PatentDe  


Dokumentenidentifikation DE69931394T2 03.05.2007
EP-Veröffentlichungsnummer 0001141368
Titel VERFAHREN ZUR HERSTELLUNG VON ASCORBINSÄURE-ZWISCHENPRODUKTEN
Anmelder Genencor International, Inc., Palo Alto, Calif., US
Erfinder BOSTON, G., Matthew, San Carlos, CA 94070, US;
SWANSON, A., Barbara, San Francisco, CA 94131, US
Vertreter WUESTHOFF & WUESTHOFF Patent- und Rechtsanwälte, 81541 München
DE-Aktenzeichen 69931394
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 22.12.1999
EP-Aktenzeichen 999681828
WO-Anmeldetag 22.12.1999
PCT-Aktenzeichen PCT/US99/30918
WO-Veröffentlichungsnummer 2000037667
WO-Veröffentlichungsdatum 29.06.2000
EP-Offenlegungsdatum 10.10.2001
EP date of grant 17.05.2006
Veröffentlichungstag im Patentblatt 03.05.2007
IPC-Hauptklasse C12P 7/58(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12P 7/60(2006.01)A, L, I, 20051017, B, H, EP   C12N 1/21(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
GEBIET DER ERFINDUNG

Die vorliegende Erfindung betrifft die technologische Stoffwechselumgestaltung und insbesondere biokatalytische Verfahren zur Herstellung von Ascorbinsäure-Zwischenprodukten. Insbesondere sieht die Erfindung Verfahren zur Herstellung von Ascorbinsäure-Zwischenprodukten in nicht-fermentativen Systemen vor.

HINTERGRUND DER ERFINDUNG

L-Ascorbinsäure (Vitamin C, ASA) findet Anwendung in der pharmazeutischen und Nahrungsmittelindustrie als ein Vitamin und Antioxidanz. Die Synthese von ASA hat beträchtliche Beachtung über viele Jahre erhalten, und zwar aufgrund ihres relativ großen Marktvolumens und hohen Wertes als eine Spezialchemikalie. Das Reichstein-Grussner-Verfahren, ein chemischer Weg von Glukose zu ASA, wurde zuerst in 1934 beschrieben (Helv. Chim. Acta 17: 311-328). Lazarus et al. (1989, "Vitamin C: Bioconversion via a Recombinant DNA Approach", Genetics and Molecular Biology of Industrial Microorganisms, American Society for Microbiology, Washington D. C., herausgegeben von C. L. Hershberger) beschrieben ein Bioumwandlungsverfahren zur Herstellung eines Zwischenprodukts von ASA, 2-Keto-L-gulonsäure (2-KLG, KLG), welche chemisch zu ASA umgewandelt werden kann. Diese Bioumwandlung einer Kohlenstoffquelle zu KLG involviert eine Vielzahl von Zwischenprodukten, wobei das enzymatische Verfahren mit einer Cofaktor-abhängigen Reduktaseaktivität assoziiert ist. Eine enzymatische Cofaktor-Regenierung involviert die Verwendung von Enzymen, um Cofaktoren wie NAD+ zu NADH oder NADP+ zu NADPH auf Kosten eines anderen Substrates, welches dann oxidiert wird, zu regenerieren.

Es bleibt ein Bedarf nach wirtschaftlich gängigen Verfahren zur Herstellung von ASA-Zwischenprodukten. Insbesondere, wenn solche Verfahren die Verwendung von enzymatischen Aktivitäten involvieren, welche einen Cofaktor erfordern, wäre es besonders wünschenswert, Verfahren zu haben, welche eine Cofaktor-Regenerierung bereitstellen. Die vorliegende Erfindung geht dieses Bedürfnis an.

ZUSAMMENFASSUNG DER ERFINDUNG

Die vorliegende Erfindung betrifft die nicht-fermentative Herstellung von ASA-Zwischenprodukt, KLG, und schließlich ihre Umwandlung zu gewünschten Endprodukten, zum Beispiel Erythorbat und Ascorbinsäure, aus einer Kohlenstoffquelle in einer biokatalytischen Umgebung, wobei die Umgebung, auf die hierin Bezug genommen wird, ein Bioreaktor ist. Die biokatalytische Umgebung kann lebensfähige oder nicht lebensfähige Wirtszellen umfassen, welche mindestens eine enzymatische Aktivität enthalten, die zur Prozessierung der Kohlenstoffquelle zu dem gewünschten Zwischenprodukt in der Lage ist. In einer Ausführungsform wird das gewünschte Zwischenprodukt aus dem Bioreaktor über Elektrodialyse vor der Umwandlung zu dem gewünschten Endprodukt gereinigt. Siehe die 2 für eine schematische Repräsentation der Herstellung dieser Zwischenprodukte und Produkte.

Die vorliegende Erfindung betrifft ebenfalls ein nicht-fermentatives Verfahren zur Herstellung von ASA-Zwischenprodukten, wobei der benötigte Cofaktor regeneriert wird. Die vorliegende Erfindung basiert teilweise auf der Feststellung, dass katalytische Mengen von Cofaktor in einem nicht-fermentativen oder in einem in vitro-Verfahren zur Herstellung von KLG aus einer Kohlenstoffquelle regeneriert werden können. In einer Ausführungsform der vorliegenden Erfindung wird der erforderliche Cofaktor aus dem Bioreaktor vermittels Nano-Filtration gereinigt und wieder verwendet.

Wenn KLG das gewünschte ASA-Zwischenprodukt ist, wird der Bioreaktor mit einer Kohlenstoffquelle versorgt, welche biokatalytisch durch mindestens einen oxidativen Schritt und mindestens einen reduzierenden Schritt zu KLG umgewandelt wird. In Abhängigkeit von der verwendeten Wirtszelle kann die Wirtszelle (eine) Mutation(en) in (einem) Gen(en) umfassen, welches/welche eine oxidierende oder reduzierende enzymatische Aktivität kodiert/kodieren, sodass KLG nicht weiter zu anderen Zwischenprodukten umgewandelt wird. Der oxidative Schritt und reduzierende Schritt erfordern Cofaktor, und das Verfahren sieht ein Mittel zur Cofaktorregenerierung vor.

In einer Ausführungsform sind die Wirtszellen rekombinant und umfassen mindestens eine heterologe enzymatische Aktivität. In einer Ausführungsform ist die enzymatische Aktivität an Wirtszellenmembranen gebunden; in einer anderen Ausführungsform liegt die enzymatische Aktivität in Lösung vor; in einer anderen Ausführungsform ist die enzymatische Aktivität innerhalb der Zelle löslich; und in einer anderen Ausführungsform wird die enzymatische Aktivität immobilisiert. Das Verfahren kann als ein Ansatzverfahren oder ein kontinuierliches Verfahren durchgeführt werden. Die Wirtszellen sind vorzugsweise Vertreter der Familie Enterobacteriacea, und in einer Ausführungsform ist der Vertreter eine Pantoea-Spezies und insbesondere Pantoea citrea. Pantoea citrea kann zum Beispiel von der ATCC mit der ATCC-Zugangsnummer 39140 erhalten werden.

Die Wirtszellen können lyophilisiert, permeabilisiert oder in anderer Weise behandelt werden, um die Lebensfähigkeit zu senken, oder mutiert werden, um die Glukosenutzung für das Zellwachstum oder den Stoffwechsel zu eliminieren, solange die enzymatische Aktivität verfügbar ist, um die Kohlenstoffquelle zu dem gewünschten Zwischenprodukt umzuwandeln. Die Zwischenprodukte können weiter zu den Endprodukten von Erythorbat oder ASA prozessiert werden.

Bei der Herstellung von KLG, wenn die Kohlenstoffquelle KDG ist, oder wenn eine Kohlenstoffquelle zu KDG umgewandelt wird, umfasst das Verfahren die Schritte des enzymatischen Oxidierens des KDG durch mindestens eine oxidative enzymatische Aktivität zu einem Oxidationsprodukt; und das enzymatische Reduzieren des Oxidationsprodukts durch mindestens eine reduzierende enzymatische Aktivität zu 2-KLG. Wenn alternativ DKG die Kohlenstoffquelle ist, oder wenn eine Kohlenstoffquelle zu DKG umgewandelt, wird DKG zu KLG durch eine reduzierende enzymatische Aktivität umgewandelt.

Die vorliegende Erfindung sieht ein Verfahren zur nicht-fermentativen Herstellung von 2-KLG aus einer Kohlenstoffquelle vor, wobei das Verfahren die folgenden Schritte in einer beliebigen Reihenfolge umfasst, das enzymatische Oxidieren der Kohlenstoffquelle durch mindestens eine oxidative enzymatische Aktivität zu einem Oxidationsprodukt; und das enzymatische Reduzieren des Oxidationsprodukts durch mindestens eine reduzierende enzymatische Aktivität zu 2-KLG. Die oxidative enzymatische Aktivität erfordert eine oxidierte Form eines enzymatischen Cofaktors, und die reduzierende enzymatische Aktivität erfordert eine reduzierte Form von dem enzymatischen Cofaktor, und die oxidierte Form des Cofaktors und die reduzierte Form des Cofaktors werden zwischen mindestens einem Oxidationsschritt und mindestens einem Reduktionsschritt recycelt. In einer Ausführungsform ist die oxidierte Form des enzymatischen Cofaktors NADP+, und die reduzierte Form des enzymatischen Cofaktors ist NADPH. In einer anderen Ausführungsform ist die oxidierte Form von dem enzymatischen Cofaktor NAD+ und die reduzierte Form ist NADH. Andere Cofaktoren, die bei dem Verfahren der vorliegenden Erfindung brauchbar sind, schließen ATP, ADP, FAD und FMN ein.

In einer hierin beschriebenen veranschaulichenden Ausführungsform umfasst das Verfahren die folgenden Schritte in einer beliebigen Reihenfolge, und die Schritte können gleichzeitig und/oder kontinuierlich während des Verfahrens auftreten: enzymatisches Oxidieren der Kohlenstoffquelle durch eine erste oxidative enzymatische Aktivität zu einem ersten Oxidationsprodukt; enzymatisches Oxidieren des ersten Oxidationsprodukts durch eine zweite oxidative enzymatische Aktivität zu einem zweiten Oxidationsprodukt; enzymatisches Oxidieren des zweiten Oxidationsprodukts durch eine dritte oxidative enzymatische Aktivität zu einem dritten Oxidationsprodukt; und enzymatisches Reduzieren des dritten Oxidationsprodukts durch eine reduzierende enzymatische Aktivität zu 2-KLG. In einer Ausführungsform erfordert mindestens eine der ersten, zweiten und dritten oxidativen enzymatischen Aktivitäten eine oxidierte Form eines enzymatischen Cofaktors, und die Reduzierung enzymatischer Aktivität erfordert eine reduzierte Form des enzymatischen Cofaktors, und wobei die oxidierte Form des Cofaktors und die reduzierte Form des Cofaktors zwischen mindestens einem oxidierenden Schritt und dem reduzierenden Schritt recycelt werden.

In einer Ausführungsform läuft das Verfahren in einer Umgebung ab, die organische Lösungsmittel umfasst, und in einer weiteren läuft das Verfahren in einer Umgebung ab, welche lange Polymere umfasst. In noch einer weiteren Ausführungsform läuft das Verfahren in einer Umgebung ab, die ein Salz umfasst, und innerhalb eines Bereichs von Salzkonzentrationen.

Die vorliegende Erfindung sieht ebenfalls Vektoren und rekombinante Wirtszellen gemäß den Ansprüchen vor, umfassend enzymatische Aktivitäten, welche bei den Verfahren zur Herstellung der ASA-Zwischenprodukte verwendet werden. In einer Ausführungsform umfasst die Wirtszelle heterologe Nukleinsäure, die GDH kodiert, erhältlich aus Spezies, die T. acidophilum, Cryptococcus uniguttalatus und Bacillus-Spezies einschließen, und/oder DKG-Reduktase, die aus Corynebacterium oder Erwinia erhältlich ist.

KURZE BESCHREIBUNG DER ZEICHNUNG

Die 1 ist eine schematische Darstellung eines in vitro-Verfahrens, wobei NADP+ und NADPH zwischen Oxidations- und Reduktionsschritten recycelt werden.

Die 2 ist eine schematische Darstellung eines Stoffwechselwegs zu ASA-Zwischenprodukten. Mit A markierte Schritte sind enzymatisch; mit B markierte Schritte sind entweder enzymatische oder chemische Umwandlungen. Bei dieser Repräsentation ist das Enzym, welches Glukose (Glc) zu GA umwandelt, eine GDH-Aktivität; das oxidative Enzym, welches GA zu KDG umwandelt, ist eine GADH-Aktivität; das oxidative Enzym, welches KDG zu DKG umwandelt, ist eine KDGDH-Aktivität, und das reduzierende Enzym, welches DKG zu KLG umwandelt ist eine DKGR-Aktivität.

Die 3 veranschaulicht die Aktivität von Reduktase in Gegenwart von 0 bis 40 % Methanol bei einem pH-Wert von 7 und 30°C.

Die 4 veranschaulicht die Reduktase-Aktivität in Gegenwart von 0 bis 50 % Ethanol bei einem pH-Wert von 7,22°C.

Die 5 veranschaulicht die Reduktase-Aktivität bei einem pH-Wert von 7 in Gegenwart von NaCl, KCl, CaCl2, K2SO4 oder Kaliumphosphat (KPi). Anfängliche Raten wurden über eine Minute gemessen.

Die 6 veranschaulicht die Aktivität von Reduktase, die nach der Inkubation bei einem pH-Wert von 7 und 45°C in Gegenwart und Abwesenheit von bis zu 500 mM 2-KLG verbleibt.

Die 7 zeigt die spektrophotometrische Messung von NADPH in einer in vitro-Cofaktor-Recycling-Reaktion. Der Absorptionswert wurde bei 340 nm gemessen. Die anfängliche Absorptionswertablesung betrug 0,7, und zwar bevor die Enzyme hinzugesetzt wurden. Zusätzliche Aliquote an GDH wurden bei etwa 12 und 23 Minuten hinzugegeben.

Die 8 zeigt die spektrophotometrische Messung von NADPH in einer in vitro-Cofaktor-Recyclingreaktion. Der Absorptionswert wurde bei 340 nm gemessen. Genügend NaCl wurde bei etwa 5 Minuten hinzugesetzt, um die Endkonzentration auf 0,5 M zu bringen.

Die 9 zeigt den Km- und relativen Vmax-Wert von Reduktase für 2,5-DKG in Gegenwart steigender Mengen an 2-KLG.

GENAUE BESCHREIBUNG DER BEVORZUGTEN AUSFÜHRUNGSFORMEN Definitionen

Die folgenden Abkürzungen gelten, wie sie hierin verwendet werden, für Glukose (G); D-Gluconat (GA); 2-Keto-D-gluconat (2KDG); 2,5-Diketo-D-gluconat (2,5DKG oder DKG), 2-Keto-L-gulonsäure (2KLG oder KLG), L-Idonsäure (IA), Ascorbinsäure (ASA), Glukosedehydrogenase (GDH), Gluconsäuredehydrogenase (GADH), 2,5-Diketo-D-gluconatreduktase (DKGR), und 2-Keto-D-gluconatreduktase (KDGDH).

Wie hierin verwendet, bezieht sich der Ausdruck "nicht-fermentativ" oder "in vitro" auf ein biokatalytisches Verfahren, welches die enzymatische Aktivität einer Zelle ausnutzt. Die Zellen können nicht lebensfähig oder lebensfähig sein und nicht signifikant wachsen. Die Zellen können genetisch verändert werden, um ihren Verbrauch an Glukose und/oder jedweden erzeugten Zwischenprodukten zu eliminieren. Das in vitro-Verfahren der vorliegenden Erfindung beinhaltet die Verwendung von Zellmembranen, weiche mit dem biokatalytischen Verfahren assoziierte enzymatische Aktivität beinhalten, die Verwendung von permeabilisierten Zellen oder lyophylisierten Zellen, welche die mit dem biokatalytischen Verfahren assoziierte enzymatische Aktivität umfassen, und die Verwendung einer Wirtszelle oder von Wirtszellmembranen oder -fragmenten in einer beliebigen Form, welche die notwendige enzymatische Aktivität für die biokatalytische Umwandlung einer Kohlenstoffquelle zu einem beliebigen der ASA-Zwischenprodukte bereitstellt, einschließlich, jedoch nicht beschränkt auf, GA, KDG, DKG und KLG. Die Zelle kann eine rekombinante Zelle, welche heterologe Nukleinsäure, die eine gewünschte enzymatische Aktivität kodiert, umfasst, oder eine natürlich vorkommende Zelle, welche die gewünschte enzymatische Aktivität umfasst, sein. Der Ausdruck "Bioreaktor", wie er hierin verwendet wird, bezieht sich auf die Umgebung, innerhalb der das nicht-fermentative oder in-vitro-Verfahren abläuft.

Viele Enzyme sind nur aktiv in Gegenwart eines Cofaktors, wie zum Beispiel NAD+ oder NADP+. Der Ausdruck Cofaktor, wie er hierin verwendet wird, bezieht sich auf ein Substrat, welches seiner Natur nach für die enzymatische Reaktion sekundär ist, jedoch für die enzymatische Reaktion absolut notwendig ist. Wie hierin verwendet, schließt der Ausdruck "Cofaktor" NAD+/NADH; NADP+/NADPH; ATP; ADP, FAD/FADH2 und FMN/FMNH2 ein, ist jedoch nicht darauf beschränkt. Der Ausdruck "Regeneration vom Cofaktor" oder "Recycling vom Cofaktor" innerhalb des in vitro-Systems bezieht sich auf das Phänomen der kontinuierlichen Oxidation und Reduktion des erforderlichen Cofaktors durch Biokatalyse, und zwar dergestalt, dass der erforderliche Cofaktor in der angemessenen Form vorliegt, damit die Katalyse stattfinden kann. In der vorliegenden Erfindung sieht die Regeneration vom Cofaktor eine Umgebung vor, in der eine reduzierte Form eines Cofaktors für ein reduzierendes Enzym verfügbar ist, und eine oxidative Form des Cofaktors für ein oxidierendes Enzym verfügbar ist. Die vorliegende Erfindung beinhaltet die Regeneration von Cofaktor zwischen irgendeinem enzymatischen Oxidationsschritt und irgendeinem enzymatischen Reduktionsschritt bei dem biokatalytischen Stoffwechselweg von einer Kohlenstoffquelle zu dem ASA-Zwischenprodukt, zum Beispiel KLG. Der erforderliche Cofaktor kann in katalytischen Mengen vorliegen, die durch die Wirtszellenumgebung bereitgestellt werden, oder kann exogen zu Beginn des Bioreaktorverfahrens in stöchiometrischen Mengen in entweder oxidierter oder reduzierter Form vorgesehen werden.

Wie hierin verwendet, beinhaltet der Ausdruck Kohlenstoffquelle geeignete Kohlenstoffquellen, die normalerweise durch Enterobacteriaceae-Stämme verwendet werden, wie 6-Kohlenstoff-Zucker, einschließlich, jedoch nicht beschränkt auf, Glukose, Gulose, Sorbose, Fructose, Idose, Galactose und Mannose, alle entweder in der D- oder L-Form, oder eine Kombination von 6-Kohlenstoff-Zuckern, wie Saccharose, oder 6-Kohlenstoff-Zuckersäuren, einschließlich, jedoch nicht beschränkt auf, 2-Keto-L-gulonsäure, Idonsäure, Gluconsäure, 6-Phosphogluconat, 2-Keto-D-gluconsäure, 5-Keto-D-gluconsäure, 2-Ketogluconatphosphat, 2,5-Diketo-L-gulonsäure, 2,3-L-Diketogulonsäure, Dehydroascorbinsäure, Erythroascorbinsäure und D-Mannonsäure, oder die enzymatischen Derivate von diesen, solange die Kohlenstoffquelle in der Lage ist, zu einem ASA-Zwischenprodukt wie zum Beispiel KDG, DKG und KLG umgewandelt zu werden.

Wie hierin verwendet, bezieht sich die Familie "Enterobacteriaceae" auf bakterielle Stämme mit den allgemeinen Charakteristika, dass sie gramnegativ sind und fakultativ anaerob sind. Bevorzugte Enterobacteriaceae-Stämme sind jene, welche in der Lage sind, 2,5-Diketo-D-gluconsäure aus D-Glukoselösungen zu produzieren. Eingeschlossen in der Familie der Enterobacteriaceae, welche in der Lage sind, 2,5-Diketo-D-gluconsäure aus D-Glukoselösungen herzustellen, sind zum Beispiel die Gattungen Erwinia, Enterobacter, Gluconobacter und Pantoea. Zwischenprodukte bei dem mikrobiellen Kohlenhydrat-Stoffwechselweg aus einer Kohlenstoffquelle zu ASA schließen GA, 2KDG, 2,5DKG, 5DKG, 2KLG und IA ein, sind jedoch nicht darauf beschränkt. In der vorliegenden Erfindung ist ein bevorzugter Enterobacteriaceae-Fermentationsstamm eine Pantoea-Spezies und insbesondere Pantoea citrea. Vier Sterioisomere von Ascorbinsäure sind möglich: L-Ascorbinsäure, D-Araboascorbinsäure (Erythorbinsäure), welche Vitamin-C-Aktivität zeigt, L-Araboascorbinsäure und D-Xyloascorbinsäure. Wie hierin verwendet, beinhaltet der Ausdruck ASA-Zwischenprodukt jedwedes Produkt in dem Stoffwechselweg zu ASA, einschließlich KDG, DKG und KLG, jedoch nicht darauf beschränkt.

Wie hierin verwendet, bezieht sich der Ausdruck "rekombinant" auf eine Wirtszelle, welche Nukleinsäure enthält, die nicht natürlicherweise in dem Organismus vorkommt, und/oder auf Wirtszellen, welche zusätzliche Kopien an rekombinant eingeführter endogener Nukleinsäure aufweisen. Der Ausdruck "heterolog", wie hierin verwendet, bezieht sich auf Nukleinsäure- oder Aminosäuresequenzen, welche in der Wirtszelle natürlicherweise nicht auftreten. Wie hierin verwendet, bezieht sich der Ausdruck "endogen" auf eine Nukleinsäure, welche in der Wirtszelle natürlich auftritt.

Wie hierin verwendet, bezieht sich "Nukleinsäure" auf eine Nukleotid- oder Polynukleotidsequenz und Fragmente oder Teilen davon, und auf DNA oder RNA von genomischem oder synthetischem Ursprung, welche doppelsträngig oder einzelsträngig sein können, je nachdem, ob sie den Sinn- oder Antisinnstrang repräsentieren. Wie hierin verwendet, bezieht sich "Aminosäure" auf Peptid- oder Proteinsequenzen oder Abschnitte davon.

Wie hierin verwendet, bezieht sich der Ausdruck "Mutation" auf jede beliebige Veränderung in einer Nukleinsäure, sodass das Produkt der Nukleinsäure inaktiviert oder eliminiert ist. Beispiele für Mutationen schließen Punktmutationen, Leserahmen-Verschiebungsmutationen und Deletionen eines Teils oder der Gesamtheit eines Gens, welches eine enzymatische Aktivität kodiert, wie eine oxidative Enzymaktivität oder eine reduzierende Aktivität, ein, sind jedoch nicht darauf beschränkt. In einer hierin beschriebenen Ausführungsform zur Herstellung von KLG, wobei Cofaktor regeneriert wird, wird Nukleinsäure, die membrangebundene GDH-Aktivität kodiert, mutiert, wodurch die endogene GDH-Aktivität inaktiviert wird. In einer weiteren Ausführungsform wird die 2-Keto-D-gluconat-dehydrogenase-Aktivität inaktiviert, wodurch eine optimierte Herstellung des Zwischenprodukts KDG ermöglicht wird.

Der Ausdruck "oxidatives Enzym", wie er hierin verwendet wird, bezieht sich auf ein Enzym oder Enzymsystem, welches die Umwandlung eines Substrats eines gegebenen Oxidationszustands zu einem Produkt eines höheren Oxidationszustandes als dem des Substrats katalysieren kann. Der Ausdruck "reduzierendes Enzym" bezieht sich auf ein Enzym oder Enzymsystem, welches die Umwandlung eines Substrats eines bestimmten Oxidationszustands zu einem Produkt eines niedrigeren Oxidationszustands als dem des Substrats katalysieren kann. Oxidative Enzyme, welche mit der Biokatalyse von D-Glukose zu KLG in Verbindung stehen, schließen unter anderen D-Glukose-Dehydrogenase, D-Gluconatdehydrogenase und 2-Keto-D-gluconatdehydrogenase ein. Reduzierende Enzyme, welche mit der Biokatalyse von Stoffwechselzwischenprodukten von ASA zu KLG in Verbindung stehen, schließen unter anderen 2,5-Diketo-D-gluconatreduktase (DKGR), 2-Keto-Reduktase (2-KR) und 5-Keto-Reduktase (5-KR) ein. Solche Enzyme schließen jene ein, die natürlich durch den Wirtsstamm hergestellt werden, oder jene, die über rekombinante Mittel bzw. Methoden eingeführt werden. In einer Ausführungsform, welche hierin beschrieben ist, läuft das Verfahren in einer Pantoea citrea-Wirtszelle ab, bei der die natürlich auftretende, membrangebundene, nicht-NADP+-abhängige GDH-Aktivität eliminiert ist und eine cytosolische NADP+-abhängige GDH rekombinant eingeführt wurde. In einer anderen Ausführungsform wird eine heterologe Nukleinsäure, die eine Reduktaseaktivität kodiert, in die Wirtszelle eingeführt. In einer bevorzugten Ausführungsform ist die Reduktaseaktivität aus einer Coryneform-Spezies oder einer Erwinia-Spezies erhältlich. Wie hierin verwendet, bezieht sich der Ausdruck "Stoffwechselenzym" auf jedwedes Enzym, welches in die biokatalytische Umwandlung einer Kohlenstoffquelle zu einem ASA-Zwischenprodukt, zum Beispiel KDG, DKG und KLG involviert ist.

Die Ausdrücke "isoliert" oder "gereinigt", wie hierin verwendet, beziehen sich auf eine Nukleinsäure oder ein Protein oder Peptid oder Cofaktor, welches/welcher aus mindestens einer Komponente entfernt ist, mit welcher es/er in natürlicher Weise assoziiert ist. In der vorliegenden Erfindung kann eine isolierte Nukleinsäure einen Vektor einschließen, der die Nukleinsäure umfasst.

Es wird im Fachbereich allgemein verstanden, dass die sauren Derivate von Sacchariden in einer Vielzahl von Ionisierungszuständen in Abhängigkeit von ihren Umgebungsmedien existieren können, und zwar, wenn sie in Lösung sind, oder außerhalb einer Lösung, aus der sie hergestellt werden, wenn sie in fester Form sind. Die Verwendung eines Ausdrucks wie zum Beispiel Idonsäure, um solche Moleküle zu bezeichnen, soll alle Ionisationszustände des erwähnten organischen Moleküls einschließen. Somit beziehen sich "Idonsäure", ihre zyklisierte Form "Idonolacton" und "Idonat" auf den gleichen organischen Rest und sie sollen keine besonderen Ionisationszustände oder chemischen Formen spezifizieren.

GENAUE BESCHREIBUNG

Die vorliegende Erfindung betrifft die biokatalytische Herstellung des ASA-Zwischenprodukts KLG aus einer Kohlenstoffquelle in einer in vitro- oder nicht-fermentativen Umgebung. Das Verfahren erfordert die Gegenwart von enzymatischem Cofaktor. Der enzymatische Cofaktor wird regeneriert. Aufgrund der Kosten vom Cofaktor ist es in starkem Maße vorteilhaft, ein in vitro-Verfahren anzuwenden, welches die Regeneration von katalytischen Mengen an Cofaktor, welche durch die Umgebung der Wirtszelle bereitgestellt werden oder exogen bereitgestellt werden, ermöglicht.

Nicht-fermentative Herstellung von ASA-Zwischenprodukten

Die vorliegende Erfindung sieht ein Mittel zur Herstellung von ASA-Zwischenprodukten vor. Solche Zwischenprodukte können weiter zu ASA, ASA-Stereoisomeren oder anderen Produkten, wie Erythorbat prozessiert werden.

Wenn KLG das gewünschte ASA-Zwischenprodukt ist, wird der Bioreaktor mit lebensfähigen oder nicht-lebensfähigen Pantoea citrea-Wirtszellen und einer Kohlenstoffquelle wie Glukose, welche biokatalytisch durch drei oxidative Schritte, wie in der 2 gezeigt, und einen reduzierenden Schritt zu KLG umgewandelt wird, beladen. In dieser Ausführungsform kann die Reduktaseaktivität durch Nukleinsäure, welche innerhalb der Pantoea citrea-Wirtszelle enthalten ist, kodiert werden, oder exogen zugegeben werden. In dieser Ausführungsform erfordert die erste oxidative enzymatische Aktivität eine oxidierte Form des Cofaktors, und die reduzierende enzymatische Aktivität erfordert eine reduzierte Form des Cofaktors. In einer hierin beschriebenen bevorzugten Ausführungsform wird die Pantoea citrea-Zelle modifiziert, um die natürlich vorkommende GDH-Aktivität zu eliminieren, und eine heterologe GDH, die aus T. acidophilum, Cryptococcus uniguttalatus oder Bacillus-Spezies erhältlich ist und eine Spezifität für NADPH+ besitzt, wird in die Pantoea-Zelle eingeführt, um ein Cofaktor-Recyclingsystem bereitzustellen, welches einen Cofaktor erfordert und regeneriert. Diese Ausführungsform stellt ein Mittel zur Cofaktor-Regenerierung bereit, wodurch die Kosten für ein kontinuierliches Hinzusetzen von exogenem Cofaktor zum Bioreaktor für die Herstellung von KLG in Pantoea-Zellen eliminiert werden. In dieser Ausführungsform umfasst die Wirtszelle weiterhin 2,5-DKG-Reduktaseaktivität kodierende Nukleinsäure, oder die 2,5-DKG-Reduktase wird exogen dem Bioreaktor zugegeben.

In einer anderen Ausführungsform zur Herstellung von KLG wird der Bioreaktor mit Pantoea citrea-Zellen, welche membrangebundene GDH kodierende Nukleinsäure umfassen, geeigneten Enzymen und Cofaktor beladen, und Glukonsäure wird hinzugesetzt, welche zu DKG umgewandelt wird. Die Reaktionsmischung wird dann anaerob gemacht, und Glukose wird hinzugegeben. Die GDH wandelt die Glukose zu GA um, und die Reduktase wandelt DKG zu KLG um, während Cofaktor recycelt wird. Wenn diese Reaktionen vollständig abgeschlossen sind, wird Sauerstoff hinzugesetzt, um GA zu DKG umzuwandeln, und die Zyklen werden fortgesetzt.

Biokatalytische in vitro-Umgebung

Ein biokatalytisches Verfahren zur Umwandlung einer Kohlenstoffquelle zu einem ASA-Zwischenprodukt beginnt mit einer geeigneten Kohlenstoffquelle, die durch Enterobacteriaceae-Stämme verwendet wird, wie einen 6-Kohlenstoff-Zucker, einschließlich zum Beispiel Glukose oder eine 6-Kohlenstoff-Zuckersäure, wie zum Beispiel KDG. Andere Metabolitquellen schließen Galactose, Lactose, Fructose oder die enzymatischen Derivate davon ein, sind jedoch nicht darauf beschränkt. Zusätzlich zu einer geeigneten Kohlenstoffquelle müssen Medien geeignete Mineralien, Salze, Cofaktoren, Puffer und andere Komponenten enthalten, welche jenen im Fachbereich Erfahrenen zur Aufrechterhaltung von Kulturen und zur Förderung des enzymatischen Stoffwechselweges, der zur Herstellung von gewünschten Endprodukten notwendig ist, bekannt sind. Bevorzugte Salze für den Bioreaktor sind Na+, K+, NH4 +, SO4 und Acetat. Die Zellen werden zuerst wachsen gelassen, und für das nicht-fermentative Verfahren wird die für das Wachstum verwendete Kohlenstoffquelle eliminiert, wird der pH-Wert zwischen etwa pH 4 und etwa pH 9 gehalten und liegt Sauerstoff vor.

Bei dem biokatalytischen in vitro-Verfahren machen die Kohlenstoffquelle und Metabolite davon enzymatische Oxidationsschritte oder enzymatische Oxidations- und enzymatische Reduktionsschritte durch, welche außerhalb der intrazellulären Wirtszellenumgebung stattfinden können, und welche die enzymatische Aktivität, welche mit der Wirtszelle assoziiert ist, ausnutzen, und sie laufen durch einen Stoffwechselweg, um das gewünschte ASA-Zwischenprodukt zu bilden. Die enzymatischen Schritte können der Reihe nach oder gleichzeitig innerhalb des Bioreaktors ablaufen, und einige weisen einen Cofaktor-Bedarf auf, um das gewünschte ASA-Zwischenprodukt zu erzeugen. Die vorliegende Erfindung beinhaltet ein in vitro-Verfahren, bei dem die Wirtszellen mit einer organischen Substanz behandelt werden, wie in Beispiel V beschrieben, sodass die Zellen nicht-lebensfähig sind, wobei immer noch Enzyme zur Oxidation und Reduktion der gewünschten Kohlenstoffquelle und/oder von Metaboliten davon in der Biokatalyse von Kohlenstoffquelle zu ASA-Zwischenprodukt verfügbar verbleiben. Die vorliegende Erfindung beinhaltet ebenfalls ein in vitro-Verfahren, bei dem die Wirtszellen lyophilisiert werden, mittels eines beliebigen Mittels permeabilisiert werden, sprühgetrocknet werden, zerbrochen oder in anderer Weise behandelt werden, sodass die Enzyme für die Umwandlung der Kohlenstoffquelle zum ASA-Zwischenprodukt verfügbar sind.

Die enzymatischen oxidativen oder reduzierenden Aktivitäten können an eine Wirtszellenmembran gebunden werden, immobilisiert werden, wie an ein Harz, zum Beispiel AminoLink-Kopplungsgel (von Pierce Chemical Co), an ein Polymer, oder sie können löslich in der Bioreaktorumgebung sein. In einer bevorzugten Ausführungsform ist mindestens ein oxidatives Enzym membrangebunden. Die Umgebung kann in einem organischen oder wässrigen System oder einer Kombination von beiden voranschreiten, oder sie kann in einem Gefäß oder mehreren voranschreiten. In einer Ausführungsform läuft das Verfahren in zwei Gefäßen ab, wobei eines Sauerstoff verwendet und eines anaerob ist. Zum Beispiel können die membrangebundenen Enzyme, welche Sauerstoff erfordern (GDH, GADH, KDGDH) von jenen Enzymen isoliert werden, welche keinen Sauerstoff erfordern (Cofaktor-abhängige GDH, Cofaktor-abhängige DKGR), wodurch die Verwendung eines Gefäßes mit kleinerem Volumen, das Sauerstoff erfordert, ermöglicht wird, wodurch Kosten gesenkt werden. Der Bioreaktor kann in einem satzartigen oder in einem kontinuierlichen Verfahren durchgeführt werden. In einem Ansatz-System wird unabhängig von dem, was hinzugesetzt wird, die gesamte Brühe zur gleichen Zeit abgeerntet. In einem kontinuierlichen System wird die Brühe regelmäßig für eine stromabwärts liegende Prozessierung entfernt, während frisches Substrat hinzugesetzt wird. Die erzeugten Zwischenprodukte können aus der Fermentationsbrühe mittels einer Vielzahl von Verfahren rückgewonnen werden, einschließlich Ionenaustauschharzen, Absorptions- oder Ionenverzögerungs-Harzen, Aktivkohle, Konzentration/Kristallisation, Hindurchleiten durch eine Membran etc.

Das Bioreaktorverfahren kann ebenfalls mehr als einen Zelltyp involvieren, zum Beispiel kann eine Zelle die oxidativen Aktivitäten umfassen, und eine zweite Zelle kann die reduzierenden Aktivitäten umfassen. In einer anderen Ausführungsform wird die Wirtszelle permeabilisiert oder lyophilisiert (Izumi et al., J. Ferment. Technol. 61 (1983) 135-142), solange die notwendigen enzymatischen Aktivitäten verfügbar bleiben, um die Kohlenstoffquelle oder Derivate davon umzuwandeln. Der Bioreaktor kann mit einigen enzymatischen Aktivitäten, die exogen bereitgestellt werden, laufen, und in einer Umgebung, in der Lösungsmittel oder lange Polymere bereitgestellt werden, welche die enzymatischen Aktivitäten stabilisieren oder erhöhen. In einer hierin beschriebenen Ausführungsform wird Methanol oder Ethanol verwendet, um Reduktaseaktivität zu erhöhen. In einer anderen Ausführungsform wird Gafquat verwendet, um die Reduktase zu stabilisieren (siehe Gibson et al., US-Patent 5 240 843).

In einem hierin beschriebenen illustrativen Bioreaktor ist die Wirtszelle eine permeabilisierte Pantoea citrea-Zelle, wobei D-Glukose als eine Kohlenstoffquelle bereitgestellt wird, welche eine Reihe von oxidativen Schritten durch enzymatische Umwandlungen erfährt. Die oxidierenden Enzyme schließen GDH, GADH und DGDH und einen reduzierenden Schritt ein, welcher 2-DKGR involviert (siehe US-Patent 3 790 444), um KLG zu erhalten. Das durch ein Verfahren der vorliegenden Erfindung hergestellte KLG kann weiter zu Ascorbinsäure umgewandelt werden, und das KDG zu Erythorbat, und zwar mit Hilfe von Mitteln, die jenen im Fachbereich Erfahrenen bekannt sind, siehe zum Beispiel Reichstein und Grussner, Helv. Chim. Acta., 17, 311-328 (1934).

Cofaktor-Regenerierung

Einer der Vorteile des Verfahrens der vorliegenden Erfindung liegt in der Regenerierung von Cofaktor, der für Stoffwechsel-Enzyme erforderlich ist. Beispiele für Cofaktor, welcher in dem vorliegenden Verfahren verwendet werden kann, schließen NAD+/NADH; NADP+/NADPH; ATP; ADP, FAD/FADH2 und FMN/FMNH2 ein, sind jedoch nicht darauf beschränkt.

In einer Ausführungsform der Erfindung wird eine Kohlenstoffquelle zu KLG in einem Verfahren umgewandelt, welches die Cofaktor-Regenerierung involviert, wie in der 1 gezeigt. Bei diesem enzymatischen Cofaktor-Regenerierungsverfahren wird ein Äquivalent an D-Glukose zu einem Äquivalent D-Gluconat oxidiert, und ein Äquivalent NADP+ wird zu einem Äquivalent NADPH durch die katalytische Wirkung von GDH reduziert. Das eine Äquivalent D-Gluconat, welches durch die GDH hergestellt wird, wird dann zu einem Äquivalent 2-KDG oxidiert, und dann zu einem Äquivalent 2,5-DKG durch die Wirkung von den membrangebundenen Dehydrogenasen GADH bzw. KDGDH. Das eine erzeugte Äquivalent 2,5-DKG wird dann zu einem Äquivalent 2-KLG reduziert, und das NADPH wird zu einem Äquivalent NADP+ zurück oxidiert durch die Wirkung der 2,5-DKG-Reduktase, wodurch in wirksamer Weise der äquivalente Cofaktor, der für ein zweites Äquivalent an D-Glukose-Oxidation verfügbar sein soll, recycelt wird. Andere Verfahren der Cofaktor-Regeneration können chemische, fotochemische und elektrochemische Mittel einschließen, wobei das Äquivalent oxidiertes NADP+ direkt zu einem Äquivalent NADPH entweder durch chemische, fotochemische oder elektrochemische Mittel reduziert wird. Die Menge an Cofaktor, die exogen dem Bioreaktor hinzugefügt wird, liegt zwischen etwa 1 &mgr;M bis etwa 5 mM, und in einer bevorzugten Ausführungsform zwischen etwa 5 &mgr;M bis etwa 1 mM. Wie hierin in den Beispielen veranschaulicht, beeinflusst NaCl den Km-Wert für NADPH, wohingegen KLG, eine einspeiste Spezies, den Km-Wert nicht beeinflusst. Deshalb gilt, wenn NaCl in dem Bioreaktor vorliegt, wäre mehr NADPH erforderlich, um eine optimale Rate aufrechtzuerhalten. Ferner, wie in den Beispielen beschrieben, hatten die meisten getesteten Salze eine Wirkung auf die thermische Stabilität der Reduktase. Wie es durch den Fachmann anerkannt wird, können in Abhängigkeit von den Konditionen des Bioreaktors, wie der Temperatur, die Salzanteile eingestellt werden, um eine Ausgewogenheit zwischen thermischer Stabilität und annehmbaren Geschwindigkeiten bereitzustellen. Ein exogen einem in vitro-System zugesetzter Cofaktor kann allein oder in Kombination mit anderen Substanzen, die mit einer biokatalytischen Umwandlung einer Kohlenstoffquelle zu einem ASA-Zwischenprodukt assoziiert sind, hinzugesetzt werden. Das vorliegende Verfahren beinhaltet die Verwendung von an einem Träger immobilisierten Cofaktor, einem chemisch veränderten Cofaktor, wie bei der Anheftung an ein langes Polymer, und die Verwendung von Cofaktor in einer isolierten oder gereinigten Form.

Der erforderliche Cofaktor kann ebenfalls aus der biokatalytischen Umgebung über eine Nano-Filtration gereinigt und wieder verwendet werden. Verfahren zur Verwendung von Nano-Filtrationsmembranen zur Cofaktorretention werden zum Beispiel in Seelbach et al. beschrieben (1997, Enzyme and Microbial Technology, Band 20, Seiten 389-392).

Rekombinante Verfahren Wirtszellen

Jede beliebigen oxidativen oder reduzierenden Enzyme, die notwendig sind, um einen Kohlenhydrat-Stoffwechsel einer Wirtszelle zu ASA-Zwischenprodukten, wie zum Beispiel KDG, DKG oder KLG, zu steuern, können über rekombinante DNA-Techniken eingeführt werden, welche jenen im Fachbereich bekannt sind, wenn solche Enzyme in der Wirtszelle nicht natürlich auftreten. Alternativ können Enzyme, welche einen gewünschten Stoffwechsel behindern würden, durch rekombinante DNA-Verfahren mutiert werden. Die vorliegende Erfindung beinhaltet die rekombinante Einführung oder Mutation eines beliebigen Enzyms oder eines Zwischenprodukts, die notwendig ist, um einen gewünschten Stoffwechselweg zu erreichen.

In einer Ausführungsform der vorliegenden Erfindung wird eine Kohlenstoffquelle wie Glukose zu KLG durch mehrere Oxidationsschritte und einen Reduktionsschritt umgewandelt. In dieser Ausführungsform erfordern der erste Oxidationsschritt und der reduzierende Schritt Cofaktor. Die Wirtszelle ist Pantoea citrea, die natürlich auftretende Nukleinsäure, kodierend Glukosedehydrogenase (GDH), wird mutiert, sodass die Dehydrogenaseaktivität eliminiert wird und eine heterologe GDH in die Zelle eingeführt wird. Die vorliegende Erfindung beinhaltet eine Wirtszelle mit zusätzlicher Mutation von Enzymen in dem Kohlenstofffluss-Stoffwechselweg, was die Produktion beeinflusst. Für allgemeine Techniken siehe zum Beispiel die in Maniatis et al., 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N. Y. und Ausubel et al., 1989, Current Protocols in Molecular Biology, Greene Publishing "Associates and Wiley Interscience, N. Y. beschriebenen Techniken.

In einer Ausführungsform der vorliegenden Erfindung wird DKG-Reduktase (DKGR) kodierende Nukleinsäure rekombinant in den Pantoea-Fermentationsstamm eingeführt. Es sind viele Spezies gefunden worden, welche DKGR enthalten, insbesondere Vertreter der Coryneform-Gruppe, einschließlich der Gattungen Corynebacterium, Brevibacterium und Arthrobacter. In einer Ausführungsform der vorliegenden Erfindung wird 2,5-DKGR, die vom Corynebacterium sp.-Stamm SHS752001 erhältlich ist (Grindley et al., 1988, Applied and Environmental Microbiology 54: 1770-1775), in Pantoea citrea rekombinant eingeführt. In einer anderen Ausführungsform wird 2,5-DKG-Reduktase, die von Erwinia herbicola erhältlich ist, beschrieben in dem US-Patent Nr. 5 008 193 von Anderson et al., rekombinant in Pantoea citrea eingeführt.

Quellen für Nukleinsäuren, die oxidative oder reduzierende Enzyme kodieren, schließen die Folgenden ein: ENZYM REFERENZANGABE Glukosedehydrogenase Smith et al. 1989, Biochem. J. 261: 973; Neijssel et al. 1989, Antonie Van Leauvenhoek 56 (1): 51-61 Gluconsäuredehydrogenase Matsushita et al. 1979, J. Biochem. 85: 1173; Kulbe et al. 1987, Ann. N. Y. Acad Sci 506: 552 2-Keto-D-gluconsäuredehydrogenase Stroshane 1977 Biotechnol. BioEng 19 (4) 459 2-Keto-Giuconatreduktase J. Gen. Microbiol. 1991, 137: 1479 2,5-Diketo-D-gluconsäurereduktase United States Patent Nrn.: 5 795 761; 5 376 544; 5 583 025; 4 757 012; 4 758 514; 5 008 193; 5 004 690; 5 032 514

Vektorsequenzen

Expressionsvektoren, die beim Exprimieren der Stoffwechselenzyme, zum Beispiel eine Dehydrogenase oder eine Reduktase, des vorliegenden erfindungsgemäßen Verfahrens in Wirtsmikroorganismen verwendet werden, umfassen mindestens einen mit dem Enzym assoziierten Promotor, wobei der Promotor in der Wirtszelle funktionell ist. In einer Ausführungsform der vorliegenden Erfindung ist der Promotor der Promotor vom Wild-Typ für das gewählte Enzym, und in einer anderen Ausführungsform der vorliegenden Erfindung ist der Promotor für das Enzym heterolog, jedoch in der Wirtszelle immer noch funktionell. In einer Ausführungsform der vorliegenden Erfindung wird das Enzym kodierende Nukleinsäure stabil in das Mikroorganismusgenom integriert.

In einer bevorzugten Ausführungsform enthält der Expressionsvektor eine Kassette mit mehreren Klonierstellen, welche vorzugsweise mindestens eine Restriktionsendonuklease-Stelle umfasst, die für den Vektor einzigartig ist, um die Einfachheit der Nukleinsäurehandhabung zu begünstigen. In einer bevorzugten Ausführungsform umfasst der Vektor ebenfalls einen oder mehrere selektierbare Marker. Wie hierin verwendet, bezieht sich der Ausdruck, selektierbarer Marker, auf ein Gen, welches zur Expression in dem Wirtsmikroorganismus in der Lage ist, welches die Leichtigkeit der Selektion von jenen den Vektor enthaltenden Wirten erlaubt. Beispiele für solche selektierbare Marker schließen Antibiotika, wie Erythromycin, Actinomycin, Chloramphenicol und Tetracyclin ein, sind jedoch nicht darauf beschränkt.

Ein bevorzugtes Plasmid für die rekombinante Einführung von nicht natürlich auftretenden Enzymen oder Zwischenprodukten in einen Stamm von Enterobacferiaceae ist RSF1010, ein mobilisierbares, jedoch nicht selbst übertragbares Plasmid, welches die Fähigkeit hat, sich in einem breiten Bereich von bakteriellen Wirten, einschließlich Gram(–)- und Gram(+)-Bakterien, zu replizieren (Frey et al., 1989, The Molecular biology of IncQ plasmids. In: Thomas (Hrsg.), Promiscuous Plasmids of Gram Negative Bacteria. Academic Press, London, S. 79-94). Frey et al. (1992, Gene 113: 101-106) berichten über drei Regionen, bei denen man herausfand, dass sie die Mobilisierungseigenschaften von RSF1010 beeinflussen.

Transformation

Allgemeine Transformationsprozeduren werden in Current Protocols In Molecular Biology (Band 1, herausgegeben von Ausubel et al., John Wiley & Sons, Inc. 1987, Kapitel 9) gelehrt und schließen Kalziumphosphat-Verfahren, die Transformation unter Verwendung von DEAE-Dextran und die Elektroporation ein. Eine Vielzahl von Transformationsprozeduren ist jenen im Fachbereich Erfahrenen zur Einführung von Nukleinsäure, die ein Stoffwechselenzym kodiert, in eine bestimmte Wirtszelle bekannt. Das vorliegende Verfahren beinhaltet Stoffwechselenzyme, die von rekombinanten Wirtszellen produziert werden und daraus gereinigt werden und exogen in die in vitro-Umgebung hinzugegeben werden, sowie Verfahren, bei denen das Stoffwechselenzym, das entweder heterolog oder endogen gegenüber der Wirtszelle ist, durch eine aktiv wachsende Wirtszelle exprimiert wird oder in der Membran einer nicht-lebensfähigen Wirtszelle vorliegt. Eine Vielzahl von Wirtszellen kann für die rekombinante Produktion der Stoffwechselenzyme, die exogen hinzugesetzt werden sollen, verwendet werden, einschließlich bakterielle, pilzliche, Säuger-, Insekten- und Pflanzenzellen. Pflanzentransformations-Verfahren werden in Rodriquez (WO 95/14099, veröffentlicht am 26. Mai 1995) gelehrt.

In einer bevorzugten Ausführungsform des Verfahrens ist die Wirtszelle eine Enterobacteriaceae. Eingeschlossen in der Gruppe der Enterobacteriaceae sind Erwinia-, Enterobacter-, Gluconobacter- und Pantoea-Spezies. In der vorliegenden Erfindung ist ein bevorzugter Enterobacteriaceae-Fermentationsstamm eine Pantoea-Spezies und insbesondere Pantoea citrea. In einer weiteren bevorzugten Ausführungsform ist die Wirtszelle Pantoea citrea, welche Stoffwechselenzyme umfasst, die zur Umwandlung einer Kohlenstoffquelle zu KLG in der Lage sind. Die vorliegende Erfindung beinhaltet Stoffwechselwege von einer Kohlenstoffquelle zu KLG durch ein beliebiges Zwischenprodukt im mikrobiellen Kohlenhydrat-Stoffwechsel, der in der Lage ist, eine Kohlenstoffquelle zur Herstellung von KLG zu verwenden, wobei durch Zwischenprodukte gegangen wird, welche GA, 2KDG, 2,5DKG, 5DKG und IA einschließen, jedoch nicht darauf beschränkt sind. In einer Ausführungsform wird Nukleinsäure, welche das Stoffwechselenzym kodiert, über einen Plasmidvektor eingeführt und in einer anderen Ausführungsform wird Nukleinsäure, die ein Stoffwechselenzym kodiert, in stabiler Weise in das Wirtszellgenom integriert.

Identifikation von Transformanten

Ob eine Wirtszelle transformiert worden ist, kann durch die Anwesenheit/-Abwesenheit einer Markergen-Expression nachgewiesen werden, welche darauf hin deuten kann, ob die Nukleinsäure von Interesse vorliegt. Gleichwohl sollte seine Expression bestätigt werden. Wenn zum Beispiel die Nukleinsäure, welche ein Stoffwechselenzym kodiert, innerhalb einer Markergensequenz insertiert wird, können rekombinante Zellen, welche den Insert enthalten, durch die Abwesenheit der Markergenfunktion identifiziert werden. Alternativ kann ein Markergen im Tandem mit Nukleinsäure, welche das Stoffwechselenzym kodiert, unter der Kontrolle eines einzigen Promotors angeordnet werden. Die Expression des Markergens als Antwort auf eine Induktion oder Selektion gibt für gewöhnlich die Expression des Enzyms ebenfalls an.

Alternativ können Wirtszellen, welche die Kodiersequenz für ein Stoffwechselenzym enthalten und das Enzym exprimieren, durch eine Vielzahl von Prozeduren, die jenen im Fachbereich Erfahrenen bekannt sind, identifiziert werden. Diese Prozeduren schließen DNA-DNA- oder DNA-RNA-Hybridisierung und Protein-Bioassay- oder Immunoassay-Techniken ein, welche membran-basierende, lösungs-basierende oder chip-basierende Technologien für den Nachweis und/oder die Quantifizierung der Nukleinsäure oder des Proteins einschließen, sind jedoch nicht darauf beschränkt.

Darüber hinaus kann die Anwesenheit der Enzym-Polynukleotidsequenz in einem Wirtsmikroorganismus durch DNA-DNA- oder DNA-RNA-Hybridisierung oder Amplifizierung unter Verwendung von Sonden, Bereichen oder Fragmenten der Enzym-Polynukleotidsequenzen detektiert werden.

Assaybedingungen

Verfahren zum Nachweis von ASA-Zwischenprodukten, ASA und ASA-Stereoisomeren schließen die Anwendung der Redox-Titration mit 2,6-Dichlorindophenol (Burton et al. 1979, J. Assoc. Pub. Analysts 17: 105) oder anderen geeigneten Reagenzien; die Hochleistungs-Flüssigkeitschromatographie (HPLC) unter Verwendung des Anionenaustausches (J. Chrom. 1980, 196: 163); und Elektro-Redox-Prozeduren (Pachia, 1976, Anal. Chem. 48: 364) ein. Dem erfahrenen Fachmann sind Kontrollen bekannt, die bei der Nutzung dieser Nachweismethoden anzuwenden sind.

Gewinnung von Zwischenprodukten

Sobald ASA-Zwischenprodukte produziert worden sind, können sie unter Anwendung jedweder Mittel gewonnen und/oder gereinigt werden, welche jenen im Fachbereich Erfahrenen bekannt sind, einschließlich der Lyophilisierung, Kristallisation, Sprühtrocknung und Elektrodialyse etc. Elektrodialyse Verfahren zur Reinigung von ASA und ASA-Zwischenprodukten wie KLG sind zum Beispiel in dem US Patent, Nr. 5 747 306, erteilt am 5. Mai 1998, und dem US Patent, Nr. 4 767 870, erteilt am 30. August 1998, beschrieben. Alternativ können die Zwischenprodukte ebenfalls direkt aus dem Bioreaktor formuliert und granuliert werden oder zu einer flüssigen Formulierung gebracht werden.

Die Art und Weise und das Verfahren der Durchführung der vorliegenden Erfindung können vollständiger durch jene im Fachbereich Erfahrenen durch den Bezug auf die folgenden Beispiele verstanden werden, wobei die Beispiele in keiner Weise den Umfang der vorliegenden Erfindung oder der darauf gerichteten Ansprüche beschränken sollen.

BEISPIELE Beispiel I

Dieses Beispiel beschreibt das Verfahren zur Herstellung einer Pantoea citrea-Wirtszelle mit einer Mutation in der natürlich vorkommenden GDH.

Klonieren von Glukosedehydrogenase-Gen (GDH) aus Panteoa citrea:

Das Glukosedehydrogenase-Gen wurde durch die Polymerase-Kettenreaktion (PCR) kloniert. Zwei Primer wurden in der PCR verwendet: 5'AGGGAGTGCTTACTACCTTATCTGCGGTATA3' und 5'CGCTAGCTGTGCAATCCATTGATTTTGCACA3'. Nach der PCR wurde ein DNA-Produkt mit etwa 2 kb in den Vektor, pGEM-T (Promega), kloniert, und das rekombinante E. coli mit dem korrekten DNA-Insert wurde identifiziert, und der Klon wurde als pRL bezeichnet. Das DNA-Insert wurde mittels DNA-Sequenzierung analysiert, und seine Sequenz stellte sich zu 60-70 % identisch mit den veröffentlichten DNA-Sequenzen einer GDH eines Stamms von Pantoea citrea heraus.

Erzeugung eines deletierten GDH-Gens durch die Insertion eines Chloramphenicol-Resistenzgens:

Um die Deletionsmutante des GDH-Gens in Pantoea citrea zu erzeugen, wurde eine rekombinante Kopie des zu deletierenden Gens durch die Einführung eines selektierbaren Markers, Chloramphenicol-Resistenzgen (CAT), zuerst erzeugt. Die in vitro-erzeugte Kopie wurde in die Pantoea citrea eingeführt, und man ließ sie mit der Kopie vom Wild-Typ durch homologe Rekombination rekombinieren. Die pRL-DNA wurde dann durch Verdau mit verschiedenen Restriktionsenzymen analysiert. Zwei SmaI-Spaltungsstellen, die etwa 700 bp innerhalb der GDH-kodierenden DNA voneinander entfernt lokalisiert waren, wurden gefunden. Das pRL wurde mit SmaI verdaut, um das 700-bp-Fragment zu entfernen, welches dann mit einer SmaI-verdauten 1,05-kb-DNA, die das Chloramphenicol-Resistenzgen enthielt, ersetzt wurde, um das rekombinante Plasmid zu erzeugen, welches als pRLcm4 bezeichnet wurde. Das Verfahren, welches zur Erzeugung von pRLcm4 verwendet wurde, waren Standardtechniken, welche durch jene im Fachbereich Erfahrenen angewandt werden. Die GDH-CAT-kodierende Sequenz vom pRLcm4 wurde ferner zu einem Plasmid, pGP704, transferiert. Die DNA, welche die GDH-CAT-Kassette kodierte, wurde aus pRLcm4 durch den kombinierten Verdau der Restriktionsenzyme AatII und SpeI entfernt. Die kohäsiven Enden der verdauten DNA wurden durch die Behandlung mit T4-DNA-Polymerase in Gegenwart von Desoxinukleotidtriphosphatmischungen entfernt. Die GDH-CAT-Kassette wurde dann mit dem EcoRV-verdauten pGP704 ligiert. Das rekombinante Plasmid von pGP704, welches die GDH-CAT-Kassette enthielt, wurde identifiziert und als p704RLcm bezeichnet.

Einführung des deletierten GDH-Gens in das Chromosom von Pantoea citrea:

Das Plasmid p704RLcm wurde in Pantoea citrea vom Wild-Typ durch Elektroporation eingeführt. Die transformierten Zellen wurden zuerst auf Agarplatten, die 12,5 &mgr;g/ml Chloramphenicol enthielten, ausplattiert, und resistente Kolonien wurden festgestellt. Um die wahre Deletionsmutante (welche den Chloramphenicol-resistenten Phaenotyp zeigen sollte) von Zellen, welche nur einfach das Plasmid p704RLcm aufgenommen haben, zu unterscheiden, wurden die Chloramphenicol-resistenten Kolonien gegenüber Ampicillin, einem weiteren durch p704RLcm getragenen antibiotischen Resistenzmarker, gescreent. Ampicillinsensitive Kolonien wurden identifiziert. Mehrere Klone, welche den richtigen Phaenotyp (Chloramphenicol-resistent und Ampicillin-sensitiv) besaßen, wurden durch biochemische Assays charakterisiert, und alle zeigten den GDH-negativen Phaenotyp. Die DNA-Blot-Analyse bestätigte ebenfalls, dass das GDH-Gen vom Wild-Typ durch die deletierte Kopie ersetzt worden war.

Beispiel II

Das Beispiel II beschreibt das Verfahren zur Herstellung einer Wirtszelle mit einer Mutation in der natürlich vorkommenden 2-Keto-D-gluconat-Dehydrogenase (E3).

2-Keto-D-gluconat-Dehydrogenase (EC1.1.99.4) aus Gluconobacter melanogenus wird gemäß der Prozedur von McIntire et al, (McIntire, W., Singer, T. P., Ameyama, M., Adachi, O., Matsushita, K., und Shinagawa, E. Biochem. J. (1985) 231, 651-654) und den Referenzen darin gereinigt. Das gereinigte Protein wird mit Trypsin und Chymotrypsin oder anderen Proteasen verdaut, um Peptidfragmente herzustellen, welche mittels HPLC oder anderen Techniken separiert werden. Einzelne Peptide werden gesammelt und sequenziert. Aus der Sequenz werden DNA-Sonden synthetisiert, welche sich an die entsprechende Sequenz in dem Wirtsorganismus oder an das Genom eines verwandten Organismus anlagern. Unter Anwendung von Standard-PCR-Techniken werden größere Fragmente des gewünschten Gens amplifiziert, gereinigt und sequenziert. Diese Fragmente werden verwendet, um das Gen zu hybridisieren und ein Klonieren und Sequenzieren des gesamten Gens möglich zu machen. Sobald die Sequenz bekannt ist, wird das Gen deletiert, wie es für D-Gluconat-Dehydrogenase (GDH) in Beispiel 1 beschrieben ist.

Andere Verfahren, um 2-Keto-D-gluconat-dehydrogenase zu reduzieren oder zu eliminieren, schließen Inhibitoren (von organischen Säuren, wie Citrat und Succinat, wird berichtet, dass sie 2-Keto-D-gluconat-dehydrogenase inhibieren; Shinagawa, E. und Ameyama, M. Methods in Enzymology (1982) 89, 194-198) und Änderungen des pH-Werts oder der Temperatur ein.

Das Enzym kann bezüglich der Aktivität oder des Verlusts an Aktivität unter Anwendung der bei Shinagawa und Ameyama beschriebenen Assays getestet werden.

Beispiel III

Das Beispiel III veranschaulicht ein Verfahren zur Herstellung von KLG in einem Bioreaktor, wo Cofaktor regeneriert wird.

Materialien und Methoden Zellpermeabilisierung

400 ml an P. citrea-Zellen mit einer Mutation in der natürlich vorkommenden Membran-gebundenen GDH wurden auf 80 OD (600 nm) in 10 g/L Gluconat wachsen gelassen und mit 16 ml einer Mischung aus 10 % Toluol und 90 Aceton 3 Minuten lang bei 22°C gemischt. Die permeabilisierten Zellen wurden dann 10 Minuten lang bei 9000 Umdrehungen pro Minute zentrifugiert, und das resultierende Zellpellet wurde mit 400 ml 50 mM Tris, pH 7, gewaschen. Die Waschungen wurden noch zweimal wiederholt um die Entfernung von restlichem organischem Lösungsmittel sicherzustellen.

Beladen des Reaktors

Die 400 ml permeabilisierten Zellen in 50 mM Tris, pH 7, von oben wurden in ein ein Liter großes Glasgefäß, das mit einem Rührer, einer Temperaturregulierung, einem Sauerstoffzuführrohr, einem Basenzuführrohr, einem Probenstutzen und Sauerstoff- und pH-Sonden ausgestattet war, gegeben. 200 &mgr;l MAZU-Antischaum (BASF) wurden der Lösung hinzugesetzt, um das überschüssige Schäumen zu regulieren, Druckluft wurde dem Gefäß hinzugegeben, die Temperatur wurde auf 28°C gebracht, und der Rührer wurde angestellt, damit er bei 1200 Umdrehungen pro Minute lief, bis die Sauerstoffsondenablesung über 60 % Sättigung angab. 16 Gramm kristalline Glukose und 4 Gramm kristallines Na-Gluconat wurden dann auf eine Endkonzentration von 10 g/L Gluconat und 40 g/L Glukose hinzugesetzt. Die Mischung ließ man so lange reagieren, bis das gesamte Gluconat sich zu DKG umgesetzt hatte. Der Glukoseanteil wurde über 20 g/L gehalten. Aufgrund der Zellpermeabilisation traten minimale Mengen an Glukose in den nicht-produktiven Zellmetabolismus ein. Der pH-Wert wurde durch die durchgängige regulierte Zugabe von 50-%iger NaOH bei 7 gehalten.

Zugabe der löslichen Enzyme und des Cofaktors

Sobald das Gluconat zu DKG umgewandelt worden war, wurden jeweils 2000 Einheiten Cofaktor-abhängige GDH- und DKG-Reduktase (für DKGR ist eine Einheit entsprechend zu einer OD-Absorptionsänderung pro Minute, wenn bei 340 nm gemessen wird) zusammen mit 400 &mgr;M NADP+ hinzugesetzt. Der Reaktor wurde gerührt, Luft wurde eingeführt, und es wurde wie oben bei 28°C gehalten. Periodische Zugaben an Glukose erfolgten im Verlauf des Vorgangs, um eine konstante Substratzuführung für beide Cofaktor-abhängigen Enzyme sicherzustellen.

Ergebnisse

Ein Bioreaktor-Experiment wurde mit nicht-gereinigter Reduktase A:F22Y/-A272G (US-Patent Nr. 5 795 761) in Form eines rohen Extrakts von E. coli durchgeführt. T. acidophilum GDH und NADP+ wurden in gereinigter Form von Sigma gekauft. Die GA-zu-DKG-Raten waren größer als 10 g/L/h. Die anfänglichen 2 KLG-Bildungsraten waren größer als 10 g/L/h. Die integrierte Rate über die ersten 6 Stunden lag über 5 g/L/h. Der Cofaktor erschien stabil über die ersten 6 Stunden, und vornehmlich in der reduzierten Form. Die gesamte Umwandlungszahl betrug 537 (215 mM 2 KLG/0,4 mM NADP+). Während der ersten 6 Stunden überstiegen die Zwischenprodukte GA und DKG niemals 4 g/L. Der Lauf wurde 6,5 Stunden nach der anfänglichen Zellbeladung gestoppt, und eine Erholungsphase mit niedriger Bewegung bei 22°C wurde über Nacht laufen gelassen. Der Endtiter an KLG betrug etwa 42 g/L.

Aliquote wurden während des Verlaufs der Bioreaktorinkubation entfernt. Diese Aliquote wurden zuerst in einer Mikrofuge zu Pellets der Zellen zentrifugiert. Um auf restliche Reduktaseaktivität zu testen, wurden 25 Mikroliter Probenüberstand zu einer Lösung hinzugesetzt, die aus 910 &mgr;l Puffer (50 mM bis-Tris, pH 7), 20 &mgr;l DKG (70 mg/ml) und 250 &mgr;M NADPH bestand. Die Reduktaseaktivität wurde gemessen, indem der Verlust an Extinktion bei 340 nm 1 Minute lang überwacht wurde. Die GDH-Aktivität wurde gemessen, indem 25 &mgr;l einer Probe zu einer Lösung hinzugesetzt wurden, die 520 &mgr;l Puffer, 150 &mgr;l NaCl (1M), 200 &mgr;l Harnstoff (8 M), 50 &mgr;l Glc (1 M) und 60 &mgr;l NADP+ (5 mM) enthielt, und es wurde die Zunahme in der Extinktion bei 340 nm 1 Minute lang beobachtet. Sowohl die Reduktase als auch die GDH zeigten eine volle Aktivität im Verlauf des Bioreaktorexperiments.

Beispiel IV

Dieses Beispiel veranschaulicht die Produktion von KDG in einem in-vitro-Bioreaktor.

Zellen, welche Membran-gebundene D-Glukosedehydrogenase- und D-Gluconsäuredehydrogenase-Aktivitäten, jedoch keine 2-Keto-D-gluconat-dehydrogenase-Aktivität enthielten, wurden wachsen gelassen und geerntet. Ein Beispiel von einer solchen Zelle ist Pantoea citrea, welche eine Mutation in dem 2-Keto-D-gluconatdehydrogenase-Enzym besitzt, und es wird wie in Beispiel III wachsen gelassen und behandelt. Die Zellen werden wie in Beispiel III beschrieben, permeabilisiert. Glukose (kristallin oder in Lösung) wird in Aliquoten oder kontinuierlich hinzugesetzt. Der pH-Wert wird durch regulierte Zugabe einer konzentrierten NaOH-Lösung aufrechterhalten. Die Glukose wird zu D-Gluconsäure und dann KDG umgewandelt. Produktbildung wird überwacht, indem Aliquote auf einem geeigneten HPLC-System analysiert werden. Das Produkt wird gewonnen, indem die Zellen durch Zentrifigution entfernt werden und die restliche Flüssigkeit konzentriert oder entfernt wird.

Beispiel V

Dieses Beispiel veranschaulicht, dass die Zugabe von organischen Lösungsmitteln die Reduktaseaktivität erhöht.

1-2 mg DKG, 250 &mgr;M NADPH, F22Y/A272G-Reduktase A und genügend 50 50 mM bis-Tris-Puffer, pH 7, um das Endvolumen auf 1 ml zu bringen, wurden einer Cuvette hinzugesetzt. Die Reduktaseaktivität wurde gemessen, indem die Abnahme in der Extinktion bei 340 nm gemessen wurde. Die Menge an hinzugesetzter Reduktase erzeugte typischerweise eine Änderung in der Extinktion von 0,1 bis 0,2 OD/min bei Raumtemperatur oder 30°C. Unter den gleichen Bedingungen wurde Aliquote an Methanol oder Ethanol der Lösung hinzugesetzt, und die Reduktaseaktivität wurde gemessen. Die Reduktaseaktivität in Gegenwart von verschiedenen Mengen an Methanol bei 30°C ist in der 3 gezeigt, und die Aktivität in Gegenwart von Ethanol bei 22°C ist in der 4 gezeigt.

Wie in den Figuren gezeigt, wird die Reduktaseaktivität in Gegenwart von bestimmten Mengen an Methanol oder Ethanol erhöht. Optimale Konzentrationen liegen zwischen 10 und 25 % des organischen Lösungsmittels.

GDH aus T. acidophilum zeigt eine kleine Abnahme in der Aktivität, wenn sie mit 10%igem Methanol inkubiert wird (die Testbedingungen sind: 50 mM Tris, pH 7, 12,5 mM D-Glukose, 250 &mgr;M NADP+ in 1 ml. Die Aktivität wird durch die Zunahme in der Extinktion bei 340 nm festgestellt). Permeabilisierte Zellen wurden mit 15%igem MeOH und Gluconsäure inkubiert. Die Aktivitäten von D-Gluconsäuredehydrogenase und 2-Keto-D-gluconsäure-dehydrogenase wurden durch die Zugabe von Methanol nicht signifikant beeinflusst, wie durch die Produktbildung überwacht (HPLC-Analyse).

Die Zugabe von Methanol oder Ethanol zu einer vollständigen Bioreaktorreaktion würde die Reduktaseaktivität steigern. Verluste bezüglich der GDH-Aktivität oder anderer Komponenten könnten durch Zugabe von mehr GDH oder Zellen überwunden werden.

Beispiel VI

Das Beispiel VI veranschaulicht die Reduktaseaktivität in Gegenwart von Gafquat und PEG8000.

Reduktase wurde mit 250 &mgr;M NADPH, 1-2 mg/ml DKG und 0, 0,7 % und 2,8 % Gafquat (ISP Technologies, Inc.) oder 0,5 % PEG8000 in 1 ml (50 mM bis-Tris-Puffer, pH 7) bei 30 °C inkubiert. Die Reduktaseaktivität wurde wie in Beispiel VI gemessen. Wie in der Tabelle 1 gezeigt, erhöht die Zugabe von Gafquat die Reduktaseaktivität um 80 % im Vergleich zu der Aktivität ohne Gafquat. PEG8000 erhöht die Reduktaseaktivität um etwa 15 %.

Beispiel VII

Das Beispiel VII veranschaulicht die Reduktaseaktivität in Gegenwart an Salz.

Die Reduktase A F22Y/A272G-Aktivität wurde in Gegenwart von variierenden Mengen von unterschiedlichen Salzen gemessen. Der Test bestand aus dem Hinzusetzen von Reduktase zu einer Lösung (1 Milliliter Endvolumen), die 250 &mgr;M NADPH, DKG (1-1,5 mg/ml) 50 mM bis-Tris-Puffer, pH 7, und unterschiedliche Mengen an Kaliumphosphat, NaCl, KCl, K2SO4 oder CaCl2 enthielt. Alle Reaktionen wurden bei 30°C durchgeführt. Die Ergebnisse sind in der 5 gezeigt.

Wie in der 5 gezeigt, bleibt die Reduktaseaktivität die gleiche oder erhöht sich etwas, wenn mit 100 mM NaCl oder KCl inkubiert wird. Die Aktivität fällt dann, wenn die Salzkonzentrationen auf 250 mM erhöht werden. Die Reduktaseaktivität fällt bei CaCl2- oder Kaliumphosphatkonzentrationen von 20 mM oder mehr.

Die Reduktase-Bindungskonstante (Km) für NADPH in Gegenwart von 200 mM NaCl wurde unter Anwendung von biochemischen Standardtechniken bestimmt (Fersht, A. "Enzyme Structure and Mechanism" (1977) W. H. Freeman und Company). Die Reaktionen wurden in bis-Tris-Puffer mit einem pH-Wert von 7, der etwa 1,5 mg/ml DKG enthielt, bei 30°C und unterschiedlichen Mengen an NADPH durchgeführt. Es wurde festgestellt, dass der Km-Wert für NADPH in Gegenwart von 200 mM NaCl sich um das 10- bis 40-Fache gegenüber dem Km-Wert, welcher ohne NaCl bestimmt wurde, erhöhte. Die maximale Rate (Vmax) in Salz war der Vmax ohne Salz ähnlich oder war etwas erhöht. Ein Weg, um die Wirkung von Salz auf die Reduktaseaktivität zu verringern, ist es, die Konzentration an NADPH solange zu erhöhen, bis sie bei oder oberhalb des Km-Wertes unter diesen Bedingungen liegt. Alternativ könnten geladene Spezies, einschließlich KLG, entfernt werden.

Beispiel VIII

Das Beispiel VIII veranschaulicht die Stabilität von Reduktase A F22Y/A272G in Gegenwart von Salz/Produkt.

Die thermische Stabilität von Reduktase wurde in starkem Maße in Gegenwart von Salzen erhöht. Reduktase wurde auf einem der folgenden Wege getestet. Im ersten Fall wurde Reduktase zu Puffer (50 mM bis-Tris, pH 7) in Gegenwart und Abwesenheit von verschiedenen Mengen an 2-KLG (0-500 mM) hinzugesetzt. Diese Lösungen wurden dann in 1,5 ml große Eppendorf-Röhrchen in Aliquote (40 &mgr;l) aufgeteilt. Die Röhrchen wurden dann in ein Wasserbad bei 45°C gestellt und zu festgelegten Intervallen entfernt. Die Reduktase wurde dann bezüglich der restlichen Aktivität unter Verwendung des standardmäßigen Reduktaseaktivitäts-Tests getestet. Die Ergebnisse sind in der 6 gezeigt.

Wie in der 6 gezeigt, verliert die Reduktase nicht in signifikanter Weise Aktivität unter diesen Bedingungen in Gegenwart von 500 mM 2-KLG. Gleichwohl verliert Reduktase, die nur mit Puffer inkubiert wird, etwa die Hälfte ihrer Aktivität in 10 Minuten. Dazwischen liegende Konzentrationen von 2-KLG führen zu einer teilweisen Stabilisierung.

Reduktase wurde 10 Minuten lang in Gegenwart von Puffer (50 mM bis-Tris, pH 7, oder 25 mM MOPS, pH 7), 0,5 M NaCl, 0,5 M KCl, 0,5 M NH4Cl, 0,5 M K2SO4 und 0,1 M NaCl bei einem pH-Wert von 7 und bei 45°C inkubiert. Wie unten in der Tabelle 2 gezeigt ist, geht nur wenig Aktivität in Gegenwart dieser Verbindungen verloren, wohingegen Reduktase nur mit Puffer fast die Hälfte ihrer Aktivität verlor. Diese Verbindungen stabilisieren die Reduktase deutlich. Niedrigere und höhere Anteile dieser Verbindungen sollten ebenfalls die Reduktase stabilisieren.

Ein Vergleich zwischen der Stabilisation durch 2-KLG und NaCl wurde durchgeführt. Die Temperaturinkubation wurde bei 45,4°C in 25 mM MOPS, pH 7, durchgeführt. Eine Konzentration von 20 mM 2-KLG oder 20 mM NaCl wurde verwendet. Zeitpunkte der Messung lagen bei 0,5 und 10 Minuten. Die Ergebnisse sind unten in der Tabelle 3 aufgelistet. Wie gezeigt, stabilisiert die gleiche Menge an NaCl die Reduktase mehr als 2-KLG.

  • In der Tabelle 3 sind alle %-Angaben +/– 10 %.

Bei 46,6-46,9°C wurden die Halbwertszeiten für Reduktase in Gegenwart von 0-400 mM NaKLG bestimmt. Diese Temperatur wurde gewählt, um alle Halbwertszeiten bei der gleichen Temperatur zu bestimmen. Der Puffer ist 25 mM MOPS, pH 7,0. Aliquote wurden entfernt und bezüglich der verbleibenden Aktivität getestet. Die Halbwertszeitmessungen zur Thermostabilität wurden wie folgt durchgeführt: ein 450 &mgr;l Probe enthaltender Puffer, Reduktase und 2 KLG (sofern verwendet) wurden in ein Eppendorf-Röhrchen gegeben und in einem Wasserbad erhitzt. 8 oder 9 Aliquote wurden im Zeitverlauf entfernt, welche von 10 bis 30 Minuten variierten. Jedes Aliquot wurde auf Eis gestellt und zweifach am Ende des Experiments getestet. Die Aktivitäten wurden mit der Zeit vs. restliche Aktivität aufgetragen. Der Kf-Wert wurde bestimmt durch Anpassung der Linie unter Verwendung eines Computergrafikprogramms zur Lösung einer exponentiellen Abnahme. Dieser Wert wurde dann verwendet, um die Halbwertszeit zu berechnen (Fersht, A. "Enzyme Structure and Mechanism" (1977) W. H. Freeman und Co.). Die Ergebnisse sind unten in der Tabelle 4 gezeigt.

Wie die Ergebnisse in Tabelle 4 zeigen, stabilisiert NaKLG deutlich die Reduktase, und diese Stabilisierung ist konzentrationsabhängig.

Diese Daten zeigen, dass erhöhte Mengen an Salz Reduktase stabilisieren können. Geeignete Salze, welche in dem Bioreaktor verwendet werden können, schließen Ammoniumsulfat, Natriumacetat, Ammoniumacetat, Ammoniumchlorid, Natriumsulfat, Kaliumphosphat, Natriumphosphat, Natriumchlorid, KCl, NH4Cl, K2SO4 und NaI ein. Ein im Fachbereich Erfahrener würde erkennen, dass der optimale Salzbereich temperaturabhängig wäre. Deshalb könnte im Bioreaktor entweder die Temperatur oder die Salzkonzentration oder Beides modifiziert werden, um die gewünschte Stabilität der Reduktase zu erreichen. Bei niedrigeren Temperaturen, unter welchen ein typischer Bioreaktor laufen gelassen werden würde, müsste weniger Salz verwendet werden, um die gleiche Menge an Stabilisierung der Reduktase, wie es in Tabelle 4 gezeigt ist, bereitzustellen.

Beispiel IX

Das Beispiel IX veranschaulicht ein Verfahren zum Messen des NADPH/-NADP+-Verhältnisses und des Reaktionsgleichgewichts.

Der reduzierte Cofaktor (NADPH) besitzt eine starke Extinktion bei 340 nm, während oxidierter Cofaktor (NADP+) bei dieser Wellenlänge nicht absorbiert. Wenn die zwei Cofaktoren miteinander gemischt werden, kann deshalb die Menge an vorliegendem NADPH durch Extinktion bei 340 nm bestimmt werden. Wenn die Menge an ursprünglichem zugesetztem NADP+ ebenfalls bekannt ist, kann das Verhältnis der zwei Cofaktoren dann leicht bestimmt werden. Dieses Verfahren kann verwendet werden, um zu messen, wie die Zugabe von verschiedenen Komponenten zu einer Reaktion, wie einer Cofaktor-Recyclingreaktion, das Reaktionsgleichgewicht beeinflusst.

Eine 1 ml-Reaktion wurde in einer Küvette bei Raumtemperatur angesetzt. Die Reaktion bestand aus Puffer (50 mM bis-Tris, pH7), 5 mg Glukose, 5 mg 2,5-DKG, 100 &mgr;M NADPH, 100 &mgr;M NADP+, Reduktase und Glukosedehydrogenase (GDH). Die Enzyme wurden zuletzt hinzugesetzt, um die Reaktion zu initiieren, und die Cofaktoranteile wurden bei 340 nm überwacht. Nachdem das Gleichgewicht erreicht war (7), wurde ein zusätzliches Aliquot an GDH hinzugesetzt. Sehr schnell verschob sich das Gleichgewicht in Richtung auf mehr vorliegendes NADPH. Die Zugabe von mehr GDH ergab das gleiche Verhalten.

Eine weitere 1 ml-Inkubation wurde wie oben angesetzt. Nachdem sie das Gleichgewicht erreicht hatte, wurden 29 mg NACl hinzugesetzt, um eine Endkonzentration von 0,5 M NaCl zu erhalten. Wie in der 8 gezeigt, verschob dies dramatisch das Gleichgewicht in Richtung auf die Begünstigung der Anwesenheit von NADPH.

Beispiel X

Das Beispiel X veranschaulicht Cofaktor-Recyclingreaktionen.

Cofaktor-Recyclingreaktionen wurden durch Zugabe von Reduktase, GDH, Glukose, 2,5-DKG und NADP+ in ein Reaktionsgefäß durchgeführt. Zusätzlich wurde gereinigte 2-KLG zu einigen Reaktionen hinzugesetzt, um die Reaktion in Gegenwart von Produkt zu bestimmen. Diese Reaktionen wurden aufrechterhalten, um Gluconsäure und 2-KLG herzustellen. Cofaktor wurde zwischen NADP+ und NADPH durch die Wirkung der zwei Enzyme recycelt. Aliquote wurden periodisch entfernt und mittels HPLC zur Bestimmung der Gegenwart von Substraten und Produkten analysiert. Die Reaktion wurde mindestens 20 Stunden bei Raumtemperatur aufrechterhalten.

Reaktionen mit so wenig wie 3 ml wurden durchgeführt. In einer Reaktion wurden Reduktase, GDH, 10 mg/ml Glukose und 10 mg/ml lyophilisiertes 2,5-DKG zu 50 mM bis-Tris-Puffer hinzugesetzt. 2-KLG wurde einigen Inkubationen bei einer Konzentration von 75 mg/ml hinzugesetzt. Die Reaktion wurde bei Raumtemperatur durch Zugabe von NADP+ (400 &mgr;M) initiiert. Der Lösungs-pH wurde zwischen einem pH-Wert von 6-7,5 durch Zugabe kleiner Mengen an NaOH aufrechterhalten. Aliquote an Glukose und 2,5-DKG wurden periodisch hinzugegeben. Am Ende eines Tages wurde die Reaktion bei 4°C über Nacht stehen gelassen. Am folgenden Morgen wurde sie auf Raumtemperatur erwärmt, der pH-Wert wurde eingestellt und die Reaktion wurde fortgesetzt. Kleine Aliquote wurden entfernt und in eine HPLC injiziert. Durch den Vergleich mit einem Standard konnten die hergestellten Mengen an Gluconat und 2-KLG berechnet werden. In einer typischen Reaktion wurden mindestens 60 % der Glukose zu Gluconat umgewandelt, und mindestens 60 % des 2,5-DKG wurden zu 2-KLG umgewandelt.

Beispiel XI

Das Beispiel XI veranschaulicht NaCl-Kinetiken.

Wenn NaCl (100 mM oder mehr) zu einem standardmäßigen Reduktaseassay, enthaltend 250 &mgr;M NADPH und 10-20 mM DKG, hinzugesetzt wurde, verringerte sich die Reduktaserate. Durch die Durchführung von kinetischen Analysen stellte sich heraus, dass Natriumchlorid den Km-Wert der Reduktase für den Cofaktor NADPH erhöhte. Wenn mehr NaCl hinzugegeben wurde, erhöhte sich der Km-Wert. Wenn eine untersättigende Menge an NADPH verwendet wurde, schien es, dass die Reduktase durch NaCl inhibiert wurde. Um diesem Effekt entgegenzuwirken, wurde mehr NADPH der Reaktion hinzugesetzt, sodass es mehrfach über dem Km-Wert lag. Der Modus der Inhibition erschien kompetitiv zu sein.

Der Km-Wert für DKG in Gegenwart von NaCl wurde unter Anwendung von Standardtechniken bestimmt. Die NADPH-Konzentration, welche für jede Messung verwendet wurde, wurde so eingestellt, dass sie mindestens 3-fach über ihrem Km-Wert bei jeder NaCl-Konzentration lag.

Beispiel XII

Das Beispiel XII zeigt 2-KLG-Kinetiken.

Der Km-Wert für DKG in Gegenwart von 2-KLG wurde unter Anwendung von biochemischen Standardtechniken bestimmt. Die Menge an 2-KLG wurde von 0 bis 150 mM in einem Puffer mit einem pH-Wert von 7 variiert. Der Km-Wert für DKG unter pH-7-Bedingungen betrug 10-12 mM. Wenn sich die Konzentration von 2-KLG erhöhte, sank der Km-Wert für 2,5-DKG. Zum Beispiel beträgt der Km-Wert für DKG bei 150 mM 2-KLG 2-4 mM. Die Reaktionsrate nimmt ebenfalls ab und erfährt eine 2- bis 4-fache Abnahme, wenn sich die KLG-Konzentration von 0 auf 150 mM erhöht. Dieses Verhalten ist konsistent mit einer nicht kompetitiven Inhibition.

Der Km-Wert für NADPH in Gegenwart von 100 mM 2-KLG wurde zu 4-9 mM bestimmt. Dies wurde unter Anwendung biochemischer Standardtechniken bei einem pH-Wert von 7, mit einer Konzentration an 2,5-DKG von mehr als 14 mM und NADPH-Konzentrationen, welche den Km-Wert einrahmten, durchgeführt.

Deshalb würde man erwarten, dass die Anwesenheit von steigenden Mengen an KLG in einer Bioreaktorumgebung die Reduktaseaktivität senken würde und die Reaktionsgesamtrate verlangsamen würde. Zwei Wege, um dieses Phänomen zu überwinden, wären die KLG-Gewinnung, zum Beispiel durch Elektrodialyse oder alternativ durch Zugabe von mehr Reduktase zu dem Bioreaktor.

Beispiel XIII

Das Beispiel XIII veranschaulicht die Synthese von 2,5-DKG.

P. citrea-Zellen werden mit 150 mM Natriumgluconat in einem geeigneten Puffer: 25 mM bis-Tris, oder 25 mM MOPS wird bei einem pH-Wert von 6 verwendet. 25 ml der Zellen, Puffer und Substrat werden in einen 125 ml großen Erlenmeyer-Kolben mit Bafflen gegeben und bei 28°C unter Schütteln bei etwa 250 Umdrehungen pro Minute inkubiert. Nach 16-24 Stunden wurde der Kolben bezüglich der Bildung von 2,5-DKG mittels HPLC-Analyse und Aktivitätsassay begutachtet. Die Zellen wurden zentrifugiert und der Überstand wurde entfernt. Das Material wird steril filtriert und kann bei 4°C oder eingefroren gelagert werden. Alternativ kann das Material zu einem Feststoff lyophilisiert werden.


Anspruch[de]
Verfahren zur nicht-fermentativen Produktion von 2-KLG (2-Keto-L-gulonsäure) aus einer Kohlenstoffquelle, umfassend die folgenden Schritte in beliebiger Reihenfolge: enzymatisches Oxidieren der Kohlenstoffquelle durch mindestens eine oxidative enzymatische Aktivität zu einem Oxidationsprodukt; und enzymatisches Reduzieren des Oxidationsprodukts durch mindestens eine reduzierende enzymatische Aktivität zu 2-KLG, wobei die oxidative enzymatische Aktivität eine oxidierte Form eines enzymatischen Cofaktors erfordert, und die reduzierende enzymatische Aktivität eine reduzierte Form des enzymatischen Cofaktors erfordert, und wobei die oxidierte Form des Cofaktors und die reduzierte Form des Cofaktors zwischen mindestens einem oxidierenden Schritt und mindestens einem reduzierenden Schritt recycelt werden. Verfahren gemäß Anspruch 1, wobei die Kohlenstoffquelle KDG (Keto-D-gluconat) ist. Verfahren gemäß Anspruch 1, umfassend die folgenden Schritte in beliebiger Reihenfolge:

a. enzymatisches Oxidieren der Kohlenstoffquelle durch eine erste oxidative enzymatische Aktivität zu einem ersten Oxidationsprodukt;

b. enzymatisches Oxidieren des ersten Oxidationsprodukts durch eine zweite oxidative enzymatische Aktivität zu einem zweiten Oxidationsprodukt;

c. enzymatisches Oxidieren des zweiten Oxidationsproduktes durch eine dritte oxidative enzymatische Aktivität zu einem dritten Oxidationsprodukt; und

d. enzymatisches Reduzieren des dritten Oxidationsprodukts durch eine reduzierende enzymatische Aktivität zu 2-KLG,

wobei mindestens eine der ersten, zweiten und dritten oxidativen enzymatischen Aktivität eine oxidierte Form eines enzymatischen Cofaktors erfordert, und die reduzierte enzymatische Aktivität eine reduzierte Form des enzymatischen Cofaktors erfordert, und wobei die oxidierte Form des Cofaktors und die reduzierte Form des Cofaktors zwischen mindestens einem oxidierenden Schritt und dem reduzierenden Schritt recycelt wird.
Verfahren gemäß Anspruch 3, wobei die erste oxidative enzymatische Aktivität eine oxidierte Form des enzymatischen Cofaktors erfordert. Verfahren gemäß Anspruch 3, wobei die Kohlenstoffquelle Glukose ist und die erste enzymatische Aktivität eine Glukosedehydrogenase-Aktivität ist. Verfahren gemäß Anspruch 5, wobei die Glukosedehydrogenase-Aktivität aus einer bakteriellen, Hefe- oder Pilzquelle erhältlich ist. Verfahren gemäß Anspruch 6, wobei die Glukosedehydrogenase-Aktivität aus einer Quelle erhältlich ist, die T. acidophilum, Cryptococcus uniguttalatus und Bacillus-Spezien einschließt. Verfahren gemäß Anspruch 3, wobei jedes des ersten, des zweiten Enzyms und des dritten Enzyms eine Dehydrogenase-Aktivität besitzt. Verfahren gemäß Anspruch 3, wobei Enzyme mit mindestens einer der ersten, der zweiten, der dritten und der vierten enzymatischen Aktivität immobilisiert sind. Verfahren gemäß Anspruch 3, wobei Enzyme mit mindestens einer der ersten, der zweiten, der dritten und der vierten enzymatischen Aktivität in Lösung sind. Verfahren gemäß Anspruch 9, wobei die zweite Enzymaktivität eine GADH (Gluconsäuredehydrogenase)-Aktivität ist. Verfahren gemäß Anspruch 9, wobei die dritte Enzymaktivität KDGDH (2-Keto-D-gluconatreduktase)-Aktivität ist. Verfahren gemäß Anspruch 9, wobei die vierte Enzymaktivität eine Reduktase-Aktivität ist. Verfahren gemäß Anspruch 13, wobei die Reduktase-Aktivität aus einer bakteriellen, Hefe- oder Pilzquelle erhältlich ist. Verfahren gemäß Anspruch 14, wobei die Quelle Corynebacterium und Erwinia einschließt. Verfahren gemäß Anspruch 15, wobei die Reduktase-Aktivität 2,5-DKG (2,5-Diketo-D-gluconat)-Reduktase ist. Verfahren gemäß Anspruch 3, wobei das erste Oxidationsprodukt Gluconat ist, das zweite Oxidationsprodukt 2-KDG (2-Keto-D-gluconat) ist und das dritte Oxidationsprodukt 2,5-DKG (2,5-Diketo-D-gluconat) ist. Verfahren gemäß Anspruch 3, welches in einer Umgebung abläuft, die rekombinante Wirtszellen umfasst. Verfahren gemäß Anspruch 18, wobei die Wirtszelle lebensfähig ist. Verfahren gemäß Anspruch 18, wobei die Wirtszelle nicht lebensfähig ist. Verfahren gemäß Anspruch 18, wobei die rekombinanten Wirtszellen Vertreter von Enterobacteriacea umfassen. Verfahren gemäß Anspruch 18, welches in einer Umgebung abläuft, die rekombinante Wirtszellenmembranen umfasst, und wobei Enzyme mit mindestens einer der ersten, der zweiten und der dritten enzymatischen Aktivität an den Wirtszellenmembranen gebunden sind. Verfahren gemäß Anspruch 21, wobei die rekombinante Wirtszelle eine Pantoea-Spezies ist. Verfahren gemäß Anspruch 23, wobei die rekombinante Wirtszelle Pantoea citrea ist. Verfahren gemäß Anspruch 24, wobei die rekombinante Wirtszelle eine inaktivierende Mutation von mindestens einer natürlich auftretenden Dehydrogenase-Aktivität besitzt. Verfahren gemäß Anspruch 25, wobei die Mutation eine membrangebundene GDH (Glucosedehydrogenase)-Aktivität ist. Verfahren gemäß Anspruch 25, wobei die Wirtszelle ferner Nukleinsäure umfasst, die eine heterologe GDH (Glucosedehydrogenase)-Aktität kodiert. Verfahren gemäß Anspruch 27, wobei die heterologe GDH (Glucosedehydrogenase)-Aktivtität aus T. acidophilum, Cryptococcus uniguttalatus oder einer Bacillus-Spezies erhältlich ist. Verfahren gemäß Anspruch 3, wobei die oxidierte Form des enzymatischen Cofaktors NADP+ ist, und die reduzierte Form von der enzymatischen Cofaktor NADPH ist. Verfahren gemäß Anspruch 3, wobei die oxidierte Form des enzymatischen Cofaktors NAD ist und die reduzierte Form NADH ist. Verfahren gemäß mindestens einem der vorhergehenden Ansprüche, welches kontinuierlich ist. Verfahren gemäß mindestens einem der vorhergehenden Ansprüche, welches ein Ansatz bzw. Batch ist. Verfahren gemäß mindestens einem der vorhergehenden Ansprüche, welches in einer Umgebung abläuft, die organische Lösungsmittel umfasst. Verfahren gemäß mindestens einem der vorhergehenden Ansprüche, welches in einer Umgebung abläuft, die lange Polymere umfasst. Verfahren gemäß mindestens einem der vorhergehenden Ansprüche, welches ferner den Schritt des Erhalts von ASA (L-Ascorbinsäure) aus der 2-KLG (2-Keto-L-gulonsäure) umfasst. Verfahren gemäß mindestens einem der vorhergehenden Ansprüche, wobei die 2-KLG (2-Keto-L-gulonsäure) ferner mittels Elektrodialyse gereinigt wird. Verfahren gemäß mindestens einem der vorhergehenden Ansprüche, wobei der Cofaktor mittels Nanofiltration gereinigt wird. Verfahren gemäß mindestens einem der vorhergehenden Ansprüche, welches in einer Salz umfassenden Umgebung abläuft. Verfahren gemäß Anspruch 38, wobei das Salz Ammoniumsulfat, Natriumacetat, Ammoniumacetat, Ammoniumchlorid, Natriumsulfat, Kaliumphosphat, Natriumphosphat, Natriumchlorid, KCl, NH4Cl, K2SO4 und NaI einschließt. Verfahren gemäß Anspruch 38, welches eine Salzkonzentration zwischen 0 mM und 500 mM umfasst. Wirtszelle zur Herstellung von 2-KLG, die Nukleinsäure mit einer inaktivierenden Mutation in dem GDH (Glycosedehydrogenase)-Aktivität kodierenden Gen, eine heterologe GDH-Aktivität kodierende Nukleinsäure und eine heterologe Reduktase-Aktivität kodierende Nukleinsäure umfasst, dergestalt, dass die heterologe GDH-Aktivität eine oxidierte Form eines Cofaktors erfordert, und die Reduktase eine reduzierte Form des Cofaktors erfordert. Wirtszelle gemäß Anspruch 41, welche eine Pantoea-Spezies ist.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com