PatentDe  


Dokumentenidentifikation DE69636450T2 03.05.2007
EP-Veröffentlichungsnummer 0000809655
Titel PEPTIDE UND PEPTIDOMIMETIKA MIT STRUKTURELLER ÄHNLICHKEIT MIT p53 UND DIE DIE p53-FUNKTION AKTIVIEREN
Anmelder The Wistar Institute, Philadelphia, Pa., US;
Bayer Corp., West Haven, Conn., US
Erfinder HALAZONETIS, Thanos, Philadelphia, PA 19103, US;
HARTWIG, Wolfgang, Stamford, CT 06903, US
Vertreter WINTER, BRANDL, FÜRNISS, HÜBNER, RÖSS, KAISER, POLTE, Partnerschaft, 85354 Freising
DE-Aktenzeichen 69636450
Vertragsstaaten AT, BE, CH, DE, DK, ES, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 16.02.1996
EP-Aktenzeichen 969053693
WO-Anmeldetag 16.02.1996
PCT-Aktenzeichen PCT/US96/01535
WO-Veröffentlichungsnummer 1996025434
WO-Veröffentlichungsdatum 22.08.1996
EP-Offenlegungsdatum 03.12.1997
EP date of grant 16.08.2006
Veröffentlichungstag im Patentblatt 03.05.2007
IPC-Hauptklasse C07K 14/82(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse G01N 33/574(2006.01)A, L, I, 20051017, B, H, EP   G01N 33/68(2006.01)A, L, I, 20051017, B, H, EP   A61K 38/17(2006.01)A, L, I, 20051017, B, H, EP   A61K 38/04(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
Gebiet der Erfindung

Die vorliegende Erfindung betrifft das Gebiet von Peptiden, die sich von Tumorsuppressorproteinen ableiten, und ihre Verwendung bei Therapie und Wirkstoffdesign.

HINTERGRUND DER ERFINDUNG

Wildtyp (WT)-p53 ist ein bei Menschen und anderen Säugern gefundenes sequenzspezifisches DNA-bindendes Protein, das Tumorsuppressorfunktion besitzt [Harris (1993), Science, 262: 1980-1981]. Das für p53 codierende Gen ist bei mehr als der Hälfte aller menschlichen Tumoren mutiert, was vermuten lässt, dass die Inaktivierung der Funktion des p53-Proteins für die Tumorentwicklung entscheidend ist.

Die Nucleotidsequenz des humanen p53-Gens und die Aminosäuresequenz des codierten p53-Proteins wurden beschrieben [Zakut-Houri et al. (1985), EMBO J., 4: 1251-1255; GenBank Code Hsp53]. Diese Sequenzen sind weiter unten als SEQ ID NO:1 bzw. 2 dargestellt. Die Aminosäuresequenz von p53 ist über die Evolution hin konserviert (Soussi et al. (1990), Oncogene, 5: 945-952], was vermuten lässt, dass auch seine Funktion konserviert ist.

Die Funktion des p53-Proteins besteht darin, Zellproliferation und Zelltod (auch als Apoptose bekannt) zu regulieren. Es ist auch an der Antwort der Zelle auf DNA-schädigende Mittel beteiligt [Harris (1993), wie oben zitiert]. Diese Funktionen erfordern, dass p53 DNA sequenzspezifisch bindet und anschließend die Transkription aktiviert [Pietenpol et al. (1994), Proc. Natl. Acad. Sci. USA, 91: 1998-2002]. Eine Bezugnahme auf die DNA-bindende Aktivität von p53 betrifft hier, soweit nicht anders angegeben, diese sequenzspezifische Bindung.

Bei mehr als der Hälfte aller menschlichen Tumoren ist das für p53 codierende Gen mutiert [Harns (1993), wie oben zitiert]. Das codierte mutierte p53-Protein ist somit nicht in der Lage, DNA zu binden [Bargonetti et al. (1992), Genes Dev., 6: 1886-1898] und seine Tumorsuppressorfunktion auszuüben. Der Verlust der p53-Funktion ist für eine Tumorentwicklung entscheidend. Das Einschleusen von Wildtyp-p53 in Tumorzellen führt zur Hemmung von Zellproliferation oder zu Zelltod [Finlay et al. (1989), Cell, 57: 1083-1093; Eliyahu et al. (1989), Proc. Natl. Acad. Sci. USA, 86: 8763-8767; Baker et al. (1990), Science, 249: 912-915; Mercer et al. (1990), Proc. Natl. Acad. Sci. USA, 87: 6166-6170; Diller et al. (1990), Mol. Cell. Biol., 10: 5772-5781; Isaacs et al. (1991), Cancer Res., 51: 4716-4720; Yonish-Rouach et al. (1993), Mol. Cell. Biol., 13: 1415-1423; Lowe et al. (1993), Cell, 74: 957-967; Fujiwara et al. (1993), Cancer Res., 53: 4129-4133; Fujiwara et al. (1994), Cancer Res., 54: 2287-2291]. Wenn es möglich wäre, die DNA-Bindung mutierter p53-Tumorproteine zu aktivieren, könnte das Tumorwachstum also gehemmt werden. Selbst bei Tumoren, die Wildtyp-p53 exprimieren, könnte eine Aktivierung von dessen DNA-bindender Aktivität das Tumorwachstum durch Verstärken der Funktion des endogenen p53-Proteins hemmen.

Der N-Terminus von p53 (Reste 1-90 der p53-Wildtypsequenz, die unter der GenBank-Zugangsnummer Hsp53 gespeichert ist und hier nochmals als SEQ ID NO:2 wiedergegeben ist; alle hier angegebenen Nummern für die Reste entsprechen dieser Sequenz) codiert für dessen Transkriptionsaktivierungsdomäne, auch als Transaktivierungsdomäne bekannt [Fields et al. (1990), Science, 249: 1046-1049]. Die sequenzspezifische DNA-Bindungsdomäne wurde an den Aminosäureresten 90-289 von Wildtyp-p53 kartiert [Halazonetis und Kandil (1993), EMBO J., 12: 5057-5064; Pavletich et al. (1993), Genes Dev., 7: 2556-2564; Wang et al. (1993), Genes Dev., 7: 2575-2586]. C-Terminal zur DNA-Bindungsdomäne enthält p53 eine Tetramerisierungsdomäne. Diese Domäne kartiert an den Resten 322-355 von p53 [Wang et al. (1994), Mol. Cell. Biol., 14: 5182-5191]. Unter die Einwirkung dieser Domäne bildet p53 Homotetramere und behält seine tetramere Stöchiometrie selbst dann, wenn es an DNA gebunden ist [Kraiss et al. (1988), J. Virol., 62: 4737-4744; Stenger et al. (1992), Mol. Carcinog., 5: 102-106; Sturzbecher et al. (1992), Oncogene, 7: 1513-1523; Friedman et al. (1993), Proc. Natl. Acad. Sci. USA, 90: 3319-3323; Halazonetis und Kandil (1993), EMBO J., 12: 5057-5064; und Hainaut et al. (1994), Oncogene, 9: 299-303].

Auf der C-terminalen Seite der Tetramerisierungsdomäne (d. h. vom C-Terminus bis Rest 355 von humanem p53) enthält p53 eine Region, die DNA-Bindung negativ reguliert. Die Funktion dieser Region wird durch Deletion der Reste 364-393 von humanem p53 oder durch Deletion der entsprechenden Reste von Maus-p53 (Reste 361-390 der p53-Maussequenz, die in SEQ ID NO:3 gezeigt ist, ausgeschaltet [Hupp et al. (1992), Cell, 71: 875-886; Halazonetis et al. (1993), EMBO J., 12: 1021-1028; Halazonetis und Kandil (1993), wie oben zitiert].

Deletion dieser negativen Regulatorregion aktiviert also die DNA-Bindung von p53 (Halazonetis und Kandil (1993), wie oben zitiert]. Außerdem aktiviert auch eine Inkubation von p53 mit Antikörper PAb421, der p53 an den Aminosäuren 373-381 erkennt, die DNA-Bindung, vermutlich durch Maskierung und Inaktivierung dieser negativen Regulatorregion [Hupp et al. (1992), wie oben zitiert; Halazonetis et al. (1993), wie oben zitiert]. Wir bezeichnen diese negative Regulatorregion nachfolgend als NRR1. (Wir haben nun experimentelle Hinweise, die vermuten lassen, dass p53 weitere negative Regulatorregionen enthält, siehe Beispiel 3.)

Hupp et al. [(1992), wie oben zitiert] haben nahegelegt, dass NRR1 den Oligomerisierungszustand von Wildtyp-p53 zwischen Tetrameren und Dimeren beeinflusst. Im Gegensatz dazu hatten wir vorgeschlagen, dass die NRR1 trotz ihrer Nähe zur Tetramerisierungsdomäne keinen Einfluss auf die p53-Oligomerisierung hat, sondern eher die Konformation von p53 kontrolliert [Halazonetis et al. (1993), wie oben zitiert]. Um unser Modell endgültig zu stützen, zeigten wir, dass die aktivierte Form von p53, dem die NRR1 fehlt, ebenso wie vollständiges p53 ein Tetramer ist [Halazonetis und Kandil (1993), wie oben zitiert]. p53 wechselt also zwischen zwei Konformationszuständen, die beide tetramer sind: einem R-Zustand mit hoher Affinität für DNA und einem T-Zustand ohne oder mit geringer Affinität für DNA [Halazonetis und Kandil (1993), wie oben zitiert].

Unabhängig vom Mechanismus, durch den NRR1 DNA-Bindung von p53 steuert, besteht das Potential, Wirkstoffe zu entwickeln, die diese Region inaktivieren und die D1VA-Bindung von p53 hochregulieren. Solche Wirkstoffe sollten sich zur Behandlung von Krebs eignen, da verstärkte p53-Funktion zur Hemmung von Zellproliferation oder zu Zelltod führt [Finlay et al. (1989), Cell, 57: 1083-1093; Eliyahu et al. (1989), Proc. Natl. Acad. Sci. USA, 86: 8763-8767; Baker et al. (1990), Science, 249: 912-915; Mercer et al. (1990), Proc. Natl. Acad. Sci. USA, 87: 6166-6170; Diller et al. (1990), Mol. Cell. Biol., 10: 5772-5781; Isaacs et al. (1991), Cancer Res., 51: 4716-4720; Yonish-Rouach et al. (1993), Mol. Cell. Biol., 13: 1415-1423; Lowe et al. (1993), Cell, 74: 957-967; Fujiwara et al. (1993), Cancer Res., 53: 4129-4133; Fujiwara et al. (1994), Cancer Res., 54: 2287-2291].

Lane und Hupp haben bereits vorgeschlagen, den Antikörper PAb421 zur Behandlung von Krebs zu verwenden, da er die DNA-Bindung von p53 in vitro aktiviert (Internationale Patentanmeldung WO 94/12202). Verabreichung von PAb421-Antikörper an einen Patienten für diesen Zweck wäre jedoch wahrscheinlich umsonst, da Antikörper nicht ohne Weiteres durch Zellmembranen dringen und zu intrazellulären Proteinen wie p53 gelangen. Lane und Hupp argumentieren außerdem, dass alle Liganden, einschließlich niedermolekularer Liganden, die an die 30 C-terminalen Aminosäuren von humanem p53 binden, dessen DNA-bindende Aktivität aktivieren sollten (Internationale Patentanmeldung WO 94/12202). Der einzige Ligand, den sie beschreiben (nämlich Antikörper PAb421), besitzt jedoch eine Molekülgröße, die wenigstens 100-mal höher ist als die von pharmazeutischen Verbindungen, von denen bekannt ist, dass sie in Zellen eindringen. Ihre Behauptung ist ferner wenig überzeugend, da die 30 C-terminalen Aminosäuren von humanem p53 (Reste 364-393 von SEQ ID NO:2) und die NRR1 nicht zusammenfallen (wenngleich sie überlappen).

Es besteht folglich eine Notwendigkeit, den Mechanismus zu charakterisieren, durch den NRR1 die DNA-bindende Aktivität von p53 beeinflusst. Insbesondere besteht Bedarf, kleine Moleküle zu identifizieren, die die Bindung von DNA durch p53 hochregulieren können. Es besteht ferner Bedarf an Verfahren, die Tumoren identifizieren, die p53-Mutanten exprimieren, deren DNA-bindende Aktivität durch kleine Moleküle hochreguliert werden kann, die ähnliche Wirkung auf Wildtyp-p53 haben. Es besteht ferner Bedarf an therapeutischen Verfahren, die auf der Verabreichung solcher hochregulierender Moleküle an Zellen basieren, die Krankheitszustände zeigen, die geringe p53-Aktivität widerspiegeln.

ZUSAMMENFASSUNG DER ERFINDUNG

Eine Aufgabe dieser Erfindung besteht darin, kleine Moleküle bereitzustellen, die in der Lage sind, die p53-Bindung an DNA hochzuregulieren. Solche kleinen Moleküle können die Funktion von NRR1 stören, müssen aber nicht unbedingt an sie binden.

Eine weitere Aufgabe der Erfindung besteht darin, kleine Moleküle bereitzustellen, die die DNA-Bindung durch p53 hochregulieren, indem sie die Funktion der negativen Regulatorregion (NRR1), die im C-Terminus von p53 enthalten ist, stören, vorzugsweise in im Wesentlichen gleichen Maße wie der monoklonale Antikörper PAb421.

Eine weitere Aufgabe der Erfindung besteht darin, einen Test bereitzustellen, der die von dieser Erfindung umfassten kleinen Moleküle identifiziert und/oder ihre Aktivität quantifiziert.

Noch eine weitere Aufgabe der Erfindung besteht darin, ein Verfahren zur Identifizierung jener mutierten Formen von p53 bereitzustellen, die DNA-bindende Aktivität zeigen, die durch die kleinen Moleküle der Erfindung stimuliert werden können.

Diese und andere Aufgaben werden von der hier offenbarten Erfindung gelöst.

Der oben geschilderte Bedarf an Mitteln, die die DNA-Bindung von humanem p53 aktivieren, hat die Erfinder dazu geführt, die Regulation von humanem p53 weiter zu untersuchen. Wir haben NRR1 in den Resten 361-383 von humanem p53 kartiert (siehe Beispiel 3). Übereinstimmend mit unserer Kartierung aktiviert Antikörper PAb421, der an p53 bindet, nämlich an den Resten 373-381 (innerhalb der 30 C-terminalen Aminosäuren von humanem p53) [Wade-Evans und Jenkins (1985), EMBO J., 4: 699-706], die DNA-Bindung [Hupp et al. (1992), wie oben zitiert; Halazonetis et al. (1993), wie oben zitiert], während Antikörper ICA-9, der an die p53-Reste 382-392 bindet (ebenfalls innerhalb der 30 C-terminalen Aminosäuren von humanem p53), die DNA-Bindung nicht aktiviert (Hupp und Lane (1994), Current Biology 4: 865-875]. Diese Untersuchungen haben zur Identifizierung niedermolekularer Verbindungen geführt, die die DNA-Bindung von humanem p53 aktivieren und sich zur Entwicklung von Therapien für und/oder zur Vorbeugung von Krebs sowie anderen Erkrankungen und Störungen eignen, die von einer inadäquaten p53-Funktion in vivo verursacht werden. Diese niedermolekularen Verbindungen beinhalten Peptidfragmente und nichtnatürliche Peptide, deren Aminosäuresequenz sich von NRR1 von p53 ableitet, Modifikationen dieser Peptide und Peptidomimetika mit der gewünschten Aktivität.

Die vorliegende Erfindung betrifft daher Peptide, deren Aminosäuresequenz sich von p53 ableitet, und Peptidomimetika auf Basis der Struktur solcher Peptide, sowie Verfahren zur Verwendung dieser Peptide und Peptidomimetika bei der Therapie von Krebs und anderen Erkrankungen, die durch übermäßige Proliferation bestimmter Zellen und Gewebe gekennzeichnet sind. Die Peptide dieser Erfindung sind keine Subfragmente von p53, wenngleich sich ihre Aminosäuresequenz von der linearen Sequenz von humanem p53 oder den entsprechenden Sequenzen von nichthumanem p53 ableitet. Insbesondere geeignete nichthumane p53-Quellen beinhalten Maus, Huhn, Xenopus und Forelle.

Gemäß einem Aspekt betrifft die vorliegende Erfindung ein Peptid, umfassend wenigstens vier aufeinanderfolgende Aminosäuren einer negativen Regulatorregion, die in den Resten 361-383 (SEQ ID NO:2) von p53 kartiert, wobei das Peptid kein Subfragment von humanem p53 ist, das Peptid DNA-Bindung von Wildtyp-p53 oder einer eine einzelne Aminosäuresubstitution enthaltenden p53-Mutante, die ausgewählt ist aus der Gruppe bestehend aus p53-ser239, p53-his273, p53-gln248 und p53-cys273, in einem p53-DNA-Bindungsassay aktiviert, wobei das Peptid ein Molekulargewicht von weniger als 2000 Dalton aufweist. Solch ein Peptid kann ein Peptid sein, das Aminosäuresequenzen enthält, die den Aminosäureresten (aa) 363-373, 368-380, 373-383, 371-383, 363-382, 367-386, 363-386, 362-386 und 360-386 von p53 entsprechen.

Vorzugsweise sind die wenigstens vier aufeinanderfolgenden Aminosäuren D-Aminosäuren, die in der negativen Regulatorregion (dargestellt durch die Reste 361-383 (SEQ ID NO:2) von humanem p53) in einer reversen Sequenzorientierung relativ zur Wildtypsequenz kartieren.

Gemäß einem weiteren Aspekt stellt die Erfindung peptidomimetische Verbindungen bereit, wie sie in den anhängenden Ansprüchen definiert sind. Die Erfindung stellt ferner Verfahren zur Selektion peptidomimetischer Verbindungen bereit.

Noch ein anderer Aspekt dieser Erfindung betrifft eine pharmazeutische Zusammensetzung, die eines der oben identifizierten Peptide oder Peptidomimetika oder eine Kombination davon in einem pharmazeutisch verträglichen Träger umfasst.

Die Erfindung betrifft Verfahren zur Verwendung der pharmazeutischen Zusammensetzungen dieser Erfindung zur Aktivierung der p53-Funktion bei humanen Subjekten. Eine solche Aktivierung würde: 1) die zelluläre Antwort auf DNA-schädigende Mittel induzieren und dadurch die Resistenz gesunder Subjekte gegen DNA-schädigende Mittel, wie Sonnenlicht, Strahlung usw., erhöhen und die Toxizität von Therapien, die DNA-schädigende Mittel einsetzen, wie die Krebstherapie, vermindern, 2) Apoptose von Lymphozyten induzieren und dadurch Immuntoleranz für Patienten mit Autoimmunerkrankungen, Allergien oder für Transplantatempfänger vermitteln, 3) die p53-Funktion anomal proliferierender Zellen verbessern, beispielsweise solcher, die mit Krebs, Psoriasis usw. assoziiert sind, und dadurch zur Behandlung durch Apoptose oder Wachstumshemmung solcher Zellen führen.

Ohne an eine Theorie gebunden sein zu wollen, haben die Erfinder die erfindungsgemäßen Peptide aus der vollständigen p53-Sequenz auf Basis ihrer Beobachtung ausgewählt, dass in p53 zwei negative Regulatorregionen vorkommen, nämlich die Sequenz von Rest 300-321 von humanem p53 (NRR2) und die früher erkannte Regulatorregion etwa innerhalb von Rest 361-383 von humanem p53 (NRR1). Die Erfinder haben die Hypothese aufgestellt, dass diese beiden Sequenzen physisch miteinander oder mit einer dritten Region in p53 interagieren, wobei sie p53 in eine Konformation mit geringer Affinität für DNA überführen. Wenn die Wechselwirkungen dieser beiden negativen Regulatorregionen gestört werden (durch Deletionen in einer der beiden Regionen oder durch einen geeigneten Antikörper), dann wechselt p53 in eine Konformation mit hoher Affinität für DNA.

Indem sie mit der endogenen negativen Regulatorregion von p53 um die Bindung an diese Regionen konkurrieren, können kleine Moleküle die intramolekularen regulatorischen Wechselwirkungen von p53 stören. Die Erfinder haben Peptide entwickelt, die einer dieser negativen Regulatorregionen entsprechen, und haben beobachtet, dass die Peptide dieser Erfindung die DNA-Bindung von humanem p53 aktivieren.

Andere Aspekte und Vorteile der vorliegenden Erfindung sind in der folgenden ausführlichen Beschreibung der bevorzugten Ausführungsformen näher beschrieben.

AUSFÜHRLICHE BESCHREIBUNG DER ERFINDUNG

Erfindungsgemäß werden Peptide bereitgestellt, die die DNA-bindende Aktivität der Wildtypform des p53-Tumorsuppressors sowie die bestimmter p53-Tumormutanten aktivieren. Die Mutanten, die so aktiviert werden können, gehören zu den für menschliche Tumoren signifikantesten. Mutanten, die von den Peptiden dieser Erfindung aktiviert werden können, beinhalten solche, die durch eine einzelne Aminosäuremodifikation (Substitution) an den folgenden Stellen in der Sequenz von p53 charakterisiert sind: (a) Ser an Rest 239; (b) His an Rest 273; (c) Gln an Rest 248; (d) Trp an Rest 282; und (e) Cys an Rest 273. Andererseits aktivieren erfindungsgemäße Peptide keine p53-Mutanten, die lediglich eine Substitution von His an Position 175, Trp an Position 248, Ser an Position 249 und Ile an Position 237 haben.

Die kleinen Moleküle der Erfindung beinhalten Peptidderivate, die die wirksame Sequenz von Peptiden beibehalten und in einem p53-DNA-Bindungsassay (gemessen beispielsweise mit dem Testverfahren nach Beispiel 2) wirksam sind. Die vorliegende Erfindung stellt kleine Moleküle bereit, bei denen es sich um Peptide handelt, die Aminosäuresequenzen von NRR1 von p53 enthalten, modifizierte Formen der Peptide (die die Aktivität der Peptide behalten) oder Peptidomimetika (die die wesentliche dreidimensionale Form und chemische Reaktivität und daher die biologische Aktivität der Peptide behalten). Die kleinen Moleküle der Erfindung haben gewöhnlich ein Molekulargewicht von weniger als 2000 Dalton (Da), vorzugsweise weniger als 1500 Da, besonders bevorzugt weniger als 1000 Da, ganz besonders bevorzugt weniger als 500 Da, und diese kleinen Moleküle aktivieren die DNA-Bindung von Wildtyp-p53 bei Konzentrationen von 0,2 mM oder weniger mit gleicher Effizienz wie Peptide, die aus den p53-Resten 363-373, 368-380, 373-383, 371-383, 363-382, 367-386, 363-386, 362-386 oder 360-386 bestehen.

I. PEPTIDE DER ERFINDUNG

Peptide dieser Erfindung enthalten Aminosäuresequenzen, die wenigstens einem Teil von NRR1 von p53 (Reste 361-383 von humanem p53) entsprechen. Diese Peptide können die folgenden Sequenzen umfassen, können aber nicht das gesamte Peptid der vorliegenden Erfindung sein, da das Peptid kein Subfragment von humanem p53 sein kann.

Für den Fachmann ist offensichtlich, dass andere kleinere Fragmente der obigen Peptide von einem Fachmann ausgewählt werden können und dass diese Peptide die gleiche biologische Aktivität besitzen. Beispielsweise werden Peptide, die Fragmente des Peptids p53p360-385 [SEQ ID NO:12] umfassen, die in der Länge von 26 Aminosäuren bis etwa 5 Aminosäuren variieren, von der Erfindung umfasst, vorausgesetzt, dass die Peptide keine Subfragmente von humanem p53 sind. Im Allgemeinen haben die Peptide dieser Erfindung wenigstens 4 Aminosäuren, vorzugsweise wenigstens 5 Aminosäuren, besonders bevorzugt wenigstens 6 Aminosäuren.

Segmente entsprechend der NRR1 Region. Die Aminosäuresequenz von p53 ist über die Spezies hinweg konserviert [Soussi et al. (1990), Oncogene, 5: 945-952], was impliziert, dass auch die Funktion konserviert ist. Tatsächlich hat eine Analyse von p53-Proteinen von Xenopus und Mensch keine funktionellen Unterschiede ergeben [Cox et al. (1994), Oncogene, 9: 2951-2959]. Es ist daher möglich, humane p53-Sequenzen der Peptide dieser Erfindung durch die homologen nichthumanen p53-Sequenzen zu substituieren. Die Sequenzen von humanem p53 und ausgewählten nichthumanen p53-Proteinen wurden von Soussi et al. (1990) [wie oben zitiert] einem Alignment unterzogen. Dieses Alignment kann dazu dienen, Regionen zu identifizieren, die zwischen den Spezies homolog sind. Für p53-Spezies, die von Soussi et al. (1990) [wie oben zitiert] nicht aufgeführt sind, lässt sich das Alignment mit den humanen p53-Sequenzen durch handelsübliche und dem Fachmann bekannte Computerprogramme erhalten, beispielsweise das BESTFIT-Programm des GCG-Pakets der University of Wisconsin. Die ganzen oben dargestellten Peptidsequenzen können durch die entsprechenden nichthumanen Sequenzen substituiert sein, oder alternativ kann ein Fragment der obigen Peptidsequenzen durch die entsprechenden nichthumanen Sequenzen substituiert sein.

Obwohl die oben beschriebenen Peptide die DNA-Bindung von Wildtyp-p53 in vitro wirksam aktivieren, kann ihre Wirksamkeit in vivo durch die Anwesenheit von Proteanen beeinträchtigt werden. Serumproteasen besitzen ziemlich spezifische Substratanforderungen. Das Substrat muss zur Spaltung sowohl L-Aminosäuren als auch Peptidbindungen besitzen.

Exopeptidasen, die die überwiegendste Komponente der Proteaseaktivität in Serum darstellen, wirken außerdem gewöhnlich an der ersten Peptidbindung des Peptids und benötigen einen freien N-Terminus (Power et al. (1993), Pharmaceutical Res., 10:1268-1273). Auf Basis dieser Überlegungen ist es vorteilhaft, modifizierte Versionen der oben beschriebenen Peptide zu verwenden. Die modifizierten Peptide behalten die strukturellen Eigenschaften der ursprünglichen L-Aminosäurepeptide, die hinsichtlich p53 biologische Aktivität vermitteln, wegen der Modifkation werden sie von Proteasen und/oder Exopeptidasen jedoch nicht so leicht gespalten.

Erfindungsgemäß beinhaltet der Begriff "Peptid" modifizierte Formen des Peptids, solange die Modifikation die wesentliche Sequenz nicht verändert und das modifizierte Peptid die Fähigkeit behält, die Bindung von p53 an spezifische DNA-Sequenzen zu aktivieren (d. h. die sequenzspezifische DNA-bindende Aktivität). Solche Modifikationen beinhalten N-terminale Acetylierung, Glykosylierung, Biotinylierung usw. Besonders bevorzugte Versionen der L-Aminosäurepeptide, die der Aminosäuresequenz der p53-NRR1 (Reste 361-383 von humanem p53) entsprechen, sind nachfolgend beschrieben und werden als erfindungsgemäße Peptide angesehen.

A. Peptide mit einer N-terminalen D-Aminosäure

Die Anwesenheit einer N-terminalen D-Aminosäure erhöht die Serumstabilität eines Peptids, das ansonsten L-Aminosäuren enthält, weil Exopeptidasen, die am N-terminalen Rest wirken, keine D-Aminosäure als Substrat verwerten können (Powell et al. (1993), wie oben zitiert). Die Aminosäuresequenzen der Peptide mit N-terminalen D-Aminosäuren sind daher üblicherweise identisch mit den Sequenzen der oben beschriebenen L-Aminosäurepeptide [z. B. SEQ ID NO:4-12], außer dass der N-terminale Rest eine D-Aminosäure ist.

B. Peptide mit einer C-terminalen D-Aminosäure

Die Anwesenheit einer C-terminalen D-Aminosäure stabilisiert ebenfalls ein Peptid, das ansonsten L-Aminosäuren enthält, weil Serumexopeptidasen, die am C-terminalen Rest einwirken, keine D-Aminosäure als Substrat verwerten können (Powell et al. (1993), wie oben zitiert). Die Aminosäuresequenzen dieser Peptide sind daher üblicherweise mit den Sequenzen der oben beschriebenen L-Aminosäurepeptide identisch [z. B. SEQ ID NO:4-12], außer dass der C-terminale Rest eine D-Aminosäure ist.

C. Cyclische Peptide

Cyclische Peptide haben keine freien N- oder C-Termini. Sie sind daher gegenüber einer Proteolyse durch Exopeptidasen unempfindlich, wenngleich sie natürlich für Endopeptidasen empfindlich sind, die nicht an den Peptidenden spalten. Die Aminosäuresequenzen der cyclischen Peptide können mit den Sequenzen der oben beschriebenen L-Aminosäurepeptide identisch sein [z. B. SEQ ID NO:4-12], außer dass die Topologie ringförmig und nicht linear ist.

D. Peptide mit Substitutionen von natürlichen Aminosäuren durch nichtnatürliche Aminosäuren

Eine Substitution nichtnatürlicher Aminosäuren für natürliche Aminosäuren in einer Subsequenz der NRR1 von p53 kann ebenfalls Resistenz gegen Proteolyse vermitteln. Eine solche Substitution kann beispielsweise Resistenz gegen Proteolyse durch Exopeptidasen vermitteln, die am N-Terminus wirken. Mehrere der Peptide, deren Aminosäuresequenz von der NRR1 von humanem p53 (Reste 361-383 von humanem p53) abstammt, haben Serin als N-terminalen Rest (siehe beispielsweise SEQ ID NO:7, 9 und 11). Der Serinrest kann durch die &bgr;-Aminosäure Isoserin substituiert sein. Solche Substitutionen wurden beschrieben (Coller et al. 1993), J. Biol. Chem., 268: 20741-20743), und diese Substitutionen beeinträchtigen die biologische Aktivität nicht. Außerdem ist die Synthese von Peptiden mit nichtnatürlichen Aminosäuren Routine und dem Fachmann bekannt (siehe beispielsweise Coller et al. (1993), wie oben zitiert).

E. Peptide mit N-terminalen oder C-terminalen chemischen Gruppen

Ein effektiver Ansatz, um Resistenz gegenüber Peptidasen zu vermitteln, die an den N-terminalen oder C-terminalen Resten eines Peptids wirken, besteht darin, chemische Gruppen an die Peptidtermini anzuhängen, so dass das modifizierte Peptid nicht länger ein Substrat für die Peptidase ist. Eine derartige chemische Modifikation ist die Glykosylierung der Peptide an einem oder beiden Enden. Es wurde gezeigt, dass bestimmte chemische Modifikationen, insbesondere N-terminale Glykosylierung, die Stabilität von Peptiden in Humanserum erhöhen [Powell et al. (1993), Pharma. Res., 10: 1268-1273]. Andere chemische Modifikationen, die die Serumstabilität erhöhen, umfassen, ohne darauf beschränkt zu sein, das Anhängen einer N-terminalen Alkylgruppe, die aus einem Niederalkyl mit 1 bis 20 Kohlenstoffen besteht, beispielsweise einer Acetylgruppe, und/oder das Anhängen einer C-terminalen Amid- oder substituierten Amidgruppe. Insbesondere umfasst die vorliegende Erfindung modifizierte Peptide, die aus den Resten 363-373, 368-380, 373-383, 371-383, 363-382, 367-386, 363-386, 362-386 oder 360-386 von humanem p53 bestehen und eine N-terminale Acetylgruppe und eine C-terminate Amidgruppe tragen.

F. Peptide mit zusätzlichen Aminosäuren

Ebenfalls von der Erfindung umfasst werden modifizierte Peptide, die die oben beschriebenen Peptide in ihren Sequenzen enthalten. Diese längeren Peptidsequenzen, die aus dem Anhängen zusätzlicher Aminosäurereste resultieren, werden von dieser Erfindung umfasst, da sie die gleiche biologische Aktivität besitzen (nämlich die DNA-Bindung von p53 zu aktivieren) wie die oben beschriebenen Peptide.

Ein spezielles Beispiel für Varianten des Peptids, das den Aminosäureresten 360-386 von humanem p53 entspricht, beinhaltet das Anhängen eines N-terminalen Cysteins, das dem Peptid die Fähigkeit zur Bildung von Dimeren verleiht:

Obwohl Peptide mit einer größeren Anzahl zusätzlicher Aminosäuren nicht ausgeschlossen sind, weiß man, dass manche große Polypeptide eine Konfiguration annehmen werden, die die wirksame Sequenz maskiert und dadurch eine Bindung an p53 verhindert. Andere Polypeptide werden zwar noch binden, sind aber so sperrig, dass der Komplex von p53 mit Peptiden nicht länger an DNA bindet. Diese Derivate verbessern die Wirkung von p53 nicht und sind daher von der Erfindung ausgenommen.

G. Peptide mit deletierten Aminosäuren

Die erfindungsgemäßen Peptide haben Aminosäuresequenzen, die in der NRR1 von p53 enthalten sind. Soweit ein Peptid, das die Sequenz eines Segments von NRR1 enthält, die gewünschte biologische Aktivität besitzt, folgt daraus, dass ein Peptid, das die Sequenzen von zwei solchen Segmenten enthält, ebenfalls die gewünschte biologische Aktivität besitzen sollte, selbst wenn diese Segmente in der p53-NRR1 nicht aufeinanderfolgen sollten. Solche Peptide können auch als Peptide mit einer Sequenz beschrieben werden, die der p53-NRR1 mit einer internen Deletion entspricht.

Die Fähigkeit von Peptiden mit internen Deletionen, DNA-Bindung von p53 zu aktivieren, wurde zuerst durch die Beobachtung festgestellt, dass eine Synthese von Peptid p53pC360-386 [SEQ ID NO:22] auch Peptide lieferte, denen ein Glycin oder ein Phenylalanin oder Kombinationen davon fehlten, beispielsweise:

Die Fähigkeit der obigen Peptide, die DNA-Bindung von p53 zu aktivieren, hat uns dazu veranlasst, weitere Peptide mit einzelnen Aminosäuredeletionen oder mit längeren Deletionen zu konstruieren.

Modifizierte Peptide, die einzelne Aminosäuredeletionen enthalten, umfassen auch:

Modifizierte erfindungsgemäße Peptide mit längeren Deletionen umfassen:

Bei einer weiteren Ausführungsform der Erfindung sind die Peptide Reverse-D-Peptide, die der Aminosäuresequenz der p53-NRR1 (Reste 361-386 von humanem p53) entsprechen. Der Begriff "Reverse-D-Peptid" bezeichnet Peptide, die D-Aminosäuren enthalten, die relativ zu einem Peptid, das L-Aminosäuren enthält, in einer umgekehrten Reihenfolge angeordnet sind. Der C-terminale Rest eines L-Aminosäurepeptids wird also für das D-Aminosäurepeptid N-terminal usw. Beispielsweise ist die Sequenz des Reverse-D-Peptids, das Peptid p53p363-373 [SEQ ID NO:4] entspricht:

Die Reverse-D-Sequenzen der Peptide der SEQ ID NO:5-11 sind als SEQ ID NO:13-21 dargestellt. Reverse-D-Peptide behalten die gleiche tertiäre Konformation und daher die gleiche Aktivität wie die L-Aminosäurepeptide, sind aber in vitro und in vivo gegenüber enzymatischem Abbau stabiler und haben daher eine größere therapeutische Wirksamkeit als das Ausgangspeptid (Brady und Dodson (1994), Nature, 368: 692-693; Jameson et al. (1994), Nature, 368: 744-746).

Die Peptide dieser Erfindung, einschließlich der Analogen und der anderen modifizierten Varianten, können allgemein nach bekannten Methoden hergestellt werden. Vorzugsweise kann die synthetische Herstellung des Peptids der Erfindung nach dem Festphasensyntheseverfahren erfolgen. Die Festphasensynthese wird beispielsweise gut verstanden und ist ein übliches Verfahren zur Herstellung von Peptiden, ebenso wie eine Vielzahl von Modifikationen dieser Methode [Merrifield (1964), J. Am. Chem. Soc., 85: 2149; Stewart und Young (1984), Solid Phase Peptide Synthesis, Pierce Chemical Company, Rockford, IL; Bodansky und Bodanszky (1984), The Practice of Peptide Synthesis, Springer-Verlag, New York; Atherton und Sheppard (1989), Solid Phase Peptide Synthesis: A Practical Approach, IRL Press, New York]. Siehe auch das im nachfolgenden Beispiel 1 beschriebene spezielle Verfahren.

Alternativ können die erfindungsgemäßen Peptide in rekombinanten Systemen mit Polynucleotidsequenzen hergestellt werden, die für die Peptide codieren. Es versteht sich, dass ein erfindungsgemäßes Peptid mehr als eine der oben beschriebenen Modifikationen innerhalb des gleichen Peptids enthalten kann. Ebenfalls von der Erfindung umfasst sind pharmazeutisch verträgliche Salzkomplexe der erfindungsgemäßen Peptide.

II. PEPTIDOMIMETIKA

Ein Peptidomimetikum ist ein Molekül, das die biologische Aktivität eines Peptids nachahmt, aber von seiner chemischen Natur her nicht länger peptidisch ist. Nach strenger Definition ist ein Peptidomimetikum ein Molekül, das keine Peptidbindungen (d. h. Amidbindungen zwischen Aminosäuren) mehr enthält. Der Begriff Peptidomimetikum wird jedoch manchmal verwendet, um Moleküle zu beschreiben, die ihrer Natur nach nicht mehr vollständig peptidisch sind, beispielsweise Pseudopeptide, Semipeptide und Peptoide. Beispiele für einige Peptidomimetika entsprechend der breiteren Definiton (bei denen ein Teil eines Peptids durch eine Struktur ohne Peptidbindungen ersetzt ist) sind nachfolgend beschrieben. Unabhängig davon, ob sie vollständig oder teilweise nichtpeptidisch sind, liefern erfindungsgemäße Peptidomimetika eine räumliche Anordnung von reaktiven chemischen Funktionen, die der dreidimensionalen Anordnung aktiver Gruppen in dem Peptid, auf dem das Peptidomimetikum basiert, stark ähnelt. Als Folge dieser ähnlichen Geometrie des Wirkzentrums hat das Peptidomimetikum Wirkungen auf biologische Systeme, die der biologischen Aktivität des Peptids ähneln.

Die vorliegende Erfindung umfasst Peptidomimetikazusammensetzungen, bei denen es sich um Analoge handelt, die die Aktivität erfindungsgemäßer biologisch aktiver Peptide nachahmen, d. h. die Peptidomimetika sind in der Lage, die DNA-bindende Aktivität von p53 zu aktivieren. Die Peptidomimetika der Erfindung sind den oben erläuterten Peptiden vorzugsweise im Wesentlichen sowohl in ihrer dreidimensionalen Form als auch in ihrer biologischen Aktivität ähnlich. Wesentliche Ähnlichkeit bedeutet, dass die geometrischen Verhältnisse von Gruppen in dem Peptid, das mit p53 reagiert, konserviert sind, und gleichzeitig, dass das Peptidomimetikum die DNA-bindende Aktivität von Wildtyp-p53 und ein oder mehreren der oben erläuterten p53-Mutanten stimuliert, wobei die Stimulation bei einem Faktor innerhalb 2 der Stimulation liegt, die von wenigstens einem der Peptide der Erfindung gezeigt wird.

Die Verwendung eines Mimetikums eines gegebenen Peptids anstelle des Peptids selbst hat deutliche Vorteile, weil Peptide üblicherweise zwei unerwünschte Eigenschaften zeigen: (1) schlechte Bioverfügbarkeit; und (2) kurze Wirkdauer. Peptidomimetika bieten einen offensichtlichen Weg, um diese beiden Haupthindernisse zu umgehen, da die betroffenen Moleküle klein genug sind, um sowohl oral wirksam zu sein als auch eine lange Wirkdauer zu haben. Peptidomimetika bieten auch beträchtliche Kosteneinsparungen und verbesserte Patienten-Compliance, da sie im Vergleich mit der parenteralen Verabreichung von Peptiden oral verabreicht werden können. Außerdem sind Peptidomimetika viel billiger herzustellen als Peptide. Schließlich gibt es bei Peptiden Probleme mit Stabilität, Lagerung und Immunreaktivität, die bei Peptidomimetika nicht beobachtet werden.

Die oben beschriebenen Peptide sind daher zur Entwicklung solcher kleinen chemischen Verbindungen mit ähnlicher biologischer Aktivität und daher ähnlicher therapeutischer Anwendbarkeit nützlich. Die Methoden zur Entwicklung von Peptidomimetika sind altbekannt. So können Peptidbindungen durch Nichtpeptidbindungen ersetzt werden, die es dem Peptidomimetikum erlauben, eine ähnliche Struktur und damit ähnliche biologische Aktivität wie das Ausgangspeptid anzunehmen. Weitere Modifikationen können auch erfolgen, indem man chemische Gruppen der Aminosäuren durch andere chemische Gruppen ähnlicher Struktur ersetzt. Die Entwicklung von Peptidomimetika kann unterstützt werden, indem man die Tertiärstruktur des entweder freien oder an p53 gebundenen Ausgangspeptids durch NMR-Spektroskopie, Kristallographie und/oder computergestütztes "Molecular Modelling" bestimmt. Diese Methoden helfen bei der Entwicklung neuer Zusammensetzungen mit höherer Wirksamkeit und/oder besserer Bioverfügbarkeit und/oder besserer Stabilität als der des Ausgangspeptids [Dean (1994), BioEssays, 16: 683-687; Cohen und Shatzmiller (1993), J. Mol. Graph., 11: 166-173; Wiley und Rich (1993), Med. Res. Rev., 13: 327-384; Moore (1994), Trends Pharmacol. Sci., 15: 124-129; Hruby (1993), Biopolymers, 33: 1073-1082; Bugg et al. (1993), Sci. Am., 269: 92-98]. Sobald eine potentielle Peptidomimetikaverbindung identifiziert ist, kann sie synthetisiert und mit dem hier beschriebenen DNA-Bindungsassay oder einem geeigneten Tumorsuppressorassay getestet werden [siehe Finlay et al. (1983), Cell, 57: 1083-1093 und Fujiwara et al. (1993), Cancer Res., 53: 4129-4133], um ihre Aktivität zu bestimmen.

Durch Verwendung der oben beschriebenen Verfahren stellt die vorliegende Erfindung also Verbindungen bereit, die im Vergleich mit den oben beschriebenen Peptiden eine bessere therapeutische Aktivität zeigen. Die durch die obigen Verfahren erhaltenen Peptidomimetikaverbindungen, die die biologische Aktivität der oben genannten Peptide und eine ähnliche dreidimensionale Struktur besitzen, werden von dieser Erfindung umfasst. Für einen Fachmann ist es ohne Weiteres ersichtlich, dass ein Peptidomimetikum aus jedem der im vorhergehenden Abschnitt beschriebenen modifizierten Peptide oder aus einem Peptid erzeugt werden kann, das mehr als eine der im vorhergehenden Abschnitt beschriebenen Modifikationen trägt. Ferner ist offensichtlich, dass die Peptidomimetika dieser Erfindung neben ihrer Verwendung als therapeutische Verbindungen auch verwendet werden können, um sogar noch stärkere nichtpeptidische Verbindungen zu entwickeln. Spezielle Beispiele für Peptidomimetika, die sich von den im vorhergehenden Abschnitt beschriebenen Peptiden ableiten, sind weiter unten angegeben. Diese Beispiele dienen der Veranschaulichung und sind nicht einschränkend, was andere oder zusätzliche Modifikationen betrifft.

A. Peptide mit einer reduzierten isosteren Pseudopeptidbindung (&PSgr;(CH2NH)]

Proteasen wirken auf Peptidbindungen. Daraus folgt, dass eine Substitution von Peptidbindungen durch Pseudopeptidbindungen Resistenz gegen Proteolyse vermittelt. Es wurde eine Reihe von Pseudopeptidbindungen beschrieben, die im Allgemeinen die Peptidstruktur und die biologische Aktivität nicht beeinträchtigen. Die reduzierte isostere Pseudopeptidbindung ist eine geeignete Pseudopeptidbindung, von der bekannt ist, dass sie die Stabilität gegenüber enzymatischer Spaltung ohne oder mit nur geringem Verlust an biologischer Aktivität verbessert (Couder et al. (1993), Int. J. Peptide Protein Res., 41: 181-184). Die Aminosäuresequenzen dieser Peptide können also mit den Sequenzen der oben beschriebenen L-Aminosäurepeptide identisch sein [z. B. SEQ ID NO:4-12), außer dass ein oder mehrere Peptidbindungen durch eine isostere Pseudopeptidbindung ersetzt sind. Vorzugsweise ist die Peptidbindung substituiert, die sich dem N-Terminus am nächsten befindet, da eine solche Substitution Resistenz gegenüber Proteolyse durch Exopeptidasen vermitteln sollte, die am N-Terminus wirken. Die Synthese von Peptiden mit ein oder mehreren reduzierten isosteren Pseudopeptidbindungen ist dem Fachmann bekannt (Couder et al. (1993), wie oben zitiert).

B. Peptide mit einer Retro-Inverso-Pseudopeptidbindung [&PSgr;(NHCO)]

Um Resistenz gegenüber Proteolyse zu vermitteln, können Peptidbindungen auch durch Retro-Inverso-Pseudopeptidbindungen substituiert werden (Dalpozzo et al. (1993), Int. J. Peptide Protein Res., 41: 561-566). Bei dieser Modifikation können die Aminosäuresequenzen der Peptide mit den Sequenzen der oben beschriebenen L-Aminosäurepeptide [z. B. SEQ ID NO:4-12] identisch sein, außer dass ein oder mehrere Peptidbindungen durch eine Retro-Inverso-Pseudopeptidbindung ersetzt sind. Vorzugsweise ist die Peptidbindung substituiert, die sich dem N-Terminus am nächsten befindet, da eine solche Substitution Resistenz gegenüber Proteolyse durch Exopeptidasen vermitteln sollte, die am N-Terminus wirken. Die Synthese von Peptiden mit ein oder mehreren reduzierten Retro-Inverso-Pseudopeptidbindungen ist dem Fachmann bekannt (Dalpozzo et al. (1993), wie oben zitiert).

C. Peptoidderivate

Peptoidderivate von Peptiden stellen eine weitere Form modifizierter Peptide dar, die die für die biologische Aktivität wichtigen strukturellen Determinanten beibehalten, die Peptidbindungen jedoch eliminieren und dadurch Resistenz gegenüber Proteolyse vermitteln (Simon et al., 1992, Proc. Natl. Acad. Sci. USA, 89: 9367-9371). Peptoide sind Oligomere von N-substituierten Glycinen. Es wurde eine Reihe von N-Alkylgruppen beschrieben, von denen jede der Seitenkette einer natürlichen Aminosäure entspricht (Simon et al. (1992), wie oben zitiert). Die Sequenz von N-Alkylgruppen eines Peptoids, das dem Peptid p53p363-373 [SEQ ID NO:4] entspricht, wäre also: wobei die N-Alkylgruppen des Peptoids den natürlichen Aminosäuren wie folgt entsprechen: Narg → Arg Nala → Ala Nhhis → His Nhser → Ser Naeg → Lys. Die Bezeichnung der Peptoid-N-Alkylgruppen folgt Simon et al. (1992) (wie oben zitiert).

Obwohl in dem obigen Beispiel jede Aminosäure des Peptids durch das entsprechende N-substituierte Glycin ersetzt ist, ist es offensichtlich, dass nicht alle Aminosäuren ersetzt sein müssen. Beispielsweise kann der N-terminale Rest der Einzige sein, der ersetzt ist, oder es können einige wenige Aminosäuren durch die entsprechenden N-substituierten Glycine ersetzt sein.

III. PHARMAZEUTISCHE ZUSAMMENSETZUNGEN

Die Fähigkeit der oben beschriebenen Peptide und Zusammensetzungen dieser Erfindung, die DNA-bindende Aktivität von p53 zu aktivieren und so die oben beschriebenen zellulären Funktionen von p53 zu aktivieren, ermöglicht ihre Verwendung als pharmazeutische Zusammensetzung bei einer Reihe therapeutischer Regime. Die vorliegende Erfindung umfasst daher neue therapeutische pharmazeutische Zusammensetzungen und betrifft Verfahren zur Behandlung eines Menschen oder eines Tiers mit solchen Zusammensetzungen. Der Begriff "pharmazeutisch", wie er hier verwendet wird, beinhaltet veterinärmedizinische Anwendungen der Erfindung.

Zur Herstellung der pharmazeutischen Zusammensetzungen der vorliegenden Erfindung wird wenigstens ein Peptid (oder Peptidomimetikum) oder, alternativ, eine Mischung von Peptiden (oder Peptidomimetika) dieser Erfindung als Wirkstoff innig mit einem pharmazeutischen Träger vereinigt, der entsprechend herkömmlichen pharmazeutischen Compoundierungsmethoden ausgewählt und hergestellt wird. Dieser Träger kann abhängig von der für die Verabreichung gewünschten Herstellungsform, z. B. oral, sublingual, rektal, nasal oder parenteral, zahlreiche verschiedene Formen annehmen.

Pharmazeutisch verträgliche feste oder flüssige Träger oder Komponenten, die zugegeben werden können, um die Zusammensetzung zu verbessern oder zu stabilisieren oder um die Herstellung der Zusammensetzung zu erleichtern, umfassen u.a., ohne darauf beschränkt zu sein, Sirup, Wasser, isotonische Kochsalzlösung, 5 % Dextrose in Wasser oder gepufferter Natrium- oder Ammoniumacetatlösung, Öle, Glycerin, Alkohole, Aromastoffe, Konservierungsmittel, Farbstoffe, Stärken, Zucker, Füllstoffe, Granulierungsmittel, Gleitmittel und Bindemittel. Der Träger kann auch ein Material zur verzögerten Freisetzung enthalten, wie Glycerylmonostearat oder Glyceryldistearat, allein oder mit einem Wachs. Die Menge an festem Träger variiert, wird aber vorzugsweise zwischen etwa 20 mg und etwa 1 g pro Dosierungseinheit betragen.

Pharmazeutische Zusammensetzungen der Peptide dieser Erfindung oder Derivate davon können daher als Lösungen lyophilisierter Pulver zur parenteralen Verabreichung formuliert werden. Das zurzeit bevorzugte Verfahren ist die intravenösen Verabreichung.

Pharmazeutische Zusammensetzungen dieser Erfindung können auch topische Formulierungen umfassen, die in einen geeigneten Grund- oder Trägerstoff eingearbeitet sind, damit sie an der Stelle des Bereichs angewendet werden können, an dem die lokale Wirkung ausgeübt werden soll. Dementsprechend beinhalten solche topischen Zusammensetzungen diejenigen Formen, bei denen die Formulierung äußerlich durch direkten Kontakt mit der zu behandelnden Hautoberfläche appliziert wird. Übliche Formen für diesen Zweck beinhalten, ohne darauf beschränkt zu sein, Cremes, Salben, Lotionen, Gele, Pasten, Pulver und Formulierungen mit ölartigen Absorptionsgrundlagen, wasserlöslichen Grundlagen und Grundlagen vom Emulsionstyp.

Darüber hinaus können die Verbindungen der vorliegenden Erfindung auch in Liposomen verkapselt verabreicht werden. Abhängig von ihrer Löslichkeit können die Zusammensetzungen sowohl in der wässrigen Schicht als auch in der Lipidschicht vorliegen oder in dem, was im Allgemeinen als Liposomensuspension bezeichnet wird. Die hydrophobe Schicht umfasst im Allgemeinen, aber nicht ausschließlich, Phospholipide wie Lecithin und Sphingomyelin, Steroide wie Cholesterin, mehr oder weniger ionische Tenside wie Diacetylphosphat, Stearylamin oder Phosphatidsäure und/oder andere Materialien hydrophober Natur.

Die Zusammensetzungen können, falls gewünscht, durch aktive pharmazeutische Zusatzstoffe supplementiert sein. Gegebenenfalls können antibakterielle Mittel, antiseptische Mittel und Antioxidanzien in den Zusammensetzungen vorliegen, wo sie ihre üblichen Funktionen erfüllen.

Dosierungseinheiten solcher pharmazeutischer Zusammensetzungen, die die Peptide oder die peptidomimetischen Verbindungen der Erfindung enthalten, enthalten vorzugsweise etwa 1 mg bis 5 g des Peptids oder des Salzes davon.

Die Begriffe "geeignete Mengen" oder "therapeutisch wirksame Menge", wie sie hier verwendet werden, bedeuten eine Menge, die wirksam ist, um die weiter unten bezeichneten Zustände zu behandeln. Ein Peptid oder ein Peptidomimetikum der vorliegenden Erfindung ist im Allgemeinen wirksam, wenn es parenteral in Mengen von über etwa 1 mg pro kg Körpergewicht bis etwa 30 mg/kg verabreicht wird.

IV. BEHANDLUNGSVERFAHREN/ANWENDUNGSMÖGLICHKEITEN

Die oben beschriebenen und identifizierten pharmazeutischen Zusammensetzungen mit der Fähigkeit, die DNA-bindende Aktivität von p53 zu aktivieren, eignen sich bei therapeutischen Regimen, die die zellulären Funktionen von p53 ausnützen.

Nur als ein Beispiel können die pharmazeutischen Zusammensetzungen der Erfindung eingesetzt werden, um die zelluläre Antwort auf DNA-schädigende Mittel, wie UV-Strahlung, Strahlung und Chemotherapeutika, die zur Krebsbehandlung verwendet werden, zu induzieren. Bei Verabreichung einer geeigneten Menge einer Zusammensetzung der Erfindung können Patienten höhere Dosen solcher DNA-schädigenden Mittel tolerieren. Beispielsweise können die pharmazeutischen Zusammensetzungen der Erfindung die Form von Sonnencremes oder anderen vor Sonne schützenden Zusammensetzungen haben, die topisch verabreicht werden. Alternativ können die Zusammensetzungen der Erfindung parenteral (beispielsweise intravenös) als Zusatzstoff an Patienten verabreicht werden, die eine traditionelle Krebstherapie erhalten, bei der DNA-schädigende Mittel eingesetzt werden (z. B. Strahlungstherapie und Chemotherapie). Falls zweckmäßig, können auch andere Verabreichungsweisen zur Anwendung kommen.

Die Zusammensetzungen der Erfindung können auch als die alleinige Behandlung für Patienten mit Krebs verwendet werden, um die Tumorsuppressorfunktion von p53, das in Tumorzellen vorhanden ist, zu verbessern, egal ob Wildtyp oder Mutante. Die Verabreichung der Zusammensetzung an einen Krebspatienten ermöglicht so die Hemmung von Wachstum oder Proliferation von Tumorzellen oder die Apoptose (Zelltod) von Tumorzellen. Zweckmäßig wird eine geeignete Menge der Zusammensetzung der Erfindung systemisch oder lokal auf die Stelle des Tumors verabreicht.

Ferner können die Zusammensetzungen der Erfindung bei Verfahren zur Suppression der Zellproliferation bei anderen Krankheiten als Krebs verwendet werden, die durch aberrante Zellproliferation gekennzeichnet sind. Zu diesen Krankheiten gehören Psoriasis, Atherosklerose und arterielle Restenose. Dieses Verfahren wird durchgeführt, indem man einem Patienten eine geeignete Menge der gewählten Zusammensetzung topisch, lokal oder systemisch verabreicht.

Eine andere therapeutische Verwendung der Zusammensetzungen der Erfindung besteht in der Induktion der Apoptose spezifischer Zellen, wie proliferierender Lymphozyten. Gemäß diesem Verwendungsverfahren wird einem Subjekt eine geeignete Menge einer Zusammensetzung der Erfindung verabreicht, um die Entwicklung einer Immuntoleranz zu verbessern. Dieses Verfahren kann sowohl Formen der in vivo- als auch der ex vivo-Verabreichung verwenden. Vorzugsweise eignet sich diese Therapie als alleinige Behandlung oder als begleitende Behandlung zur Verhinderung von Transplantatabstoßung oder zur Behandlung von Autoimmunerkrankungen, z. B. systemischem Lupus erythematosis, rheumatoider Arthritis und dergleichen.

Die Peptide und Peptidomimetika der Erfindung können auch bei Verfahren zum Monitoring des Fortschreitens einer Erkrankung verwendet werden, insbesondere bei einem Patienten, der eine Therapie erhält, wie sie von der vorliegenden Erfindung vorgesehen ist, oder um festzustellen, welche Patienten für diese Therapie geeignet sind. Ein solches Verfahren beinhaltet den Erhalt einer Tumorbiopsie aus dem Patienten, die Herstellung eines Extrakts [Halazonetis et al. (1993), wie oben zitiert] und den Test dieses Extrakts auf p53-abhängige DNA-Bindung in Gegenwart und Abwesenheit eines Peptids oder Peptidomimetikums der Erfindung (wie z. B. in nachfolgendem Beispiel 2 beschrieben). Wenn das Peptid die DNA-Bindung erhöht, dann ist die therapeutische Verwendung der Zusammensetzungen dieser Erfindung angezeigt und das Ergebnis der Therapie wird verbessert.

BEISPIELE

Die folgenden Beispiele veranschaulichen die bevorzugten Zusammensetzungen und Verfahren dieser Erfindung. In Anbetracht dieser Offenbarung ist es für den Fachmann offensichtlich, dass andere geeignete Fragmente und Analoge der hier beschriebenen Peptide von einem Fachmann leicht identifizierbar sind und daher von der Erfindung umfasst sind. Diese Beispiele dienen lediglich der Veranschaulichung und schränken den Umfang der Erfindung nicht ein.

Beispiel 1 – Synthese von Peptiden

Es wurden Peptide synthetisiert, die der negativen Regulatorregion 1 (NRR1) entsprechen, die die Reste 361-383 von humanem p53 umspannt. Die Peptide wurden auf einem automatisierten Milligen 9050-Synthesegerät nach der Fmoc-Standardvorschrift zusammengesetzt [Fields und Noble (1990), Int. J. Pept. Protein Res., 35: 161-214]. Nach Abspaltung wurden die Peptide durch Reversed Phase-HPLC mit einer C18-Säule und einem linearen Acetonitrilgradienten in 0,1 %iger wässriger Trifluoressigsäure gereinigt. Effizienz und Genauigkeit der Synthese wurden durch Analyse der Aminosäurezusammensetzung und/oder Massenspektroskopie verfolgt. Die vorliegende Erfindung wird durch die speziellen chemischen Verfahren oder Synthesegeräte, die zur Herstellung der erfindungsgemäßen Peptide verwendet wurden, nicht eingeschränkt; solche Faktoren sind für die Aktivität der erfindungsgemäßen Peptide auch nicht entscheidend.

Es wurden die folgenden Peptide synthetisiert:

Alle Peptide waren an ihrem N-Terminus acetyliert und enthielten an ihrem C-Terminus eine gebundene chemische Amidgruppe.

Analyse der Aminosäurezusammensetzung und Massenspektroskopie zeigten, dass Peptid p53pC360-386 tatsächlich aus einer Mischung von Peptiden bestand. Zusätzlich zu dem erwarteten Peptid enthielt die Mischung Peptide, denen ein Glycin, ein Phenylalanin oder Kombinationen davon fehlten [SEQ ID NO:23, 24 und 25]. Weil sich die letztgenannten Peptide von dem erwarteten Peptid nur an ihren Enden unterscheiden, ist zu erwarten, dass alle diese Peptide biologisch aktiv sind. Dies wird durch den nachfolgenden Beweis gestützt, dass verschiedene Peptide, die der zentralen Region von p53pC360-386 entsprechen, biologische Aktivität besitzen.

Jedes Peptid wurde in einem herkömmlichen Puffer, z. B. 10 oder 100 mM Tris-HCl-Puffer, pH 8, in einer Konzentration von 10 mg/ml gelöst. Es kann jeder Puffer verwendet werden, in dem die Peptide löslich sind und der mit dem unten beschriebenen DNA-Bindungsassay kompatibel ist. Wenn die Peptide einmal gelöst waren, wurden sie bei –70 °C aufbewahrt.

Beispiel 2 – DNA-Bindungsassay

Die Fähigkeit der erfindungsgemäßen Peptide, die DNA-Bindung von humanem p53 zu aktivieren, wurde mit einem Standard-DNA-Bindungsassay für p53 getestet [Halazonetis et al.

(1993), wie oben zitiert; Halazonetis und Kandil (1993), wie oben zitiert]. Dieser Assay verwendet in vitro-translatiertes humanes Wildtyp-p53 oder p53-Tumormutanten und spezifische Oligonucleotide, die p53-Bindungsstellen enthalten. Diese Reagenzien und Verfahren zu ihrer Herstellung werden nachfolgend beschrieben.

Humanes p53 wurde durch in vitro-Translation mit Plasmiden hergestellt, die die vollständige für p53 codierende Sequenz enthielten. Zur Herstellung dieser Plasmide wurden übliche Klonierungsverfahren verwendet [Ausubel et al. (1994), "Cunent Protocols in Molecular Biology", Greene Publishing Associates und John Wiley & Sons, New York; Innis et al. (1990), PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego].

Reagenzien

Plasmid pGEMhump53wt codiert für vollständiges humanes Wildtyp-p53. Dieses Plasmid wurde mittels PCR [Innis et al. (1990), wie oben zitiert] unter Verwendung einer humanen p53-cDNA hergestellt, die dem Fachmann auf diesem Gebiet leicht zugänglich ist. Das PCR-Verfahren wurde so geführt, dass einmalige Restriktionsschnittstellen in humanes p53 eingebaut wurden: Kpn I an Codon 218, Sst I an Codon 299, Sst II an Codon 333, Bst BI an Codon 338 und Sal I unmittelbar nach dem Terminationscodon. Eine Msc I-Stelle an Codon 138 wurde eliminiert. Diese Änderungen veränderten die Aminosäuresequenz des codierten p53 nicht und erfolgten lediglich, um die Konstruktion mutierter Proteine mit Punktmutationen, die mit menschlichem Krebs assoziiert sind, zu beschleunigen. Das PCR-Produkt der humanen p53-cDNA wurde mit Nco I und Sal I verdaut und in den Vektor pGEM4 [Promega, Madison, WI] kloniert, der mit Eco RI und Sal I linearisiert war. Synthetische Oligonucleotide wurden verwendet, um die Eco RI-Stelle des Vektors und die Nco I-Stelle am Initiationscodon von p53 zu verbrücken. Die vollständige Nucleotidsequenz des Eco RI-Sal I-Inserts von humanem p53 in Plasmid pGEMhump53wt ist als SEQ ID NO:26 dargestellt. Plasmid pGEMhump53wt wurde zur Herstellung aller nachfolgend beschriebenen p53-Mutanten und auch zur Expression von Wildtyp-p53 durch in vitro-Translation verwendet.

Plasmid pGEMhump53wt wurde verwendet, um Plasmide zu erzeugen, die für mutierte p53-Proteine codieren, die häufig mit menschlichem Krebs assoziiert sind. Die eingebauten Mutationen sind diejenigen, die am häufigsten mit humanen Tumoren assoziiert sind [Caron de Fromentel et al. (1992), Genes Chrom. Cancer, 4: 1-15]. Im Einzelnen wurden die folgenden Mutanten (alles Mutanten mit einzelnen Aminosäuresubstitutionen) erzeugt: His175, hat Histidin an Position 175 von p53; G1n248, hat Glutamin an Position 248 von p53; Trp248, hat Tryptophan an Position 248 von p53; Ser249, hat Serin an Position 249 von p53; His273, hat Histidin an Position 273 von p53; Cys273, hat Cystein an Position 273 von p53; Trp282, hat Tryptophan an Position 282 von p53; Ser239, hat Serin an Position 239 von p53; und Ile237, hat Isoleucin an Position 237 von p53. Alle p53-Mutanten wurden mit PCR hergestellt [Innis et al. (1990), wie oben zitiert]. DNA-Fragmente, die die gewünschten Mutationen enthielten, wurden in pGEMhump53wt kloniert, wobei die am besten passenden Restriktionsstellen verwendet wurden, und durch Sequenzierung bestätigt. Die resultierten Plasmide wurden als pGEMhump53His175 usw. bezeichnet.

Plasmide pGEMhump53D300-308, pGEMhump53D300-317, pGEMhump53D300-321, pGEMhump53D356-393, pGEMhump53D364-393, pGEMhump53D379-393, pGEMhump53D384-393 und pGEMhump53D388-393 codieren für Proteine, die Deletionen in humanem Wildtyp-p53 enthalten. Diese Deletionen umfassen die Reste 300-308, 300-317, 300-321, 356-393, 364-393, 379-393, 384-393 bzw. 388-393 von p53-SEQ ID NO:2. Diese Deletionen wurden mit üblichen Rekombinationsmethoden erzeugt [Ausubel et al. (1994), wie oben zitiert; Innis et al. (1990), wie oben zitiert].

Assayverfahren

Plasmide der pGEMhump53-Reihe wurden verwendet, um nach Standardverfahren in vitro-transkribierte mRNA und anschließend in vitro-translatiertes Protein herzustellen [Halazonetis et al. (1988), Cell, 55: 917-924]. Die in vitro-translatierten Proteine wurden wie früher beschrieben auf DNA-Bindung getestet [Halazonetis et al (1993), wie oben zitiert]. Kurz gesagt wird das in vitro-translatierte Protein mit einem radioaktiv markierten Oligonucleotid, das eine p53-Bindungsstelle enthält, in Gegenwart unspezifischer Kompetitor-DNA inkubiert. Die Reaktionsmischung wird 20 min bei Raumtemperatur inkubiert und direkt auf ein natives 5%iges Polyacrylamidelektrophoresegel aufgetragen. Bei dieser Art von DNA-Bindungsassay wandert freie DNA an das untere Ende des Gels, während p53/DNA-Komplexe langsamer wandern. Die Anwesenheit langsam wandernder DNA, die durch Autoradiographie nachgewiesen werden kann, zeigt also DNA-Bindung von p53 [Halazonetis et al. (1993), wie oben beschrieben; Halazonetis und Kandil (1993), wie oben beschrieben].

Als unspezifische Kompetitor-DNAs verwendeten wir pro Reaktion 0,1 &mgr;g einzelsträngiges Oligonucleotid MI7 [GAGAGCCCCAGTTACCATAACTACTCT, SEQ ID NO:27] und 0,05 &mgr;g doppelsträngiges Oligonucleotid TF3 [ATCACGTGATATCACGTGATATCACGTGAT, SEQ ID NO:28].

Für diese Experimente wurde eine Reihe doppelsträngiger Oligonucleotide, die p53-Bindungsstellen enthielten, radioaktiv markiert. Diese beinhalteten Oligonucleotide Ewaf1, BC.V4A und BC. Die Oligonucleotide BC.V4A und BC enthalten künstliche, von p53 erkannte Stellen. Diese drei Stellen sind nachfolgend angegeben, und die spezifischen Pentanucleotid-Repeats, die von p53 erkannt werden, sind durch Bindestriche abgegrenzt. Die Sequenz von Oligonucleotid Ewaf1 (oberer Strang) ist: CCC-GAACA-TGTCC-CAACA-TGTTG-GGG [SEQ ID NO:29]. Dieses Oligonucleotid entspricht dem Enhancer, der die p53-abhängige Transkription des waf1-Gens treibt [El-Deiry et al. (1993), Cell, 75: 817-825]. Die Sequenz von Oligonucleotid BC.V4A (oberer Strang) ist: TC-GAGCA-TGTTC-GAGCA-TGTTC-GAGCATGT [SEQ ID NO:30], und die Sequenz von Oligonucleotid BC (oberer Strang) ist: CC-GGGCA-TGTCC-GGGCA-TGTCC-GGGCATGT [SEQ ID NO:31]. Diese DNAs wurden mit 32P-markierten Nucleotiden radioaktiv markiert [Halazonetis et al. (1988), wie oben zitiert].

Die mit diesem Assay erhaltenen Ergebnisse sind in den nachfolgenden Beispielen 3 bis 5 dargestellt.

Beispiel 3 – Kartierung negativer Regulatorregionen in Wildtyp-p53

Der DNA-Bindungsassay für p53 beinhaltet die Inkubation von in vitro-translatiertem p53 mit radioaktiv markierten DNAs, die p53-Bindungsstellen enthalten, wie oben in Beispiel 2 beschrieben. Für diese Untersuchungen erfolgte die Inkubation mit Oligonucleotid BC.V4A. An dieses Oligonucleotid bindet Wildtyp-p53. Seine DNA-bindende Aktivität unterliegt jedoch einer Herunterregulierung durch die negative Regulatorregion 1 (NRR1), die am C-Terminus von p53 kartiert. Deletion der Reste 364-393 von humanem p53 aktiviert daher die DNA-Bindung [Hupp et al. (1992), wie oben zitiert; Halazonetis und Kandil (1993), wie oben zitiert]. Wir reproduzierten diese Ergebnisse mit Oligonucleotid BC.V4A und Plasmid pGEMhump53D364-393. DNA-Bindung einer Deletionsmutante, der die Reste 353-360 fehlten, wurde jedoch nicht aktiviert (siehe Tabelle 1).

Um die NRR1 feiner zu kartieren und andere NRR zu identifizieren, die im C-Terminus von p53 vorhanden sein könnten, untersuchten wir die DNA-bindende Aktivität der in obigem Beispiel 2 beschriebenen p53-Deletionsmutanten. Wie in Tabelle 1 gezeigt, wurden die Mutanten p53D356-393, p53D364-393, p53D379-393 hinsichtlich Bindung an Oligonucleotid BC.V4A aktiviert. Im Gegensatz dazu wurden die Mutanten p53D384-393 und p53D388-393 nicht aktiviert. Diese Ergebnisse kartieren die C-terminale Grenze der NRR1 an Rest 383 von p53. Die N-terminale Grenze von NRR1 liegt sicherlich C-terminal von Rest 355 von p53, da die Reste 322-355 von p53 die p53-Tetramerisierungsdomäne bilden [Wang et al. (1994), wie oben zitiert]. Analyse der DNA-bindenden Aktivität einer Deletionsmutante, der die Reste 353-360 fehlen, zeigt, dass sie eine funktionelle NRR1 enthält (Tabelle 1), was anzeigt, dass sich die N-terminale Grenze von NRR1 an Rest 360 befindet. Die NRR1 befindet sich also innerhalb der Reste 361-383 von p53.

Eine Prüfung der Mutanten p53D300-308, p53D300-317 und p53D300-321 ergab die unerwartete Anwesenheit einer zweiten negativen Regulatorregion (NRR2), da alle diese drei Deletionsmutanten aktivierte Bindung an Oligonucleotid BC.V4A zeigten. NRR2 überlappt nicht mit der NRR1, da die beiden NRRs durch die p53-Tetramerisierungsdomäne getrennt sind (Reste 322-355 von p53 [Wang et al. (1994), wie oben zitiert]). Deletierte Reste in getesteter Mutante Bindung von mutiertem p53 an BC.V4A-DNA keine (Wildtyp-p53) 364-393 3+ 356-393 3+ 379-393 3+ 384-393 +/– 388-393 +/– 353-360 +/– 300-308 3+ 300-317 3+ 300-321 3+

Beispiel 4 Aktivierung der DNA-Bindung von p53 durch Antikörper PAb421

Der p53-DNA-Bindungsassay beinhaltet die Inkubation von in vitro-translatiertem p53 mit radioaktiv markierten DNAs, die p53-Bindungsstellen enthalten, wie den Oligonucleotiden BC, BC.V4A und Ewaf1 (siehe obiges Beispiel 2). Die Wirkung der Inkubation in Gegenwart oder Abwesenheit von 0,1 &mgr;g Anti-p53-Antikörper PAb421 (erhältlich von Oncogene Science, Uniondale, NY) auf die DNA-Bindung von p53 ist in Tabelle 2 gezeigt. Wildtyp-p53 bindet an die Oligonucleotide BC, BC.V4A und Ewaf1, wie sich an einer langsam wandernden 32P-markierten Spezies zeigt, die den p53/DNA-Komplex darstellt. In Gegenwart des Antikörpers PAb421 wandert die langsam wandernde 32P-markierte Spezies sogar noch langsamer, was eine größere räumliche Ausdehnung zeigt, da sie nun auch noch Antikörper PAb421 enthält. Darüber hinaus nimmt die Intensität der von der langsam wandernden 32P-markierten Spezies emittierten Radioaktivität in Gegenwart von PAb421 zu, was mit der Beobachtung übereinstimmt, dass Antikörper PAb421 die DNA-Bindung von Wildtyp-p53 aktiviert. [Hupp et al. (1992), wie oben zitiert; Halazonetis et al.

(1993), wie oben zitiert; Halazonetis und Kandil (1993), wie oben zitiert]. Da Wildtyp-p53 ziemlich effizient an Oligonucleotid BC bindet, ist die Fähigkeit von Antikörper PAb421, die DNA-Bindung von Wildtyp-p53 zu aktivieren, bei den Oligonucleotiden BC.V4A und Ewaf1 deutlicher. Antikörper PAb421 aktiviert die DNA-Bindung von Wildtyp p53, indem er die negative Regulatorregion 1 (NRR1) am p53-C-Terminus inaktiviert (siehe Hintergrund der Erfindung).

Einige der häufig mit humanen Tumoren assoziierten p53-Mutanten (siehe obiges Beispiel 2) wurden auch mit Oligonucleotid BC auf DNA-Bindung untersucht (siehe Tabelle 2). Übereinstimmend mit früheren Berichten [Bargonetti et al. (1992), wie oben zitiert] zeigte keine von ihnen im Vergleich mit Wildtyp-p53 eine signifikante DNA-bindende Aktivität. In Gegenwart von Antikörper PAb421 zeigten die Mutanten Gln248, His273, Cys273, Trp282 und Ser239 jedoch signifikante DNA-bindende Aktivität (siehe Tabelle 2), die für mehrere dieser Mutanten mit der von Wildtyp-p53 äquivalent war. Aminosäuresubstitution in p53-Mutante Stimulation der DNA-Bindung durch PAb421 keine + Gln248 2+ His273 3+ Cys273 3+ Trp282 3+ Ser239 3+

Diese Experimente lassen vermuten, dass Inaktivierung der NRR1 durch PAb421 die DNA-bindende Aktivität bei einigen der häufig mit menschlichem Krebs assoziierten p53-Mutanten wiederherstellen kann. Die erfindungsgemäßen Peptide inaktivieren auch die Funktion der NRR1 (wenn auch durch einen anderen Mechanismus als PAb421), wie in den folgenden Untersuchungen gezeigt wird. Daher kann das Spektrum von p53-Mutanten, die einer therapeutischen Intervention mit den erfindungsgemäßen Peptiden zugänglich sind, festgestellt werden, indem man p53-Mutanten identifiziert, deren DNA-bindende Aktivität einer Stimulation mit PAb421 zugänglich ist.

Beispiel 5 – Aktivierung der DNA-Bindungvon p53 durch Peptide der Erfindung

DNA-Bindungsassays erfolgten wie oben beschrieben (Beispiel 2) in Gegenwart oder Abwesenheit von Peptiden, die NRR1-Fragmenten von humanem p53 entsprachen. Die untersuchten Peptide sind in obigem Beispiel 1 beschrieben und wurden bei Konzentrationen zwischen 0,02 und 0,4 mM getestet. Die Ergebnisse sind in Tabelle 3 zusammengefasst.

Wir untersuchten zunächst die Fähigkeit von Peptid p53pC360-386, die Bindung von Wildtyp-p53 an Oligonucleotid BC.V4A zu aktivieren. In Abwesenheit des Peptids bindet Wildtyp p53 schwach an diese DNA. In Gegenwart von 0,02 bis 0,2 mM Peptid p53pC360-386 wird die DNA-Bindung von Wildtyp-p53 jedoch aktiviert. Das Ausmaß der Aktivierung, das durch 0,02 mM Peptid p53pC360-386 erreicht wird, ist ähnlich demjenigen, das mit 0,1 &mgr;g Antikörper PAb421 erreicht wird. Die Fähigkeit von Peptid p53pC360-386, DNA-Bindung von Wildtyp-p53 zu aktivieren, ist nicht auf Oligonucleotid BC.V4A beschränkt. DNA-Bindung an Oligonucleotid Ewaf1 wurde ebenfalls aktiviert (siehe Tabelle 3).

Da Peptid p53pC360-386 die DNA-Bindung von Wildtyp-p53 aktivierte, untersuchten wir anschließend, ob bei einer Trunkierung dieses Peptids am N- oder C-Terminus die Aktivität erhalten bleiben würde. Die Peptide p53p362-386, p53p363-386, p53p363-382 und p53p367-386 wurden in einem DNA-Bindungsassay mit Oligonucleotid Ewaf1 untersucht, und die Daten sind in Tabelle 3 zusammengefasst. Bei Peptidkonzentrationen von 0,1 bis 0,3 mM aktivierten alle Peptide die DNA-Bindung von Wildtyp-p53. Ein noch kleineres Peptid, p53p371-383, wurde mit Oligonucleotid BC.V4A getestet. Bei Peptidkonzentrationen von 0,2 bis 0,4 mM aktivierte Peptid p53p371-383 die Bindung von Wildtyp-p53.

Anschließend untersuchten wir die Fähigkeit der Peptide p53p363-373, p53p368-380 und p53p373-383, die DNA-Bindung von humanem Wildtyp-p53 zu aktivieren. Diese Peptide entsprechen aufeinanderfolgenden, partiell überlappenden Regionen der p53-NRR1 (Reste 363-373, 368-380 bzw. 373-383 von humanem p53). Alle drei Peptide aktivierten die Bindung von Wildtyp-p53 an Oligonucleotid Ewaf1, wenn sie bei einer Konzentration von 0,4 mM getestet wurden. Die Peptide p53p363-373 und p53p368-380 waren bei der Aktivierung der DNA-Bindung etwas stärker als p53p373-383. Nichtsdestoweniger lassen diese Ergebnisse vermuten, dass Peptide, die kleinen Bereichen der p53-NRR1 entsprechen, bei der Aktivierung der DNA-Bindung von p53 wirksam sein können. Da die Peptide p53p363-373 und p53p373-383 außerdem im Grunde genommen nicht überlappen, müssen die stimulatorischen Peptide kein spezifisches Minimalfragment der p53-NRR1 enthalten.

Um zu prüfen, ob die erfindungsgemäßen Peptide auch die DNA-Bindung von p53-Mutanten aktivieren, verwendeten wird die p53-His273-Mutante als Repräsentanten der Klasse von Mutanten, deren DNA-Bindung durch Inaktivierung von NRR1 aktiviert werden kann (siehe obiges Beispiel 4). Die p53His273-Mutante bindet bei dem hier beschriebenen DNA-Bindungsassay nicht an Oligonucleotid BC. Bei Inkubation mit den Peptiden p53pC360-386 oder p53p371-383 bei Konzentrationen von 0,2 bzw. 0,4 mM zeigte p53His273 jedoch DNA-bindende Aktivität.

Wir schließen daraus, dass die erfindungsgemäßen Peptide die DNA-Bindung von Wildtyp-p53 und ausgewählter p53-Mutanten ebenso effizient wie Antikörper PAb421 aktivieren. Obwohl sowohl die Peptide der Erfindung als auch Antikörper PAb421 die NRR1 von p53 inaktivieren, unterscheidet sich ihr Wirkungsmechanismus. So bindet Antikörper PAb421 an NRR1 und inaktiviert sie durch Maskierung. Im Gegensatz dazu konkurrieren die erfindungsgemäßen Peptide mit dem endogenen NRR1 von p53 um die Bindung an eine zweite negative Regulatorregion, vielleicht NRR2. Sie sind also Kompetitoren von NRR1, keine Maskierungsmittel.

  • * ND = nicht bestimmt

Beispiel 6 – Aktivierung der DNA-Bindung von p53 durch ein cyclisches Hexapeptid der Erfindung

Das folgende modifizierte Peptid ist ein cyclisches Peptid, das den Resten 378-382 von humanem p53 entspricht. Seine Sequenz ist: Ser-Arg-His-Lys-Lys. Damit dieses Peptid cyclisch werden kann, wurde an seinem C-Terminus ein D-Alanin eingebaut. Dieses Peptid wird c[SRHKKa] genannt, und seine chemische Struktur ist nachfolgend gezeigt:

Peptid c[SRHKKa] wurde in dem in Beispiel 2 beschriebenen DNA-Bindungsassay für p53 geprüft. Bei einer Konzentration von 0,1 mM aktivierte dieses Peptid die DNA-Bindung von p53 etwa zweimal effizienter als 0,05 mM Peptid p53p363-373 [SEQ ID NO:4]. Dieses Beispiel veranschaulicht, dass: 1) fünf Aminosäuren der p53-Sequenz ausreichen, um Aktivität zu vermitteln, und 2) dass cyclische Peptide, die gegenüber N-terminalen Peptidasen unempfindlich sind, Aktivität besitzen, wie in unserer ursprünglichen Anmeldung beansprucht.

Aus Gründen von Klarheit und Verständnis wurde die vorhergehende Erfindung durch Erläuterung und Beispiele in Verbindung mit speziellen Ausführungsformen in gewisser Ausführlichkeit beschrieben, wenngleich andere Aspekte, Vorteile und Abwandlungen für den Fachmann, den die Erfindung betrifft, offensichtlich sind. Die vorhergehende Beschreibung und die vorhergehenden Beispiele sollen die Erfindung veranschaulichen, ihren Umfang aber nicht einschränken. Abwandlungen der oben beschriebenen Ausführungsformen der Erfindung, die für den Fachmann auf dem Gebiet der Medizin, Immunologie, Hybridomtechnologie, Pharmakologie und/oder verwandten Gebieten offensichtlich sind, sollen von der Erfindung umfasst sein, die lediglich durch die anhängenden Ansprüche beschränkt wird.

Alle Veröffentlichungen und Patentanmeldungen, die in dieser Beschreibung erwähnt sind, sind für das Maß der Kenntnisse des Fachmanns, den diese Erfindung betrifft, maßgeblich. Veröffentlichungen und Patentanmeldungen sind hier ebenso vollinhaltlich Bestandteil der Beschreibung, als ob bei jeder einzelnen Veröffentlichung oder Patentanmeldung speziell und individuell angegeben worden wäre, dass sie vollinhaltlich Bestandteil der vorliegenden Beschreibung bildet.

Die obige Beschreibung beinhaltet zahlreiche Abwandlungen und Variationen der vorliegenden Erfindung, von denen zu erwarten ist, dass sie für einen Fachmann naheliegend sind. Solche Abwandlungen und Abänderungen der Zusammensetzungen und Verfahren der vorliegenden Erfindung werden vom Umfang der anliegenden Ansprüche nach unserer Auffassung umfasst.


Anspruch[de]
Peptid, umfassend wenigstens vier aufeinander folgende Aminosäuren einer negativen Regulatorregion, die in den Resten 361-383 der SEQ ID NO:2 von p53 kartiert, wobei das Peptid kein Subfragment von p53 ist, das Peptid DNA-Bindung von Wildtyp-p53 oder einer eine einzelne Aminosäuresubstitution enthaltenden p53-Mutante, die ausgewählt ist aus der Gruppe bestehend aus p53-ser239, p53-his273, p53-gln248 und p53-cys273, in einem p53-Bindungsassay aktiviert, und wobei das Peptid ein Molekulargewicht von weniger als 2000 Dalton aufweist. Peptid nach Anspruch 1, wobei das Peptid die Reste 363-373 (SEQ ID NO:4), 368-380 (SEQ ID NO:5), 373-383 (SEQ ID NO:6), 371-383 (SEQ ID NO:7), 363-382 (SEQ ID NO:8), 378-382 (Reste 8 bis 12 der SEQ ID NO:7), 367-386 (SEQ ID NO:9), 363-386 (SEQ ID NO:10), 362-386 (SEQ ID NO:11) oder 360-386 (SEQ ID NO:12) von humanem p53 umfasst. Peptid nach Anspruch 1, wobei das Peptid die Reste 363-370 (SEQ ID NO:14), 368-373 (SEQ ID NO:15), 368-372 (SEQ ID NO:16), 369-373 (SEQ ID NO:17), 370-375 (SEQ ID NO:18) oder 370-374 (SEQ ID NO:19) von humanem p53 umfasst. Peptid nach Anspruch 1, wobei wenigstens eine der wenigstens vier Aminosäuren durch den entsprechenden Rest einer nicht-humanen p53-Sequenz substituiert ist. Peptid nach Anspruch 1, wobei das Peptid sowohl L-Aminosäuren als auch D-Aminosäuren enthält. Peptid nach Anspruch 5, wobei die N-terminale Aminosäure des Peptids eine D-Aminosäure ist. Peptid nach Anspruch 5, wobei die C-terminale Aminosäure eine D-Aminosäure ist. Peptid nach Anspruch 1, wobei die wenigstens vier aufeinander folgenden Aminosäuren D-Aminosäuren sind, die in der negativen Regulatorregion (dargestellt durch die Reste 361-383 (SEQ ID NO:2) von humanem p53) in einer reversen Sequenzorientierung relativ zur Wildtyp-Sequenz kartieren. Peptid nach Anspruch 1, wobei das Peptid cyclisch ist. Peptid nach Anspruch 1, wobei ein oder mehrere natürliche Aminosäuren durch nicht-natürliche Aminosäuren ähnlicher chemischer Struktur substituiert sind. Peptid nach Anspruch 10, wobei die natürliche Aminosäure ein Serin ist und die nicht-natürliche Aminosäure ein Isoserin ist. Verfahren zur Identifizierung eines Peptidomimetikums, das DNA-Bindung von Wildtyp-p53 aktiviert, wobei das Verfahren umfasst: Auswählen einer Nichtpeptidylverbindung mit einer einem Peptid nach irgendeinem der Ansprüche 1 bis 11 ähnlichen Struktur und Bestimmen der Fähigkeit dieser Verbindung, DNA-Bindung in einem p53-DNA-Bindungsassay zu stimulieren. Verfahren zur Identifizierung eines Peptidomimetikums, das DNA-Bindung von Wildtyp-p53 aktiviert, wobei das Verfahren umfasst: Auswählen einer Verbindung, in der ein Teil eines Peptids nach irgendeinem der Ansprüche 1 bis 11 durch eine Nichtpeptidylfunktion mit ähnlicher Struktur substituiert ist, und Bestimmen der Fähigkeit dieser Verbindung, DNA-Bindung in einem p53-DNA-Bindungsassay zu stimulieren. Peptidomimetikum, umfassend wenigstens vier aufeinander folgende Aminosäuren einer negativen Regulatorregion, die in den Resten 361-383 (SEQ ID NO:2) von p53 kartiert, wobei das Peptidomimetikum die biologische Aktivität des Peptids nach Anspruch 1 besitzt, wobei das Peptid ein Molekulargewicht von weniger als 2000 Dalton aufweist. Peptidomimetikum, umfassend wenigstens vier aufeinander folgende Aminosäuren einer negativen Regulatorregion, die in den Resten 361-383 (SEQ ID NO:2) von p53 kartiert, wobei ein oder mehrere Peptidbindungen durch eine reduzierte isostere Pseudopeptidbindung ersetzt sind und das Peptidomimetikum die biologische Aktivität des Peptids nach Anspruch 1 besitzt, wobei das Peptid ein Molekulargewicht von weniger als 2000 Dalton aufweist. Peptidomimetikum, umfassend wenigstens vier aufeinander folgende Aminosäuren einer negativen Regulatorregion, die in den Resten 361-383 (SEQ ID NO:2) von p53 kartiert, wobei ein oder mehrere Peptidbindungen durch eine Retro-Inverso-Pseudopeptidbindung ersetzt sind und wobei das Peptidomimetikum die biologische Aktivität des Peptids nach Anspruch 1 besitzt, wobei das Peptid ein Molekulargewicht von weniger als 2000 Dalton aufweist. Peptidomimetikum, umfassend wenigstens vier aufeinander folgende Aminosäuren einer negativen Regulatorregion, die in den Resten 361-383 (SEQ ID NO:2) von p53 kartiert, wobei ein oder mehrere Aminosäurereste durch das entsprechende N-substituierte Glycin ersetzt sind und wobei das Peptidomimetikum die biologische Aktivität des Peptids nach Anspruch 1 besitzt, wobei das Peptid ein Molekulargewicht von weniger als 2000 Dalton aufweist. Verfahren zur Identifizierung von p53-Mutanten, deren Fähigkeit, an DNA zu binden, durch Peptide oder Peptidomimetika aktiviert werden kann, die der ganzen oder einem Teil der negativen Regulatorregion, die in den Resten 361-383 (SEQ ID NO:2) von p53 kartiert, entsprechen, umfassend: Mischen einer ein mutiertes p53-Protein enthaltenden Probe mit einem Peptid oder einem Peptidomimetikum nach irgendeinem der Ansprüche 1 bis 11 oder 16 bis 19 und Aussetzen der Mischung einem DNA-Bindungsassay, der DNA-Bindung von p53 oder Mutanten davon misst, wobei DNA-Bindung dieser p53-Mutanten durch das Peptid oder Peptidomimetikum im Vergleich mit DNA-Bindung in Abwesenheit des Peptids oder Peptidomimetikums aktiviert wird. Verfahren nach Anspruch 20, wobei der DNA-Bindungsassay die Bindung an ein doppelsträngiges DNA-Molekül misst, das 5'-TGGCATGTCATGGCATGTCA-3' umfasst. Pharmazeutische Zusammensetzung, umfassend ein Peptid oder Peptidomimetikum nach irgendeinem der Ansprüche 1 bis 11 oder 16 bis 17 in einem pharmazeutisch verträglichen Träger.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com