind vorzugsweise solche erwünscht, die in Embryo-Gewebe von Pflanzen exprimiert werden, wie die Transkriptions-Initiations-Kontrollregionen des Napin-Gens aus B. napus oder des 12S-Speicherproteins von Arabidopsis, oder des &bgr;-conglycinins aus Sojabohnen (Bray et al., 1987), oder der kappa-Hydroxylase-Promotor aus L. fendleri, der vorliegend beschrieben wird. Transkriptions-Initiations-Regionen, die vorzugsweise in Samen-Gewebe exprimiert werden, d.h. die in anderen Pflanzen-Teilen nicht nachgewiesen werden können, werden für Fettsäuremodifikationen als wünschenswert erachtet, um alle störenden oder nachteiligen Auswirkungen auf das Gen-Produkt zu minimieren.

Regulatorische Transkript-Terminations-Regionen können ebenfalls in den erfindungsgemäßen DNA-Konstrukten vorgesehen werden. Transkript-Terminations-Regionen können durch die DNA-Sequenz bereitgestellt werden, die für die Pflanzen-kappa-Hydroxylase kodiert, oder es kann eine vorteilhafte Transkriptions-Terminations-Region von einer anderen Gen-Bezugsquelle abgeleitet werden, beispielsweise von der Transkript-Terminations-Region, die natürlicherweise mit der Transkript-Initiations-Region assoziiert ist. Wenn die Transkript-Terminations-Region von einer anderen Gen-Bezugsquelle stammt, wird sie mindestens etwa 0,5 kb, vorzugsweise etwa 1 bis 3 kb, der Sequenz 3' vom Struktur-Gen enthalten, von dem die Terminations-Region abgeleitet ist.

Pflanzen-Expressions- oder Transkriptions-Konstrukte mit einer Pflanzen-kappa-Hydroxylase als DNA-Sequenz von Interesse für die gesteigerte oder verringerte Expression derselben können mit einer großen Vielzahl von pflanzlichen Lebensformen verwendet werden, insbesondere mit pflanzlichen Lebensformen, die bei der Herstellung von pflanzlichen Ölen für Nahrungszwecke und industrielle Anwendungen beteiligt sind. Am stärksten bevorzugt sind gemäßigte Ölsamen-Nutzpflanzen. Pflanzen von Interesse umfassen (sind jedoch nicht beschränkt auf) Raps (Canola und Sorten mit hohem Erucasäure-Gehalt), Crambe, Brassica juncea, Brassica nigra, Sumpfblume (meadowfom), Flachs, Sonnenblume, Distel, Baumwolle, Cuphea, Sojabohne, Erdnuss, Kokosnuss und Ölpalmen und Mais. Ein wichtiges Kriterium bei der Auswahl geeigneter Pflanzen für die Einbringung einer kappa-Hydroxylase ist das Vorhandensein eines geeigneten Substrats für die Hydroxylase in der Wirtspflanze. Daher wird beispielsweise die Produktion von Rizinolsäure am besten in Pflanzen erreicht, die normalerweise hohe Mengen Ölsäure in den Samen-Lipiden aufweisen. Die Produktion von Lesquerolsäure wird am besten in Pflanzen erreicht, die hohe Mengen Icosensäure in den Samen-Lipiden aufweisen.

Abhängig von den Verfahren zur Einbringung der rekombinanten Konstrukte in die Wirtszelle können weitere DNA-Sequenzen erforderlich sein. Es ist wichtig, dass die Erfindung bei dikotylen und monokotylen Spezies gleichermaßen angewendet werden kann und problemlos auf neue und/oder verbesserte Transformations- und Regulationsverfahren anwendbar ist. Das Verfahren der Transformation ist für die vorliegende Erfindung nicht entscheidend; verschiedene Verfahren der Transformation von Pflanzen sind gegenwärtig verfügbar. Sofern neuere Verfahren zur Transformation von Nutzpflanzen verfügbar sind, können diese direkt im vorliegenden Rahmen verwendet werden. Beispielsweise können zahlreiche Pflanzen-Spezies, die von Natur aus für eine Agrobacterium-Infektion empfänglich sind, erfolgreich durch Verfahren der Agrobacterium-vermittelten Transformation unter Verwendung von binären oder dreiteiligen Vektoren transformiert werden. Zusätzliche Verfahren von Mikroinjektion, DNA-Partikelbombardment und Elektroporation sind entwikkelt worden, die die Transformation verschiedener monokotylen und dikotylen Pflanzen-Spezies erlauben.

Bei der Entwicklung der DNA-Konstrukte werden die verschiedenen Bestandteile des Konstruktes oder Fragmente desselben in einen geeigneten Klonierungsvektor insertiert, der in der Lage ist, sich in einem bakteriellen Wirt zu replizieren, z.B. in E. coli. Es existieren zahlreiche Vektoren, die in der Literatur beschrieben wurden. Nach jeder Klonierung kann das Plasmid isoliert und weiteren Manipulationen unterzogen werden, wie beispielsweise Restriktion, Insertion von neuen Fragmenten, Ligation, Deletion, Insertion, Resektion etc., sodass die Bestandteile der gewünschten Sequenz zurechtgeschnitten werden. Sobald das Konstrukt vollständig ist, kann es gemäß der Art der Wirtszellen-Transformation für die weitere Manipulation in einen geeigneten Vektor eingebracht werden.

Normalerweise wird das DNA-Konstrukt ein Struktur-Gen mit den notwendigen regulatorischen Regionen für die Expression in einem Wirt und die Selektion von transformierten Zellen umfassen. Das Gen kann für eine Resistenz gegen ein cytotoxisches Mittel, z.B. ein Antibiotikum, ein Schwermetall, ein Toxin usw. sorgen, für eine Komplementierung, die für eine Prototrophie in einem auxotrophen Wirt sorgt, für virale Immunität und Ähnliches. Abhängig von der Anzahl der verschiedenen Wirts-Spezies, in die das Expressionskonstrukt oder Bestandteile desselben eingebracht wird, können ein oder mehrere Marker verwendet werden, wobei verschiedene Selektionbedingungen bei den verschiedenen Wirten angewendet werden.

Es wird angemerkt, dass die Degeneration des DNA-Codes dafür sorgt, dass einige Kodon-Substitutionen bei DNA-Sequenzen zulässig sind, ohne irgendeine entsprechende Modifikation bei der Aminosäuresequenz zu verursachen.

Wie oben erwähnt, ist die Art, auf die das DNA-Konstrukt in die Pflanzenzelle eingebracht wird, für die vorliegende Erfindung nicht entscheidend. Jedes beliebige Verfahren, das für eine effiziente Transformation sorgt, kann verwendet werden. Verschiedene Verfahren der Transformation von Pflanzenzellen umfassen die Verwendung von Ti- oder Ri-Plasmiden, Mikroinjektion, Elektroporation, Infiltration, Imbibition, DNA-Partikelbombardement, Liposomenfusion, DNA-Bombardement oder Ähnliches. In vielen Fällen wird es erwünscht sein, dass das Konstrukt auf einer oder auf beiden Seiten der T-DNA eingegrenzt ist; es wird besonders erwünscht sein, dass die linke und die rechte Grenze vorhanden sind, insbesondere die rechte Grenze. Dies ist besonders nützlich, wenn das Konstrukt A. tumefaciens oder A. rhizogenes als Art der Transformation verwendet, obgleich die T-DNA-Grenzen auch bei anderen Arten der Transformation Anwendung finden können.

Wenn Agrobacterium für die Transformtion der Pflanzenzellen verwendet wird, kann ein Vektor verwendet werden, der zum Zwecke der homologen Kombination mit der T-DNA oder dem Ti- oder Ri-Plasmid, die in dem Agrobacterium-Wirt vorhanden sind, in den Agrobacterium-Wirt eingebracht wird. Das Ti- oder Ri-Plasmid, welches die T-DNA für die Rekombination umfasst, kann „bewaffnet" (armed) sein (fähig, die Gallen-Bildung hervorzurufen) oder „unbewaffnet" (disarmed) sein (unfähig, Gallen hervorzurufen), wobei letzteres erlaubt ist, solange die vir-Gene in dem transformierten Agrobacterium-Wirt vorhanden sind. Das „bewaffnete" Plasmid kann zu einer Mischung von normalen Pflanzenzellen und Gallen führen.

In einigen Fällen, in denen Agrobacterium als Vehikel zur Transformation von Pflanzenzellen verwendet wird, wird das von der (den) T-DNA-Grenze(n) eingefasste Expressionskonstrukt in einen Vektor mit breitem Wirtsspektrum insertiert, wobei Vektoren mit breitem Wirtsspektrum in der Literatur beschrieben sind. Oftmals wird pRK2 oder Derivate desselben verwendet. Siehe beispielsweise Ditta et al. (1980). Umfasst vom Expressionskonstrukt und der T-DNA werden ein oder mehrere Marker sein, die die Selektion von transformiertem Agrobacterium und transformierten Pflanzenzellen erlauben. Mehrere Marker sind für die Verwendung in Pflanzenzellen entwickelt worden, wie z.B. die Resistenz gegen Kanamycin, das Aminoglykosid G418, Hygromycin und Ähnliche. Abhängig vom jeweiligen Wirt und der Art der Konstruktion werden verschiedene Marker bevorzugt werden.

Bei der Transformation von Pflanzenzellen unter Verwendung von Agrobacterium können Explantate kombiniert und mit dem transformierten Agrobacterium für eine ausreichende Transformationsdauer inkubiert werden. Die Bakterien werden getötet und die Pflanzenzellen werden in einem geeigneten selektiven Medium kultiviert. Sobald sich der Callus gebildet hat, kann die Sprossbildung durch Verwendung geeigneter Pflanzenhormone nach bekannten Verfahren unterstützt werden, und die Sprösslinge können zur Regeneration der Pflanzen auf Medium zur Wurzelbildung übertragen werden. Die Pflanzen können anschließend angezüchtet werden, um Samen zu bilden, und die Samen können verwendet werden, um repetitive Generationen zu etablieren, und um pflanzliche Öle zu isolieren.

Die nunmehr allgemein beschriebene Erfindung wird leichter durch Verweis auf die nachfolgenden Beispiele verständlich sein, wobei diese lediglich zum Zwecke der Illustration enthalten sind und die vorliegende Erfindung nicht beschränken sollen.

BEISPIELE

In der nachfolgenden experimentellen Offenbarung werden alle Temperaturen in Grad Celsius (°) angegeben, Gewichte werden in Gramm (g), Milligramm (mg) oder Mikrogramm (&mgr;g) angegeben, Konzentrationen werden in molar (M), millimolar (mM) oder mikromolar (&mgr;M) angegeben, und alle Volumen werden in Litern (l), Mikrolitern (&mgr;l) oder Millilitern (ml) angegeben, sofern nicht auf anderes verwiesen wird.

BEISPIEL 1 – HERSTELLUNG VON NEUEN HYDROXYLIERTEN FETTSÄUREN IN ARABIDOPSIS THALIANA Übersicht

Die kappa-Hydroxylase, die durch das zuvor beschriebene fah12-Gen von Rizinus kodiert wird, wurde verwendet, um Rizinolsäure, Lesquerolsäure, Densipolsäure und Auricolsäure in transgenen Arabidopsis-Pflanzen herzustellen. Dieses Beispiel setzt das in der vorhergehenden Anmeldung gelehrte Beispiel 2 in die Praxis um.

Herstellung von transgenen Pflanzen

Eine Vielzahl von Verfahren ist entwickelt worden, um eine DNA-Sequenz von Interesse in das Genom eines Pflanzen-Wirts zu insertieren, um die Transkription und Translation der Sequenz zur Verursachung einer phänotypischen Veränderung zu erhalten. Die nachfolgenden Verfahren stellen lediglich eines von mehreren äquivalenten Mitteln zur Herstellung transgener Pflanzen und zum Bewirken der Expression des Hydroxylase-Gens dar.

Arabidopsis-Pflanzen wurden durch Agrobacterium-vermittelte Transformation transformiert, wobei die kappa-Hydroxylase durch das fah12-Gen von Rizinus auf dem binären Ti-Plasmid pB6 kodiert wurde. Dieses Plasmid wurde zuvor verwendet, um Nicotiana tabacum zum Zwecke der Herstellung von Rizinolsäure zu transformieren.

Material zum Animpfen des Agrobacterium tumefaciens-Stamms GV3101, der das binäre Ti-Plasmid pB6 enthielt, wurde auf L-Nährmedium-Platten ausplattiert, die 50 &mgr;g/ml Kanamycin enthielten, und für 2 Tage bei 30°C inkubiert. Einzelne Kolonien wurden verwendet, um große Flüssigkeitskulturen (L-Nährmedium mit 50 mg/l Rifampicin, 110 mg/l Gentamycin und 200 mg/l Kanamycin) anzuimpfen, die für die Transformation von Arabidopsis-Pflanzen verwendet wurden.

Die Arabidopsis-Pflanzen wurden mittels der in planta-Transformationsmethode transformiert, wie sie im Wesentlichen von Bechtold et al., 1993) beschrieben wurde. Zellen von A. tumefaciens GV3101 (pB6) wurden durch Zentrifugation aus Flüssigkulturen geerntet, anschließend bei einer OD600 = 0,8 in Infiltrationsmedium resuspendiert (Infiltrationsmedium war Murashige und Skoog Makro- und Mikronährstoffmedium (Sigma Chemical Co., St. Louis, MO), das 10 mg/l 6-Benzylaminopurin und 5 % Glucose enthielt). Gruppen von 12–15 Pflanzen wurden für 3 bis 4 Wochen bei natürlichem Licht bei einer durchschnittlichen täglichen Temperatur von ungefähr 25°C in Töpfen von 8,89 cm (3,5 Inch), die Erde enthielten, angezüchtet. Die intakten Pflanzen wurden in die bakterielle Suspension eingetaucht und anschließend in einer Vakuumkammer eingebracht und unter ein Vakuum von 600 mm gesetzt, das von einer Laborvakuumpumpe produziert wurde, bis die Gewebe einheitlich mit Wasser durchtränkt erschienen (ungefähr 10 Minuten). Die Pflanzen wurden bei 25°C für 4 Wochen bei kontinuierlichem Licht angezüchtet (100 &mgr;mol m–2 s–1 Bestrahlung im Bereich von 400 bis 700 nm). Die Samen, die von allen Pflanzen in einem Topf erhalten wurden, wurden als eigene Gruppe geerntet. Die Samen wurden durch sequentielle Behandlung für 2 Minuten mit Ethanol, gefolgt von 10 Minuten mit einer Mischung von Haushaltsbleiche (Chlorox), Wasser und Tween-80 (50 %, 50 %, 0,05 %) sterilisiert und anschließend gründlich mit sterilem Wasser gespült. Die Samen wurden in 100 ml Petrischalen in einer hohen Dichte (2000 bis 4000 pro Platte) auf Agar-verfestigtem Medium ausplattiert, das 1/2 × Murashige und Skoog-Salzmedium enthielt, mit B5-Vitaminen (Sigma Chemical Co., St. Louis, MO) angereichert war und 50 mg/l Kanamycin enthielt. Nach Inkubation für 48 Stunden bei 4°C zur Stimulation der Keimung wurden die Keimlinge für einen Zeitraum von 7 Tagen angezüchtet, bis die Transformanten eindeutig als gesunde grüne Keimlinge gegen einen Hintergrund von chlorotischen, Kanamycin-sensitiven Keimlingen identifiziert werden konnten. Die Transformanten wurden für 2 Wochen auf Erde übertragen, bevor Blattgewebe für die DNA- und Lipid-Analyse benutzt werden konnte. Mehr als 20 Transformanten wurden erhalten.

Die DNA wurde aus jungen Blättern von Transformanten extrahiert, um das Vorhandensein eines intakten fah12-Gens zu verifizieren. Das Vorhandensein des Transgens in mehreren vermeintlichen transgenen Linien wurde unter Verwendung der Polymerase-Kettenreaktion zur Amplifizierung des Inserts von pB6 verifiziert. Bei den verwendeten Primer handelte es sich um HF2 = GCTCTTTTGTGCGCTCATTC (SEQ ID NO: 12) und HR1 = CGGTACCAGAAAACGCCTTG (SEQ ID NO: 13), die erstellt wurden, um die Amplifikation eines 700 bp-Fragments zu erlauben. Ungefähr 100 ng genomische DNA wurden zu einer Lösung gegeben, die 25 pmol von jedem Primer enthielt, 1,5 U Taq-Polymerase (Boehringer Mannheim), 200 &mgr;M dNTPs, 50 mM KCl, 10 mM Tris-HCl (pH 9), 0,1 % (v/v) Triton X-00, 1,5 mM MgCl2, 3 % (v/v) Formamid, das Endvolumen betrug 50 &mgr;l. Die Amplifikationsbedingungen waren: 4 min Denaturierungsschritt bei 94°C, gefolgt von 30 Zyklen bei 92°C für 1 min, 55°C für 1 min, 72°C für 2 min. Ein finaler Extensionsschritt bei 72°C für 5 min schloss das Programm ab. Die Transformanten konnten nach Sichtbarmachen eines charakteristischen amplifizierten Fragments von 1 kb auf einem Ethidiumbromid-gefärbten Agarosegel in positiver Hinsicht identifiziert werden. Alle transgenen Linien, die getestet wurden, ergaben ein PCR-Produkt einer Größe, die mit dem erwarteten Genotyp übereinstimmte, was bestätigte, dass die Linien in der Tat transgen waren. Alle weiteren Experimente wurden mit drei repräsentativen transgenen Linien des Wildtyps durchgeführt, die als 1-3, 4D, 7-4 bezeichnet wurden, sowie mit einer Linie der fad2-Mutantenlinie JB12. Die transgene JB12-Linie wurde einbezogen, um zu testen, ob die erhöhte Akkumulierung von Ölsäure in dieser Mutante eine Auswirkung auf die Menge der Rizinolsäure hat, die in transgenen Pflanzen akkumuliert wird.

Analyse von transgenen Pflanzen

Blätter und Samen von fah12-transgenen Arabidopsis-Pflanzen wurden unter Verwendung der Gaschromatographie auf das Vorhandensein von hydroxylierten Fettsäuren analysiert. Die Lipide wurden aus 100–200 mg Blattgewebe oder aus 50 Samen extrahiert. Es wurden Fettsäuremethylester (FAMES) hergestellt, indem Gewebe in einem 13 × 100 mm Glasbehälter mit Schraubverschluss, der mit einer mit Teflon ausgekleideten Kappe versehen war, in 1,5 ml 1,0 M methanolischem HCl (Supelco Co.) eingebracht und für 2 Stunden auf 80°C erhitzt wurde. Beim Abkühlen wurde 1 ml Petroleumether zugegeben, und die FAMES wurden entfernt, indem die Etherphase abgedampft wurde, welche anschließend in einem Glasbehälter in einem Stickstoff-Strom getrocknet wurde. 100 &mgr;l N,O-Bis(trimethylsilyl)-trifluoracetamid (BSTFA; Pierce Chemical Co.) und 200 &mgr;l Acetonitril wurden zugegeben, um die Hydroxyl-Gruppen zu derivatisieren. Die Reaktion wurde bei 70°C für 15 Minuten ausgeführt. Die Produkte wurden in Stickstoff getrocknet, in 100 &mgr;l Chloroform gelöst und in ein Gaschromatograph-Behältnis gegeben. 2 &mgr;l jeder Probe wurden auf einer SP2340 Fused-Silica-Kapillarsäule (30 m, 0,75 mm ID, 0,20 mm Film, Supelco) analysiert, wobei ein Hewlett-Packard-Gaschromatograph der Serie 5890 II verwendet wurde. Die Proben wurden nicht aufgeteilt, das Temperaturprogramm betrug 195°C für 18 min, wurde mit 25°C/min auf 230°C erhöht, bei 230°C für 5 min gehalten und anschließend mit 25°C/min auf 195°C abgesenkt, und es wurden Flammenionisations-Detektoren verwendet.

Die chromatographische Elutionszeit von Methylestern und O-TMS-Derivaten von Rizinolsäure, Lesquerolsäure und Auricolsäure wurde durch GC-MS der Lipidproben von Samen von L. fendleri und Vergleich mit veröffentlichten Chromatogrammen von Fettsäuren dieser Spezies etabliert (Carlson et al., 1990). Es wurde ein O-TMS-Methyl-Rizinoleat-Standard aus Rizinolsäure hergestellt, die von Sigma Chemicals Co (St. Louis, MO) erhalten wurde. O-TMS-Methyl-Lesqueroleat-Standards und O-TMS-Methyl-Auricolat-Standards wurden ausgehend von Triacylglycerolen, die aus Samen von L. fendleri gereinigt worden waren, hergestellt. Das Massenspektrum von O-TMS-Methyl-Rizinoleat, O-TMS-Methyl-Densipoleat, O-TMS-Methyl-Lesqueroleat und O-TMS-Methyl-Auricoleat sind jeweils in den 1A–D gezeigt. Die Struktur der charakteristischen Ionen, die während der Massenspektrometrie dieser Derivate erzeugt werden, sind in 2 gezeigt.

Die aus dem transgenen Gewebe extrahierten Lipide wurden durch Gaschromatographie und Massenspektrometrie auf das Vorhandensein von hydroxylierten Fettsäuren untersucht. Zum Zwecke der Referenz sei darauf verwiesen, dass die durchschnittliche Fettsäurezusammensetzung von Blättern in einer Arabidopsis-Wildtyp-Linie und einer fad2-Mutanten-Linien von Miguel und Browse (1992) beschrieben wurden. Gachromatogramme von methylierten und silylierten Fettsäuren von Samen vom Wildtyp und von einer fah12-transgenen Wildtypflanze sind in den 3A bzw. 3B gezeigt. Die Profile sind sehr ähnlich, mit Ausnahme des Vorhandenseins von drei kleinen aber getrennten Peaks bei 14,3, 15,9 und 18,9 Minuten. Ein sehr kleiner Peak bei 20,15 Minuten war ebenfalls zu erkennen. Die Elutionszeit der Peaks bei 14,3 und 18,9 Minuten entsprach exakt denen der zum Vergleich hergestellten Rizinolsäure- bzw. Lesquerolsäure-Standards. In Lipidextrakten von Blättern oder Wurzeln des Wildtyps und der fah12-transgenen Wildtyplinien wurden keine signifikanten Unterschiede beobachtet (Tabelle 1). Obwohl das fah12-Gen in der ganzen Pflanze exprimiert wird, beobachteten wir Auswirkungen auf die Fettsäurezusammensetzung lediglich im Samengewebe. Eine ähnliche Beobachtung wurde bei transgenem fah12-Tabak gemacht.

Um zu bestätigen, dass die beobachteten neuen Peaks in den transgenen Linien den Derivaten von Rizinolsäure, Lesquerolsäure, Densipolsäure und Auricolsäure entsprachen, wurde eine Massenspektrometrie verwendet. Die Fettsäure-Derivate wurden wie oben beschrieben mittels Gaschromatographie aufgetrennt, mit der Ausnahme, dass ein massenselektiver Hewlett-Packard Detektor der 5971-Serie anstelle des Flammenionisationsdetektor aus dem vorherigen Experiment verwendet wurde. Die Spektren der vier neuen Peaks in 3B (Peaknummern 10, 11, 12 und 13) sind jeweils in den 4A–D gezeigt. Der Vergleich des Spektrums, das für die Standards erhalten wurde, mit dem Spektrum, das für die vier Peaks aus den transgenen Linien erhalten wurde, bestätigte die Identität der vier neuen Peaks. Auf Basis der drei charakteristischen Peaks bei M/Z 187, 270 und 299 wird Peak 10 unzweifelhaft als O-TMS-Methyl-Rizinoleat identifiziert. Auf Basis der drei charakteristischen Peaks bei M/Z 185, 270 und 299 wird Peak 11 unzweifelhaft als O-TMS-Methyl-Densipoleat identifiziert. Auf Basis der drei charakteristischen Peaks bei M/Z 187, 298 und 327 wird Peak 12 unzweifelhaft als O-TMS-Methyl-Lesqueroleat identifiziert. Auf Basis der drei charakteristischen Peaks bei M/Z 185, 298 und 327 wird Peak 13 unzweifelhaft als O-TMS-Methyl-Auricoleat identifiziert. Diese Ergebnisse zeigen eindeutig, dass die fah12-cDNA für eine Hydroxylase kodiert, welche sowohl Ölsäure hydroxyliert, wobei Rizinolsäure entsteht, als auch Icosensäure hydroxyliert, wobei Lesquerolsäure entsteht. Diese Ergebnisse liefern einen weiteren Beleg dafür, dass die Hydroxylase in einer heterologen Pflanzen-Spezies auf so exprimiert werden kann, dass das Enzym katalytisch funktionstüchtig ist. Diese Ergebnisse zeigen ferner, dass die Expression dieses Hydroxylase-Gens zur Akkumulierung von Rizinolsäure, Lesquerolsäure, Densipolsäure und Auricolsäure in einer Pflanzen-Spezies führt, die normalerweise keine hydroxylierten Fettsäuren in extrahierbaren Lipiden akkumuliert.

Das Vorhandensein von Lesquerolsäure in den transgenen Pflanzen wurde in der vorhergehenden Patentanmeldung (Nr. 08/320,982) auf Basis des biochemischen Hinweises, der eine breite Substratspezifität der kappa-Hydroxylase verriet, angenommen. Im Gegensatz dazu war die Akkumulierung von Densipol- und Auricolsäure schlechter vorhersagbar. Da Arabidopsis normalerweise keine signifikanten Mengen des nicht-hydroxylierten Vorläufers dieser Fettsäuren umfasst, die als Substrate für die Hydroxylase dienen können, scheint es, dass ein oder mehrere der drei in Arabidopsis bekannten n-3-Fettsäure-Desaturasen (z.B. fad3, fad7, fad8; Überblick in Gibson et al., 1995) in der Lage sind, die hydroxylierten Verbindungen an der n-3-Position zu desaturieren. Dies bedeutet, dass Densipolsäure durch die Wirkung einer n-3-Desaturase auf Rizinolsäure produziert wird. Auricolsäure wird durch die Wirkung einer n-3-Desaturase auf Lesquerolsäure produziert. Die fad3-Desaturase ist mit annähernder Sicherheit dafür verantwortlich, da sie im endoplasmatischen Retikulum lokalisiert ist. Dies kann zukünftig getestet werden, indem fah12-enthaltene transgene Pflanzen aus der fad3-defizienten Mutante von Arabidopsis hergestellt werden (ähnliche Experimente können mit fad7 und fad8 durchgeführt werden). Es ist ferner formell möglich, dass die Enzyme, die normalerweise 18:1cis&Dgr;9 zu 20:1cis&Dgr;11 elongieren 12OH-18:1cis&Dgr;9 zu 14OH-20:1cis&Dgr;11 elongieren und 12OH-18:2cis&Dgr;9,15 zu 14OH-20:2cis&Dgr;11,17.

Die Menge der verschiedenen Fettsäuren in Lipiden von Samen, Blatt und Wurzel der Kontrolle und der transgenen Pflanzen ist in Tabelle 1 dargestellt. Obwohl die Menge an hydroxylierten Fettsäuren, die in diesem Beispiel produziert wurden, geringer ist, als es für die kommerzielle Produktion von Rizinoleat und anderen hydroxylierten Fettsäuren aus Pflanzen erwünscht ist, streben wir zahlreiche Verbesserungen dieser Erfindung an, die das Niveau der Akkumulierung von hydroxylierten Fettsäuren in Pflanzen, welche das fah12-Hydroxylase-Gen oder verwandte Hydroxylase-Gene exprimieren, erhöhen werden. Verbesserungen beim Ausmaß und bei der Gewebespezifität der Expression des Hydroxylase-Gens sind angestrebt. Verfahren, die dies durch Verwendung eines starken, samenspezifischen Promotors, wie dem Napin-Promotor aus B. napus, oder durch Verwendung der nativen Promotoren des fah12-Gens aus Rizinus oder des entsprechenden Hydroxylase-Gens von L. fendleri, erreichen werden, werden für den Fachmann offensichtlich sein. Zusätzliche angestrebte Verbesserungen betreffen die Modifikation der Enzyme, welche die hydroxylierten Fettsäuren von Phosphatidylcholin abspalten, die Verringerung der Aktivität von Enzymen, die hydroxylierte Fettsäuren abbauen, sowie das Ersetzen von Acyltransferasen, die hydroxylierte Fettsäuren zu den sn-1-, sn-2- und sn-3-Positionen der Glycerol-Lipide transferieren. Obwohl Gene für diese Enzyme in der wissenschaftlichen Literatur nicht beschrieben worden sind, kann ihre Nützlichkeit bei der Verbesserung des Ausmaßes der Produktion von hydroxylierten Fettsäuren ohne weiteres basierend auf den Ergebnissen der biochemischen Untersuchungen der Rizinoleat-Synthese abgesehen werden.

Obgleich Arabidopsis keine ökonomisch wichtige Pflanzen-Spezies ist, ist sie in weitem Umfang bei Pflanzenbiologen als Modell für höhere Pflanzen anerkannt. Daher soll die Aufnahme dieses Beispiels die allgemeine Nützlichkeit der vorliegend beschriebenen Erfindung zeigen, um die Öl-Zusammensetzung in höheren Pflanzen zu modifizieren. Ein Vorteil der Untersuchung der Expression des neuen Gens in Arabidopsis besteht darin, dass beträchtliches Wissen über den Lipid-Metabolismus in diesem System besteht, und eine Sammlung von Mutanten verfügbar ist, die dazu verwendet werden kann, nützliche Informationen in Bezug auf die Biochemie der Fettsäure-Hydroxylierung in Pflanzen-Spezies zu erlangen. Ein weiterer Vorteile besteht darin, dass alle Informationen, die über den Rizinoleat-Metabolismus in Arabidopsis erhalten wurden, leicht auf eng verwandte Spezies, wie beispielsweise die Nutzpflanzen Brassica napus, Brassica juncea oder Crambe abyssinica, übertragen werden können, um Rizinoleat, Lesqueroleat und andere hydroxylierte Fettsäuren für die industrielle Verwendung in großen Mengen zu produzieren. Die kappa-Hydroxylase ist für die Produktion von Rizinoleat oder Lesqueroleat in jeder beliebigen Pflanzen-Spezies nützlich, welche signifikante Mengen der Vorläufer, Ölsäure und Icosensäure, akkumuliert. Von besonderem Interesse sind genetisch modifizierte Varianten, die große Mengen Ölsäure akkumulieren. Solche Varianten sind gegenwärtig für Sonnenblume und Canola verfügbar. Die Produktion von Lesquerolsäure und verwandten Hydroxy-Fettsäuren kann in Spezies erreicht werden, die große Mengen an Icosensäure und anderen langkettigen Monoensäuren akkumulieren. Solche Pflanzen könnten in der Zukunft mittels Gentechnik aus Pflanzen hergestellt werden, die solche Vorläufer normalerweise nicht produzieren. Wir nehmen daher an, dass die Verwendung von kappa-Hydroxylase von allgemeiner Nützlichkeit ist.

BEISPIEL 2: ISOLIERUNG EINES GENOMISCHEN KLONS FÜR DIE LESQUERELLA-KAPPA-HYDROXYLASE Überblick

Nukleotidsequenzregionen, die sowohl in der Rizinus-kappa-Hydroxylase als auch in der Arabidopsis-fad2-&Dgr;12-Fettsäure-Desaturase konserviert sind, wurden verwendet, um Oligonukleotid-Primer zu erstellen. Diese wurden mit genomischer DNA von Lesquerella fendleri verwendet, um Fragmente mehrerer homologer Gene zu amplifizieren. Diese amplifizierten Fragmente wurden anschließend als Hybridisierungssonden verwendet, um genomische Klone vollständiger Länge aus einer genomischen Bibliothek von L. fendleri zu identifizieren. Hydroxylierte Fettsäuren sind für das Samengewebe von Lesquerella sp. spezifisch und werden in vegetativen Geweben nicht in einem nennenswerten Umfang gefunden. Eines der zwei Gene, die durch dieses Verfahren identifiziert wurden, wurde sowohl in Blättern als auch in sich entwickelnden Samen exprimiert, und es wird daher angenommen, dass es der &Dgr;12-Fettsäure-Desaturase entspricht. Das andere Gen wurde in sich entwickelnden Samen im hohen Ausmaß exprimiert, es wurde jedoch nicht oder nur in sehr geringem Ausmaß in Blättern exprimiert; es handelt sich um die kappa-Hydroxylase dieser Spezies. Die Identität dieses Gens wird durch Einbringen des Gens in transgene Arabidopsis-Pflanzen und Nachweis, dass dies die Akkumulierung von Rizinolsäure, Lesquerolsäure, Densipolsäure und Auricolsäure in den Lipiden des Samens bewirkt, nachgewiesen. Der Promotor dieses Gens ist ebenfalls von Nutzen, da er in der Lage ist, die Expression eines Gens in sich entwickelnden Samen zu einer Zeit zu steuern, zu der Speicherlipide akkumuliert werden. Dieser Promotor ist somit von großem Nutzen für zahlreiche Anwendungen bei der Genmanipulation von Samen, insbesondere bei Mitgliedern der Brassicaceen.

Die verschiedenen Schritte, die an diesem Vorgang beteiligt sind, werden nachfolgend im Detail beschrieben. Sofern nicht anders angegeben, werden zur Manipulation von Nukleinsäuren, Bakterien und Phagen Routineverfahren angewendet wie sie in Sambrook et al. (1989) beschrieben werden.

Isolierung eines Fragments des kappa-Hydroxylase-Gens aus Lesquerella

Oligonukleotid-Primer für die Amplifikation der kappa-Hydroxylase aus L. fendleri wurden erstellt, indem Regionen mit hoher Homologie der abgeleiteten Aminosäuresequenz zwischen der Rizinus-kappa-Hydroxylase und der Arabidopsis-&Dgr;12-Desaturase (fad2) ausgewählt wurden. Da die meisten Aminosäuren durch mehrere unterschiedliche Kodons kodiert werden, wurden diese Oligonukleotide so erstellt, dass sie alle möglichen Kodons umfassten, die für die entsprechenden Aminosäuren kodieren können. Die Sequenz dieser gemischten Oligonukleotide war:

Oligo 1: TAYWSNCAYMGNMGNCAYCA (SEQ ID NO: 14)

Oligo 2: RTGRTGNGCNACRTGNGTRTC (SEQ ID NO: 15)

(wobei: Y = C + T; W = A + T; S = G + C; N = A + G + C + T; M = A + C; R = A + G ist).

Diese Oligonukleotide wurde dazu verwendet, ein DNA-Fragment der genomischen DNA von L. fendleri durch Polymerase-Kettenreaktion (PCR) unter Verwendung der folgenden Bedingungen zu amplifizieren: Ungefähr 100 ng genomischer DNA wurden zu einer Lösung gegeben, die 25 pmol jedes Primers, 1,5 U Taq-Polymerase (Boehringer Mannheim), 200 &mgr;M dNTPs, 50 mM KCl, 10 mM Tris-HCl (pH 9), 0,1 % (v/v) Triton X-100, 1,5 mM MgCl2, 3 % (v/v) Formamid enthielt, wobei ein Endvolumen von 50 &mgr;l erhalten wurde. Die Amplifikationsbedingungen waren: 4 min Denaturierungsschritt bei 94°C, gefolgt von 30 Zyklen bei 92°C für 1 min, 55°C für 1 min, 72°C für 2 min. Ein finaler Extensionsschritt bei 72°C für 5 min schloss das Programm ab.

Nach elektrophoretischer Trennung der Produkte der PCR-Reaktion in Agarosegelen wurden PCR-Produkte von ungefähr 540 bp beobachtet. Zwei dieser Fragmente wurden in pBluescript (Stratagene) kloniert, wodurch die Plasmide pLesq2 und pLesq3 entstanden. Die Sequenz der Inserts in diesen zwei Plasmiden wurde durch Kettenabbruchverfahren bestimmt. Die Sequenz des Inserts von pLesq2 ist als 5 dargestellt (SEQ ID NO: 1) und die Sequenz des Inserts von pLesq3 ist als 6 dargestellt (SEQ ID NO: 2). Der hohe Grad an Sequenzidentität zwischen den zwei Klonen verweist darauf, dass diese potentielle Kandidaten waren, entweder eine &Dgr;12-Desaturase oder eine gamma-Hydroxylase zu sein.

Northern-Analyse

In L. fendleri werden hydroxylierte Fettsäuren in großen Mengen in Samenölen gefunden, jedoch nicht in nennenswerten Mengen in den Blättern. Daher besteht ein wichtiges Kriterium bei der Unterscheidung zwischen einer Fettsäure-Desaturase und einer kappa-Hydroxylase darin, dass man erwartet, dass das kappa-Hydroxylase-Gen in Geweben mit einem hohen Gehalt an hydroxylierten Fettsäuren stärker exprimiert wird als in anderen Geweben, wohingegen alle Pflanzengewebe mRNA für eine &ohgr;6-Fettsäure-Desaturase enthalten sollten, da zweifach ungesättigte Fettsäuren in den Lipiden aller Gewebe in den meisten oder in allen Pflanzen gefunden werden. Daher war es von großem Interesse zu bestimmen, ob das Gen, welches pLesq2 entspricht, ebenfalls nur in Samen exprimiert wird, oder ob es auch in anderen Geweben exprimiert wird. Dieser Frage wurde nachgegangen, indem man die Hybridisierung von pLesq2 an RNA, die aus sich entwickelnden Samen oder von Blättern erhalten wurde, untersuchte.

Gesamt-RNA wurde aus sich entwickelnden Samen und jungen Blättern von L. fendleri unter Verwendung eines Rneasy-RNA-Extraktions-Kits (Qiagen) gemäß den Anweisungen des Herstellers gereinigt. Die RNA-Konzentrationen wurden durch UV-Spektrophotometrie bei &lgr; = 260 und 280 nm quantifiziert. Um sicherzustellen, dass das für den Northernblot verwendete Gel gleichmäßig beladen wurde, wurden die RNA-Konzentrationen weiter angepasst, nachdem die Fluoreszenz der mit Ethidiumbromid gefärbten und auf einem denaturierenden Testgel getrennten RNA-Proben unter UV-Licht aufgenommen worden war.

Die wie oben beschrieben präparierte Gesamt-DNA aus Blättern und sich entwickelnden Samen wurde elektrophoretisch auf einem Agarosegel getrennt, das Formaldehyd enthielt (Iba et al., 1993). Eine gleiche Menge (10 &mgr;g) RNA wurde in beide Spuren geladen, und RNA-Standards (0,16 bis 1,77 kb-Leiter, Gibco-BRL) wurden in die dritte Spur geladen. Nach der Elektrophorese wurde die RNA vom Gel auf eine Nylonmembran (Hybond N+, Amersham) übertragen und durch Einwirken von UV-Licht auf dem Filter fixiert. Eine 32P-markierte Sonde wurde durch Random-Priming aus der Insert-DNA des Klons pLesq2 hergestellt und über Nacht bei 52°C mit der Membran hybridisiert, nachdem diese für 2 Stunden vorhybridisiert worden war. Die Vorhybridisierungslösung enthielt 5X SSC, 10X Denhardt-Lösung, 0,1 % SDS, 0,1 M KPO4 pH 6,8, 100 &mgr;g/ml Lachssperma-DNA. Die Hybridisierungslösung hatte dieselbe Basiszusammensetzung, enthielt jedoch kein SDS und enthielt 10 % Dextransulfat und 30 % Formamid. Der Blot wurde einmal in 2X SSC, 0,5 % SDS bei 65°C und anschließend in 1X SSC bei derselben Temperatur gewaschen.

Ein kurzes Einwirken (30 min) des Blots auf einen Röntgenfilm zeigte, dass die Sonde pLesq2 mit einer einzelnen Bande hybridisiert, die lediglich in der Spur mit der Samen-RNA vorhanden war (7). Der Blot wurde erneut mit dem Insert des pLesq3-Gens als Sonde untersucht, was zu Banden ähnlicher Intensität in den Spuren der Samen und der Blätter führte (7).

Diese Ergebnisse zeigen, dass das Gen, welches dem Klon pLesq2 entspricht, in hohem Maße und spezifisch in den Samen von L. fendleri exprimiert wird. In Verbindung mit der Kenntnis der Nukleotidsequenz und der abgeleiteten Aminosäuresequenz ist eine Samen-spezifische Expression des Gens, das dem Insert in pLesq2 entspricht, ein überzeugender Indikator einer Rolle des Enzyms bei der Synthese von hydroxylierten Fettsäuren in Samenöl.

Charakterisierung eines genomischen Klons für die gamma-Hydroxylase

Genomische DNA wurde wie von Murray und Thompson (1980) beschrieben aus jungen Blättern von L. fendleri isoliert. Eine genomische Bibliothek aus einem partiellem Sau3AI-Verdau, die in dem Vektor &lgr;DashII (Stratagene, 11011 North Toorey Pines Road, La Jolla, CA 92037) konstruiert wurde, wurde durch partielles Verdauen von 500 &mgr;g DANN, Größenselektion der DNA in einem Sucrosegradient (Sambrook et al., 1989) und Ligieren der DNA (durchschnittliche Größe 12 kb) mit dem BamHI-verdauten Arm von &lgr;DashII hergestellt. Die gesamte Ligation wurde gemäß den Bedingungen des Herstellers gesammelt und auf den E. coli Stamm XL1-Blue MRA-P2 (Stratagene) ausplattiert. Dies ergab 5 × 105 primäre rekombinante Klone. Die Bibliothek wurde anschließend gemäß den Bedingungen des Herstellers amplifiziert. Eine Fraktion der genomischen Bibliothek wurde auf E. coli XL1-Blue ausplattiert, und die resultierenden Plaques (150000) wurden gemäß den Bedingungen des Herstellers auf geladene Nylonmembranen (Hybond N+, Amersham) überführt. Die DNA wurde mittels UV in einem Stratalinker (Stratagene) mit den Filtern quervernetzt.

Mehrere Klone, die genomische DNA-Sequenzen trugen, welche der Hydroxylase von L. fendleri entsprachen, wurden isoliert, indem man die Membranen mit dem Insert von pLesq2 als Sonde untersuchte, das mittels PCR mit internen Primer amplifiziert und mit 32P durch Random-Priming markiert worden war. Die Filter wurden für 2 Stunden bei 65°C in 7 % SDS, 1 mM EDTA, 0,25 M Na2HPO4 (pH 7,2), 1 % BSA prähybridisiert und für 16 Stunden in derselben Lösung mit der Sonde hybridisiert. Die Filter wurden nacheinander bei 65°C in Lösungen gewaschen, die 2X SSC, 1X SSC, 0,5 X SSC und zusätzlich 0,1 % SDS enthielten. Ein 2,6 kb-XbaI-Fragment, das die vollständige kodierende Sequenz für die gamma-Hydroxylase und ungefähr 1 kb der 5'-stromaufwärts gelegenen Region enthielt, wurde in die entsprechende Stelle des pBluescript KS subkloniert, wobei das Plasmid pLesq-Hyd entstand, und die Sequenz wurde vollständig durch das Dideoxy-Kettenbabbruchs-Verfahren unter Verwendung eines automatischen Sequenziergerätes bestimmt. Die Sequenzdaten wurden unter Verwendung des Programms DNASIS (Hitachi Company) untersucht.

Die Sequenz des Inserts von Klon pLesq-Hyd ist in den 8A–B gezeigt. Die Sequenz enthält 1855 bp kontinuierliche DNA-Sequenz (SEQ ID NO: 3). Der Klon kodiert eine 5'-nicht-translatierte Region von 401 bp (d.h. Nukleotide, die dem ersten ATG-Kodon voranstehen), einen offenen Leserahmen von 1152 bp sowie eine 3'-untranslatierte Region von 302 bp. Der offene Leserahmen kodiert ein Protein von 384 Aminosäuren mit einem vorhergesagten Molekulargewicht von 44370 (SEQ ID NO: 4). Der Amino-Terminus weist keine Merkmale eines typischen Signalpeptids auf (von Heijne, 1985).

Das genaue Translations-Initiations-Methionin ist experimentell nicht bestimmt worden; man nimmt jedoch auf Basis der abgeleiteten Aminosäuresequenz-Homologie zu der Rizinus-kappa-Hydroxylase (unten angemerkt) an, dass es sich um das Methionin handelt, welches von dem ersten ATG-Kodon bei Nukleotid 402 kodiert wird.

Der Vergleich der abgeleiteten Aminosäuresequenz von pLesq-Hyd mit Sequenzen Membran-gebundener Desaturasen und der Rizinus-Hydroxylase (9A–B) zeigt, dass pLesq-Hyd homolog zu diesen Genen ist. Die Figur zeigt ein Alignment der Hydroxylase von L. fendleri (SEQ ID NO: 4) mit der Hydroxylase von Rizinus (van de Loo et al., 1995), der Arabidopsis fad2-cDNA, die eine im endoplasmatischen Retikulum lokalisierte &Dgr;12-Desaturase (fad2 genannt) kodiert (Okuley et al., 1994), zwei fad2-Desaturase-Klonen aus der Sojabohne, einem Brassica napus-fad2-Klon, einem Zea mays-fad2-Klon und der partiellen Sequenz eines fad2-Klons aus R. communis. Der hohe Grad an Sequenzhomologie verweist darauf, dass die Genprodukte ähnliche Funktionen aufweisen. So beträgt beispielsweise die Gesamthomologie zwischen der Lesquerella-Hydroxylase und der Arabidopsis-fad2-Desaturase 92,2 % Ähnlichkeit und 84,8 % Identität, und die zwei Sequenzen unterscheiden sich hinsichtlich ihrer Länge lediglich in einer Aminosäure.

Southern-Hybridisierung

Die Southernanalyse wurde verwendet, um die Kopienzahl der Gene im Genom von L. fendleri zu bestimmen, die dem pLesq-Hyd-Klon entsprachen. Genomische DNA (5 &mgr;g) wurde mit EcoRI, HindIII und XbaI verdaut und auf einem 0,9%igen Agarosegel getrennt. Die DNA wurde gemäß dem Protokoll des Herstellers mittels Alkali-Blot auf eine geladene Nylonmembran (Hybond N+. Amersham) übertragen. Der Blot wurde für 2 Stunden bei 65°C in 7 % SDS, 1 mM EDTA, 0, 25 M Na2HPO4 (pH 7,2), 1 % BSA vorhybridisiert und für 16 Stunden in derselben Lösung mit der Sonde hybridisiert, wobei das pLesq-Hyd-Insert mit internen Primern PCR-amplifiziert und durch Random-Priming mit 32P markiert worden war. Die Filter wurden nacheinander bei 65°C in Lösungen gewaschen, die 2X SSC, 1X SSC, 0,5X SSC und zusätzlich 0,1 % SDS enthielten und anschließend einem Röntgenfilm ausgesetzt.

Die Sonde hybridisierte mit einer einzelnen Bande in jedem Verdau der DNA von L. fendleri (10), was darauf verweist, dass das Gen, von dem pLesq-Hyd transkribiert wird, in einer einzelnen Kopie im Genom von L. fendleri vorliegt.

Expression von pLesq-Hyd in transgenen Pflanzen

Es gibt eine große Vielzahl von Pflanzen-Promotorsequenzen, die verwendet werden können, um eine Gewebe-spezifische Expression von klonierten Genen in transgenen Pflanzen zu bewirken. Der Napin-Promotor und die Promotoren des Acylcarrierproteins sind beispielsweise bereits zuvor bei der Modifikation der Zusammensetzung von Samenöl durch Expression einer Antisense-Form einer Desaturase verwendet worden (Knutsen et al., 1992). Von dem Promotor der &bgr;-Untereinheit des Sojabohnen-&bgr;-Conglycinin ist gezeigt worden, dass er in hohem Maße aktiv ist und zu einer Gewebe-spezifischen Expression in transgenen Pflanzen anderer Spezies als der Sojabohne führt (Bray et al., 1987). Obwohl wir die Verwendung des kappa-Hydroxylase-Promotors aus L. fendleri in den vorleiegenden Beispielen beschrieben haben, können auch andere Promotoren für die Herstellung einer modifizierter Samenöl-Zusammensetzungen verwendet werden, die zu einer Samen-spezifischer Expression führen. Solche Modifikationen der vorliegend beschriebenen Erfindung werden für den Fachmann offensichtlich sein.

Konstrukte für die Expression der kappa-Hydroxylase von L. fendleri in Pflanzenzellen werden wie folgt hergestellt: Ein 13 kb-SalI-Fragment, welches das pLesq-Hyg-Gen enthielt, wurde in die XhoI-Schnittstelle des binären Ti-Plasmid-Vektors pSLJ44026 (Jones et al., 1992) (11) kloniert, wobei das Plasmid pTi-Hyd entstand, und durch Elektroporation in den Agrobacterium tumefaciens-Stamm GV3101 transformiert. Der Stamm GV3101 (Koncz und Schell, 1986) enthält ein „unbewaffnetes" (disarmed) Ti-Plasmid. Zellen für die Elektroporation wurden wie folgt hergestellt. GV3101 wurde in LB-Medium mit verringertem NaCl (5 g/l) angezüchtet. Eine 250 ml-Kultur wurde bis zu einer OD600 = 0,6 angezüchtet und anschließend bei 4000 UpM für 15 Minuten zentrifugiert (Sorvall GS-A-Rotor). Der Überstand wurde unverzüglich von dem lockeren Pellet abgezogen, und das Pellet wurde vorsichtig in 500 ml eiskaltem Wasser resuspendiert. Die Zellen wurden wie zuvor zentrifugiert, in 30 ml eiskaltem Wasser resuspendiert, und in ein 30 ml-Gefäß transferiert und bei 5000 UpM für 5 min zentrifugiert (Sorvall SS-34-Rotor). Dies wurde dreimal wiederholt, wobei die Zellen nacheinander in 30 ml eiskaltem Wasser, 30 ml eiskaltem 10%igem Glycerol und schließlich in 0,75 ml eiskaltem 10%igen Glycerol resuspendiert wurden. Die Zellen wurden aliquotiert, in flüssigem Stickstoff gefroren und bei –80 °C gelagert.

Bei den Elektroporationen wurde ein Biorad-Gene-Pulsar-Instrument unter Verwendung kalter 2 ml-gap-Küvetten, die 40 &mgr;l Zellen und 1 &mgr;l DNA in Wasser enthielten, bei einer Spannung von 2,5 KV und 200 Ohm Widerstand eingesetzt. Die elektroporierten Zellen wurden mit 1 ml SOC-Medium (Sambrook et al., 1898, Seite A2) verdünnt und bei 28°C für 2–4 Stunden inkubiert, bevor sie auf Kanamycin-enthaltendem Medium (50 mg/l) ausplattiert wurden.

Arabidopsis thaliana kann mit den Agrobacterium-Zellen transformiert werden, die das pTi-Hyd entahlten, wie oben in Beispiel 1 beschrieben ist. Das Vorhandensein von hydroxylierten Fettsäuren in transgenen Arabidopsis-Pflanzen kann ebenfalls durch die oben in Beispiel 1 beschriebenen Verfahren nachgewiesen werden.

Konstitutive Expression der Hydroxylase aus L. fendleri in transgenen Pflanzen

Ein 1,5 kb-EcoRI-Fragment von pLesq-Hyg, das die gesamte kodierende Region der Hydroxylase umfasste, wurde aus dem Gel gereinigt, und anschließend in die entsprechende Schnittstelle von pBluescript KS (Stratagene) kloniert. Die Plasmid-DNA von mehreren rekombinanten Klonen wurde anschließend mit PstI geschnitten, das jeweils nur einmal in dem Insert und einmal in der Polylinkersequenz des Vektors schneiden sollte. Die Freisetzung eines 920 bp-Fragments mit PstI zeigte die richtige Orientierung des Inserts für weitere Manipulationen. DNA aus einem solchen Klon wurde weiter mit SalI geschnitten, die 5'-Überhänge wurden mit dem Klenow-Fragment der DNA-Polymerase I aufgefüllt und anschließend mit SacI geschnitten. Das Insert-Fragment wurde aus dem Gel gereinigt und zwischen die SmaI- und SacI-Schnittstellen von pBI121 (Clontech) hinter den Blumenkohl-Mosaikvirus 35S-Promotor kloniert. Nachdem geprüft worden war, dass die Sequenz der Verbindung zwischen Insert- und Vektor-DNA passend war, wurde Plasmid-DNA eines rekombinanten Klons verwendet, um A. tumefaciens (GV3101) zu transformieren. Kanamycin-resistente Kolonien wurden anschließend wie zuvor beschrieben für eine in planta-Transformation von A. thaliana verwendet.

DNA aus Kanamycin-resistenten Keimlingen wurde extrahiert und dazu verwendet, ausgewählte Fragmente der Hydroxylase unter Verwendung von nested-Primern mittels PCR zu amplifizieren. Wenn Fragmente der erwarteten Größe amplifiziert werden konnten, wurden die entsprechenden Pflanzen in einem Gewächshaus oder auf Agarplatten angezüchtet, und die Fettsäuren wurden von vollständig ausgebildeten Blättern, Wurzeln und getrockneten Samen extrahiert. Es wurde anschließend eine GC-MS-Analyse wie zuvor beschrieben durchgeführt, um die unterschiedlichen Fettsäure-Arten zu charakterisieren und die Akkumulierung von Hydroxyfettsäuren in transgenen Geweben zu detektieren.

BEISPIEL 3 – ERHALT VON ANDEREN PFLANZEN-FETTSÄURE-HYDROXYLASEN

In einer vorhergehenden Patentanmeldung haben wir Wege beschrieben, auf denen die Rizinus-fah12-Sequenz verwendet werden kann, um andere kappa-Hydroxylasen durch Verfahren wie PCR und heterologe Hybridisierung zu identifizieren. Aufgrund des hohen Grads an Sequenzähnlichkeit zwischen &Dgr;12-Desaturasen und kappa-Hydroxylasen stellt der Stand der Technik jedoch keine Lehre bereit, wie zwischen den beiden Arten von Enzymen ohne funktionalen Test, wie beispielsweise Nachweis der Aktivität in transgenen Pflanzen oder in einem anderen geeigneten Wirt (z.B. transgene mikrobielle oder tierische Zellen), unterschieden werden kann. Die Identifizierung der Hydroxylase aus L. fendleri sorgt für die Entwicklung von Kriterien, mittels derer eine Hydroxylase und eine Desaturase allein auf Basis der abgeleiteten Aminosäuresequenz-Information voneinander unterschieden werden können.

Die 9A–B zeigen ein Sequenz-Alignment der Hydroxylase-Sequenzen aus Rizinus und L. fendleri mit der Hydroxylase-Sequenz aus Rizinus und allen öffentlich verfügbaren Sequenzen aller mikrosomaler &Dgr;12-Fettsäure-Desaturasen aus Pflanzen. Von den 384 Aminosäureresten in der Rizinus-Hydroxylase-Sequenz sind mehr als 95 % identisch mit dem entsprechenden Rest in mindestens einer der Desaturase-Sequenzen. Daher ist keiner dieser Reste für die katalytischen Unterschiede zwischen Hydroxylase und Desaturase verantwortlich. Von den verbleibenden 16 Resten in der Rizinus-Hydroxylase und den 14 Resten in der Lesquerella-Hydroxylase stellen alle bis auf sechs Fälle dar, in denen die Hydroxylase-Sequenz einen konservativen Austausch im Vergleich mit einer oder mehreren der Desaturase-Sequenzen aufweist, oder es gibt eine große Variabilität hinsichtlich der Aminosäure in dieser Position in den verschiedenen Desaturasen. Mit konservativ meinen wir, dass die folgenden Aminosäuren funktionell äquivalent sind: Ser/Thr, Ile/Leu/Val/Met, Asp/Glu. Diese strukturellen Unterschiede können somit nicht zu den katalytischen Unterschieden zwischen Desaturasen und Hydroxylasen beitragen. Dies lässt lediglich sechs Aminosäurereste übrig, in denen sowohl die Rizinus-Hydroxylase als auch die Lesquerella-Hydroxylase von allen bekannten Desaturasen abweichen, und in denen alle bekannten mikrosomalen &Dgr;12-Desaturasen einen identischen Aminosäurerest aufweisen. Diese Reste treten an den Positionen 69, 111, 155, 226, 304 und 331 des Alignments in 9 auf. Daher unterscheiden diese sechs Reste Hydroxylasen von Desaturasen. Basierend auf dieser Analyse behaupten wir, dass ein beliebiges Enzym mit einer Sequenzidentität von mehr als 60 % zu einem der Enzyme, die in 9 aufgeführt sind, als Hydroxylase klassifiziert werden kann, wenn es sich von der Sequenz der Desaturasen an diesen sechs Positionen unterscheidet. Aufgrund leichter Unterschiede bezüglich der Anzahl der Reste in einem bestimmten Protein kann die Nummerierung von Protein zu Protein abweichen; der Sinn des Nummerierungssystems wird jedoch ersichtlich sein, wenn das betreffende Protein mit der Rizinus-Hydroxylase unter Verwendung des vorliegend gezeigten Nummerierungssystems in einem Alignment gegenübergestellt wird. Somit zeigen die vorliegend offenbarten strukturellen Kriterien in Zusammenhang mit den Verfahren zur Verwendung des Lesquerella-Hydroxylase-Gens für die Isolierung homologer Gene, wie Pflanzen-kappa-Hydroxylase-Gene zum Zwecke der genetischen Modifizierung einer Fettsäurezusammensetzung isoliert und identifiziert werden können.

Wenn man überlegt, welche der sechs Substitutionen allein oder primär für die Unterschiede bezüglich der katalytischen Aktivität der erfindungsgemäßen Hydroxylasen und der Desaturasen verantwortlich ist, sehen wir es als wahrscheinlich an, dass das Ersetzen eines Phe durch ein Tyr in Position 226 wegen der bekannten Teilnahme von Tyrosin-Radikalen bei der enzymatischen Katalyse ausschließlich für diesen Unterschied bezüglich der katalytischen Aktivität verantwortlich sein könnte. Andere Substitutionen wie Ala durch Ser in Position 331 können Auswirkungen beim Modulieren der Gesamtgeschwindigkeit der Reaktion haben. Auf dieser Basis streben wir die Erzeugung neuer kappa-Hydroxylasen durch ortsspezifische Mutagenese von &Dgr;12-Desaturasen an. Wir streben ferner die Umwandlung von &Dgr;15-Desaturasen und &Dgr;9-Desaturasen zu Hydroxylasen durch eine ähnliche Anwendung der ortsspezifischen Mutagenese an.

ABSCHLIESSENDE BEMERKUNGEN

Durch die obigen Beispiele wird der Nachweis entscheidener Faktoren bei der Herstellung von neuen hydroxylierten Fettsäuren durch Expression eines kappa-Hydroxylase-Gens aus Rizinus in transgenen Pflanzen beschrieben. Darüber hinaus wird eine vollständige cDNA-Sequenz der kappa-Hydroxylase von Lesquerella fendleri bereitgestellt. Eine vollständige Sequenz der Rizinus-Hydroxylase wird ebenfalls in verschiedenen Konstrukten zur Verwendung in Wirtszellen bereitgestellt. Durch diese Erfindung kann man für eine Vielzahl von Anwendungen die Aminosäure- und Nukleinsäuresequenzen erhalten, die für Pflanzen-Fettsäure-Hydroxylasen vielfältigen Ursprungs kodieren.

Literaturhinweise

  • Beltz, G.A., Jacobs, K.A., Eickbuch, T.H., Cherbas, P.T., Kafatos, F.C. (1983) Isolation of multigene families and determination of homologies by filter hybridization methods. Methods in Enzymology 100, 266–285.
  • Bray, E.A., Naito, S., Pan, N.S., Anderson, E., Dube, P., Beachy, R. N. (1987) Expressian of the &bgr;-subunit of &bgr;-conglycinin in seeds of transgenic plants. Planta 172:364–370.
  • Carlson, K.D., Chaudhry, A., Bagby, M.O (1990) Analysis of oil and meal from lesquerella fendleri seed. J. Am. Oil Chem. Soc. 67, 438–442.
  • Ditta, G., Stanfield, S., Corbin, D., Helinski, D.R. (1980) Broad host range DNA cloning system for gram-negative bacteria: Construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77,7347–7351.
  • Gould, S.J., Subramani, S., Scheffler, I.E. (1989) Use of the DNA polymerase chain reaction for homology probing. Proc. Natl. Acad. Sci. USA 86, 1934–1938.
  • Hirsinger, F. (1989) New oil crops, in Oil Crops of the World, Robbelen, G., Downey, K.R., and Ashri, A., Eds., McGraw-Hill, New York, pp. 518–533.
  • Howling, D., Morris, L.J., Gurr, M.I., James, A.T. (1972) The specificity of fatty acid desaturases and hydroxylases. The dehydrogenation and hydroxylation of monoenoic acids, Biochim. Biophys. Acta 260, 10.
  • Huyuh, T.V., Young, R.A., Davis, R.W. (1985) Constructing and screening cDNA libraries in &lgr;gt10 and &lgr;gt11. In DNA Cloning, Vol. 1: A Practical Approach, (ed) D.M. Glover. IRL Press, Washington DC pp 49–77.
  • Iba, K., Gibson, S., Nishiuchi, T., Fuse, T., Nishimura, M., Arondel, V., Hugly, S., and Somerville, C. (1993) A gene encoding a chloroplast omega-3 fatty acid desaturase complements alterations in fatty acid desaturation and chloroplast copy number of the fad7 mutant of Arabidopsis thaliana. J. Biol. Chem. 268, 24099–24105.
  • Jones, J.D.G., Shlumukov, L., Carland, F., English, J., Scofield, S., Bishop, G.J., Harrison, K. (1992) Effective vectors for transformation, expression of heterologous genes, and assaying transposon excision in transgenic plants. Transgenic Res. 1, 285–297.
  • Knutson, D.S., Thompson, G.A., Radke, S.E., Johnson, W.B., Knauf, V.C., Kridl, J.C. (1992) Proc. Natl. Acad. Sci. USA 89, 2624–2628.
  • Koncz, C., Schell, J. (1986) The promoter of Tl-DNA gene 5 controls the tissue-specific expression of chimeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. 204, 383–396.
  • Miquel, M. Browse, J. (1992) Arabidopsis mutants deficient in polyunsaturated fatty acid synthesis. J. Biol. Chem. 267, 1502–1509.
  • Murray, M.G., Thompson, W. F. (1980) Rapid isolation of high molecular weight plant DNA. Nucl. Acid Res. 8, 4321–4325.
  • Okukey, J., Lightner, J., Feldman, K., Yadav, N., Lark, E., Browse, J. (1994) Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid
  • Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecular Cloning: a Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, 1989.
  • Smith C.R., Jr. (1985) Unusual seed oils and their fatty acids, in Fatty Acids, Pryde E.H., Ed., American Oil Chemists' Society, Champaign, Second edition, pp 29–47.
  • van de Loo, F.J., Fox, B.G., Somerville, C. (1993) Unusual fatty acids, in Lipid Metabolism in Plants, T.S. Moore Jr., Ed., CRC Press, Boca Raton, pp91–126.
  • van de Loo, F.N., Turner, S., Somerville, C.R. (1995) An oleate 12-hydraxylase from castor (Ricinus communis L.) is a fatty acyl desaturase homolog. Proc. Natl. Acad. Sci. USA 92, 6743–6747.
  • von Heijne, G. (1985) Signal sequences. J. Mol. Biol. 184, 99–105
  • Atsmon, D. (1989) Castor, in Oil Crops of the World, Robbelen, G., Downey, K.R., and Ashri, A., Eds., McGraw-Hill, New York, pp. 438–447.
  • Bechtold, N., Ellis, J. and Pelletier, G. (1993) In Planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. C.R. Acad. Sci. Paris 316, 1194–1199.


Anspruch[de]
Isoliertes Nukleinsäurefragment, das eine Nukleinsäuresequenz umfasst, welche für eine Fettsäure-Hydroxylase mit einer Aminosäure-Identität von 60% oder mehr in Bezug auf die in SEQ ID NO: 4 dargestellte Aminosäuresequenz kodiert. Isoliertes Nukleinsäurefragment nach Anspruch 1, bei dem die Aminosäure-Identität in Bezug auf die in SEQ ID NO: 4 dargestellte Aminosäuresequenz 90% oder mehr ist. Isoliertes Nukleinsäurefragment nach Anspruch 1, bei dem die Aminosäure-Identität in Bezug auf die in SEQ ID NO: 4 dargestellte Aminosäuresequenz 100% ist. Isoliertes Nukleinsäurefragment, das für ein Polypeptid mit Fettsäure-Hydroxylase-Aktivität kodiert und eine Nukleinsäuresequenz-Identität von 90% oder mehr in Bezug auf die in SEQ ID NO: 1, 2 oder 3 dargestellte Nukleotidsequenz aufweist. Isolierte Nukleinsäure mit der Nukleotidsequenz von SEQ ID NO: 1, SEQ ID NO: 2 oder SEQ ID NO: 3. Isoliertes Nukleinsäurefragment nach Anspruch 1, wobei das Fragment aus einer Öl-produzierenden Pflanzen-Spezies isoliert ist. Chimäres Gen, das in der Lage ist, veränderte Mengen Rizinolsäure in einer transformierten Pflanzenzelle zu bewirken, wobei das chimäre Gen ein Nukleinsäurefragment nach Anspruch 1 umfasst, wobei das Fragment in funktionsfähiger Weise mit geeigneten regulatorischen Sequenzen verknüpft ist. Chimäres Gen, das in der Lage ist, veränderte Mengen Lesquerolsäure in einer transformierten Pflanzenzelle zu bewirken, wobei das chimäre Gen ein Nukleinsäurefragment nach Anspruch 1 umfasst, wobei das Fragment in funktionsfähiger weise mit geeigneten regulatorischen Sequenzen verknüpft ist. Chimäres Gen, das in der Lage ist, veränderte Mengen an Fettsäuren in einer transformierten Pflanzenzelle zu bewirken, wobei das chimäre Gen ein Nukleinsäurefragment nach einem der Ansprüche 1 bis 5 umfasst, wobei das Fragment in funktionsfähiger Weise mit geeigneten regulatorischen Sequenzen verknüpft ist. Pflanzen, die das chimäre Gen nach einem der Ansprüche 7 bis 9 umfassen. Pflanze nach Anspruch 10, wobei es sich um Raps, Crambe, Brassica juncea, Brassica nigra, Sumpfblume, Flachs, Sonnenblume, Distel, Baumwolle, Cuphea, Sojabohne, Erdnuß, Kokosnuß, Ölpalme oder Mais handelt. Isoliertes Nukleinsäurefragment nach Anspruch 1, wobei das Fragment von Ricinus communis (L.) (Rizinus) erhältlich ist. Isoliertes Nukleinsäurefragment nach Anspruch 1, wobei das Fragment von Lesquerella fendleri erhältlich ist. Verfahren zu Herstellung von Samenöl, das veränderte Mengen an hydroxylierten Fettsäuren enthält, bei dem man:

a) eine Pflanzenzelle einer Öl-produzierenden Spezies mit einem chimären Gen transformiert, das eine isolierte Nukleinsäure nach einem der Ansprüche 1 bis 5 umfasst;

b) ausgehend von den transformierten Pflanzenzellen von Schritt a) fertile Pflanzen anzüchtet;

c) Nachkommen-Samen von den fertilen Pflanzen von Schritt b) auf die gewünschten Mengen hydroxylierter Fettsäuren untersucht; und

d) die Nachkommen-Samen von Schritt c) weiterverarbeitet, um Samenöl zu erhalten, das veränderte Mengen an ungesättigten Fettsäuren enthält.
Verfahren nach Anspruch 14, bei dem die Nutzpflanze ausgewählt ist aus der Gruppe bestehend aus Raps, Crambe, Brassica juncea, Canola, Flachs, Sonnenblume, Distel, Baumwolle, Cuphea, Sojabohne, Erdnuß, Kokosnuß, Ölpalme und Mais. Triglycerid-Öl von einer transgenen Pflanze, die ausgewählt ist aus der Gruppe bestehend aus Raps, Crambe, Brassica juncea, Canola, Flachs, Sonnenblume, Distel, Baumwolle, Cuphea, Sojabohne, Erdnuß, Kokosnuß, Ölpalme und Mais, wobei die Fettsäure-Zusammensetzung des Öls im Vergleich mit einem Öl, das von derselben Pflanzen-Spezies in nicht-transformierter Form erhalten wird, eine erhöhte Menge an hydroxylierten Fettsäuren enthält, durch ein Verfahren, bei dem man eine Pflanzenzelle, die ein in ihr Genom integriertes DNA-Konstrukt aufweist, welches eine für eine Pflanzen-Hydroxylase kodierende Sequenz nach einem der Ansprüche 1 bis 5 umfasst, unter Bedingungen anzüchtet, die die Transkription und Translation der Pflanzen-Hydroxylase in den Pflanzenzellen erlauben. Verfahren zur Isolierung von Nukleinsäurefragmenten, die für eine Fettsäure-Hydroxylase kodieren, bei dem man:

a) SEQ ID NO: 4 und andere Fettsäure-Hydroxylase-Sequenzen und Fettsäure-Desaturasen vergleicht;

b) konservierte Sequenzen von 4 oder mehr Aminosäuren, die in Schritt a) erhalten werden, identifiziert;

c) auf Basis der in Schritt b) identifizierten, konservierten Sequenzen degenerierte Oligomere erstellt;

d) die degenerierten Oligomere von Schritt c) verwendet, um durch Sequenz-abhängige Methoden Sequenzen zu isolieren, die für Fettsäure-Hydroxylasen kodieren;

e) ausgehend von der Nukleotidsequenz des Gens die abgeleitete Aminosäuresequenz des kodierten Genprodukts erhält; und

f) durch Analyse von Aminosäuresequenz-Unterschieden zwischen Fettsäure-Desaturasen und Fettsäure-Hydroxylasen Hydroxylase-Gene von einem Desaturase-Gen unterscheidet.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com