PatentDe  


Dokumentenidentifikation DE69932197T2 03.05.2007
EP-Veröffentlichungsnummer 0000943688
Titel N-Acetylglucosamin-6-O-sulfotransferase Polypeptid und dafür kodierende DNA
Anmelder Seikagaku Corp., Tokio/Tokyo, JP
Erfinder Uchimura, Kenji, Nagoya-shi, Aichi-ken 456-0018, JP;
Muramatsu, Hideki, Haibara-gun, Shizuoka-ken 421-0401, JP;
Kadomatsu, Kenji, Tempaku, Nagoya-shi, Aichi-ken 468-0014, JP;
Kannagi, Reiji, Nagoya-shi, Aichi-ken 464-0072, JP;
Habuchi, Osami, Nagoya-shi, Aichi-ken 466-0812, JP;
Muramatsu, Takashi, Nagoya-shi, Aichi-ken 468-0011, JP
Vertreter Ullrich & Naumann, 69115 Heidelberg
DE-Aktenzeichen 69932197
Vertragsstaaten DE, FR, GB
Sprache des Dokument EN
EP-Anmeldetag 04.03.1999
EP-Aktenzeichen 993015304
EP-Offenlegungsdatum 22.09.1999
EP date of grant 05.07.2006
Veröffentlichungstag im Patentblatt 03.05.2007
IPC-Hauptklasse C12N 15/54(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 9/10(2006.01)A, L, I, 20051017, B, H, EP   C12P 19/04(2006.01)A, L, I, 20051017, B, H, EP   C07K 16/44(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
Gebiet der Erfindung

Die vorliegende Erfindung bezieht sich auf ein Polypeptid von N-Acetylglucosamin-6-O-sulfatotransferase und eine DNS mit einer Nukleotidsequenz, die das Polypeptid kodiert.

Beschreibung des Standes der Technik

Der nächste Stand der Technik wird im Folgenden beschrieben. Im Biochem. J., 319, S. 209–216 (1996) und im J. Biol. Chem. 272, 29493–29501 (1997) ist beschrieben worden, dass Mikrosomfraktionen von Ratten und Menschen eine N-Acetylglucosamin-6-O-sulfatotransferaseaktivität haben. Es gab aber bislang keinen Bericht über Isolierung und Identifizierung eines N-Acetylglucosamin-6-O-sulfatotransferase-polypeptids. Eine DNS, die dieses Polypeptid kodiert, war ebenfalls nicht bekannt.

Sobald ein N-Acetylglucosamin-6-O-sulfatotransferase-polypeptid erhalten wurde, kann es zur Synthese von Zuckerketten wie GlyCAM-1 verwendet werden, die ein L-Selectin-Ligand ist (das bei der Zielsuche und Rollen von Leukozyten beteiligt ist, die in frühen Stadien von Entzündungen erfolgen). Eine DNS, die dieses Polypeptid kodiert, könnte für die Herstellung des Polypeptids in großem Maßstab verwendet werden, oder zur künstlichen Synthese von GlyCAM-1 (das eine NeuAc&agr;2-3Gal&bgr;1-4(Fuc&agr;1-3)(SO4-6)GlcNAc-Struktur hat) unter Verwendung von Transformanten, die die DNS beherbergen, verwendet werden.

Zusammenfassung der Erfindung

Ein Gegenstand der vorliegenden Erfindung ist es, ein N-Acetylglucosamin-6-O-sulfatotransferasepolypeptid und eine, das Polypeptid kodierende DNS zur Verfügung zu stellen.

Die Erfinder der vorliegenden Erfindung haben erfolgreich eine DNS geklont, die ein N-Acetylglucosamin-6-O-sulfatotransferasepolypeptid kodiert, das die Wirkung hat, spezifisch eine Sulfatgruppe auf die 6-Stellung eines N-Acetylglucosaminrestes, der sich am nichtreduzierenden Ende von GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc befindet, zu übertragen, wobei GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung. Die Erfinder haben auch bestätigt, das das N-Acetylglucosamin-6-O-sulfatotransferasepolypeptid von der DNS exprimiert wurde und sie haben das Polypeptid identifizert, und damit die vorliegende Erfindung vollendet.

Die vorliegende Erfindung stellt ein Polypeptid (a) oder (b) zur Verfügung (im Folgenden manchmal als „das erfindungsgemäße Polypeptid" bezeichnet):

  • (a) ein Polypeptid, das aus einer durch die SEQ ID Nr. 2 repräsentierten Aminosäuresequenz besteht;

    oder
  • (b) ein Polypeptid, das eine Aminosäuresequenz einschließlich Substitution, Deletion, Insertion oder Transposition einer oder einiger Aminosäuren in der Aminosäuresequenz von (a) umfasst und die enzymatische Aktivität besitzt, eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung.

Das erfindungsgemäße Polypeptid schließt auch ein Polypeptid (a) oder (b) ein:

  • (a) ein Polypeptid, das aus einer durch die SEQ ID Nr. 4 repräsentierten Aminosäuresequenz besteht; oder
  • (b) ein Polypeptid, das eine Aminosäuresequenz einschließlich Substitution, Deletion, Insertion oder Transposition einer oder einiger Aminosäuren in der Aminosäuresequenz von (a) umfasst und die enzymatische Aktivität besitzt, eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung.

Das erfindungsgemäße Polypeptid schließt auch ein Polypeptid mit den folgenden Eigenschaften ein:

  • (1) Wirkung: eine Sulfatgruppe wird von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetylglucosaminrestes übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung;
  • (2) Substrat-Spezifizität: Eine Sulfatgruppe wird nicht auf Chondroitin, Chontroitin-4-sulfat, Chontroitin-6-Sulfat, Dermatansulfat, Keratansulfat, desulfatiertes Keratansulfat, CDSNS-Heparin, Muzin aus Schweinemagen, Muzin aus submandibulären Rinderdrüsen, und ein Oligosaccharid der Formel II Gal&bgr;1-4GlcNAc&bgr;1-3Gal&bgr;1-4GlcNac(II)übertragen, in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung; und
  • (3) die N-terminale Aminosäuresequenz umfasst eine Aminosäuresequenz, die durch die Aminosäuren Nr: 1 bis 48 in der SEQ ID Nr. 2 repräsentiert wird.

Die vorliegende Erfindung stellt eine DNS zur Verfügung, die ein Polypeptid (a) oder (b) kodiert, (im Folgenden manchmal als „erfindungsgemäße DNS" bezeichnet):

  • (a) ein Polypeptid, das aus der von der SEQ ID Nr. 2 repräsentierten Aminosäuresequenz besteht; oder
  • (b) ein Polypeptid, das eine Aminosäuresequenz einschließlich Substitution, Deletion, Insertion oder Transposition einer oder einiger Aminosäuren in der Aminosäuresequenz von (a) umfasst und enzymatische Aktivität besitzt, eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung.

Die erfindungsgemäße DNS schließt auch eine DNS ein, die ein die ein Polypeptid (a) oder (b) kodiert:

  • (a) ein Polypeptid, das aus der von der SEQ ID Nr. 4 repräsentierten Aminosäuresequenz besteht; oder
  • (b) ein Polypeptid, das eine Aminosäuresequenz einschließlich Substitution, Deletion, Insertion oder Transposition einer oder einiger Aminosäuren in der Aminosäuresequenz von (a) umfasst und enzymatische Aktivität besitzt, eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung.

Die erfindungsgemäße DNS ist vorzugsweise eine DNS, die eine von den Nukleotiden mit den Nummern 470 bis 1918 in der Nukleotidsequenz SEQ ID Nr. 1 umfasst und eine DNS, die eine von den Nukleotiden mit den Nummern 390 bis 1841 in der Nukleotidsequenz SEQ ID Nr. 3 umfasst.

Die vorliegende Erfindung stellt auch ein Verfahren zur Herstellung sulfatierter Zucker zur Verfügung (im Folgenden manchmal als „das erfindungsgemäße Herstellungsverfahren 1" bezeichnet) zur Verfügung, welche durch die Formel III repräsentiert werden: (SO4-6)GlcNAc-R(III)in der GlcNAc einen N-Acetylglucosaminrest darstellt, SO4-6 bedeutet, dass eine Hydroxylgruppe in 6-Stellung sulfatiert ist und -R ein Wasserstoffatom oder einen Zuckerrest darstellt, der über eine glycosidische Bindung gebunden ist, wobei das Verfahren einen Reaktionsschritt des oben beschriebenen Polypeptids mit einer Zuckerkette der Formel IV umfasst: GlcNAc-R(IV)in der GlcNAc einen N-Acetylglucosaminrest repräsentiert und -R ein Wasserstoffatom oder einen Zuckerrest darstellt, der über eine glycosidische Bindung gebunden ist.

Weiterhin stellt die vorliegende Erfindung ein Verfahren zur Herstellung sulfatierter Zucker zur Verfügung (im Folgenden manchmal als „das erfindungsgemäße Herstellungsverfahren 2" bezeichnet) zur Verfügung, das einen Schritt umfasst, bei dem erfindungsgemäße DNS in eine Zelle eingeschleust wird und die anschließende Kultivierung der besagten Zelle umfasst. Eine bevorzugte Ausführungsform dieses Verfahrens ist ein Verfahren, bei dem in eine Zelle gleichzeitig erfindungsgemäße DNS und cDNS, die Fucosyltransferase kodiert, eingeschleust werden.

Die vorliegende Erfindung stellt darüber hinaus einen Antikörper zur Verfügung, der mit 6-sulfatierem Sialyl-Lewis-X reagiert, aber nicht mit 6'-sulfatierem Sialyl-Lewis-X, 6,6'-bissulfatierem Sialyl-Lewis-X, 6-sulfatierem Lewis-X und Lewis-X.

Die vorliegende Erfindung stellt noch darüber hinaus einen Antikörper zur Verfügung, der spezifisch mit einer Zuckerkette der folgenden Formel reagiert: Gal&bgr;1-4(Fuc&agr;1-3)(SO4-6)GlcNAc

Die vorliegende Erfindung stellt auch einen Antikörper zur Verfügung, der spezifisch mit einer Zuckerkette der folgenden Formel reagiert: NeuAc&agr;2-3Gal&bgr;1-4(SO4-6)GlcNAc

Kurze Beschreibung der Zeichnungen

1 zeigt eine Auftragung der Hydrophobie des von Mäusen stammenden erfindungsgemäßen Polypeptids. Die Auftragung der Hydrophobie wurde mittels des Verfahrens von Kyte und Doolittle (J. Mol. Biol., 157, 105–132 (1982)) mit einem Fenster von 11 Aminosäuren berechnet.

2 zeigt die Substratspezifizität der erfindungsgemäßen von Mäusen stammenden DNS.

  • A: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc als Sulfatgruppenakzeptor
  • B: Gal&bgr;1-4GlcNAc&bgr;1-3Gal&bgr;1-4GlcNac (L1L1) als Sulfatgruppenakzeptor. Nach der Enzymreaktion wurden die Produkte mit Superdex 30-Gelchromatographie analysiert. „•" bedeutet in Gegenwart von Akzeptoren, „o" bedeutet in Abwesenheit von Akzeptoren. Pfeile bezeichnen die Eluierungsposition von Akzeptoren.

3 zeigt das Ergebnis des Assays von sulfatierten Produkten mit dem erfindungsgemäßen von Mäusen stammenden Polypeptid.

  • A: 35S-markiertes GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc wurde am N deacetyliert, die Aminobindung gespalten und reduziert und mittels Papierchromatographie aufgetrennt. Pfeile 1, 2 und 3 bezeichnen die Migrationsposition der Standardsubstanzen: 1, (SO4-6) Gal&bgr;1-4(SO4-6)-2,5-Anydromannitol; 2, Gal&bgr;1-4(SO4-6)-2,5-Anydromannitol; 3, (SO4-6)-2,5-Anydromannitol.
  • B: 35S-markierte (SO4-6)-2,5-Anydromannitolfraktion, die von einem horizontalem Balken in A) dargestellt wurde, wurde mit 3H-markiertem (SO4-6)-2,5-Anydromannitol (Standard) vermischt und mittels HPLC unter Verwendung einer SAX-10-Säule analysiert. Die Radioaktivität von 3H (o) und 35S (•) jeder Fraktion wurde bestimmt.

4 zeigt das Ergebnis des Assays der Spezifizität der monoklonalen Antikörper AG223 und G72 mittels ELISA.

Glycolipide wurden auf Kulturplatten mit 96 Vertiefungen immobilisiert und ELISA-Assays durchgeführt. „S" bezeichnet NeuAc, „Lex" Lewis-X-Ceramid, „PG" Paraglobosid, „SL2L4" NeuAc&agr;2-3Gal&bgr;1-4(SO4-6)GlcNAc&bgr;1-3(SO4-6)Gal&bgr;1-4(SO4-6)GlcNAc-Cholesterylanilin, respektive.

5 zeigt die Exprimierung des G72-Antigens durch Gentransfer mit der DNS der erfindungsgemäßen, von Mäusen stammenden DNS.

COS-7-Zellen vor dem Einschleusen von DNS (A, D) oder Zellen mit der eingeschleusten gleichgerichteten cDNS (in richtiger Orientierung) (B, E) oder mit entgengengerichteter cDNS (in entgegensetzteter Orientierung) (C, F) wurden mit dem monoklonalen Antikörper G72 zur Reaktion gebracht und mittels FACS analysiert. Dicke Linien sind Muster nach der Reaktion mit dem Antikörper und dünne Linien sind solche vor der Reaktion mit dem Antikörper. „–NANase" bezeichnet ein Ergebnis vor dem Abbau mit Neuraminidase, „+NANase" bezeichnet ein Ergebnis nach dem 30 minütigem Abbau mit 0,02 Einheiten/mL Neuraminidase von Arthtobacter ureafaciens in PBS (pH 7,4) bei 37°C.

6 zeigt die Exprimierung des AG223 (6-Sulfo-Lewis-X)-Antigens durch doppelten Einschleusen der von Mäusen stammenden erfindungsgemäßen DNS und Fucosyltransferase IV-cDNS. COS-7-Zellen nach Einschleusen von nur Fucosyltransferase IV-cDNS alleine (A, D), erfindungsgemäßer DNS alleine (B, E) oder beiden DNS-Arten (C, F) wurden mit dem monoklonalen AG223-Antikörper (A–C) oder mit LeuM1 (Anti-Lewis-X-Antikörper) (D–F) zur Reaktion gebracht und mittels FACS analysiert. Dicke Linien sind Muster nach der Reaktion mit dem Antikörper und dünne Linien sind solche vor der Reaktion.

7 zeigt die Exprimierung des G72-Antigens (6-Sulfosialyl-N-acetyllactosaminantigen) durch Gentransfer mit der erfindungsgemäßen von Menschen stammenden DNS und die Exprimierung des G152-Antigens (6-Sulfosialyl-Lewis-X-Antigens) durch doppelten Gentransfer mit der von Menschen stammenden erfindungsgemäßen DNS und Fucosyltransferase IV cDNS.

Die Daten zeigen die mittlere Fluoreszenzintensität der Antigen-positiven Gruppe in den Zellen mit Gentransfer.

8 zeigt das Ergebnis von Northern und Southern Analysen der erfindungsgemäßen von Mäusen stammenden DNS.

  • A: Nothern Blot-Analyse. Die Pfeilspitzen bezeichnen die Positionen unterschiedlicher mRNS mit 13,5, 9,8 und 3,9 kb. Die Positionen ribosomaler RNS sind auf der linken Seite angegeben. Eine Hybridisierung mit einer Glycerinaldehyd-3-phosphat-dehydrogenase-Sonde offenbarte eine ähnliche Intensität der Banden in jeder Reihe, mit Ausnahme der Bauchspeicheldrüse, wo die Intensität schwach war.
  • B: Genome Southern-Blot-Analyse. Einzelne Banden wurden nach Abbau mit EcoRI, EcoRV oder SacI nachgewiesen.

Genaue Beschreibung der Erfindung

Das Verfahren zur Durchführung der vorliegenden Erfindung wird im Folgenden beschrieben.

Wenn dort nicht anderes angegeben ist, ist Gal ein Galactoserest, GlcNAc ein N-Acetylglucosaminrest, NeuAc ein N-Acetylneuraminsäurerest, Fuc ein Fucoserest, &bgr;1-3 ist eine &bgr;1-3-glycosidische Bindung, &bgr;1-4 ist eine &bgr;1-4-glycosidische Bindung, &agr;2-3 ist eine &agr;2-3-glycosidische Bindung, &agr;1-3 ist eine &agr;1-3-glycosidische Bindung, SO4-6 besagt, dass eine Hydroxylgruppe in 6-Stellung sulfatiert ist, und Cer ist ein Ceramidrest, respektive.

<1> Erfindungsgemäße Polypeptide

Das erfindungsgemäße Polypeptid ist ein Polypeptid gemäß (a) oder (b):

  • (a) Polypeptid, das aus einer durch die SEQ ID Nr. 2 repräsentierten Aminosäuresequenz besteht, oder
  • (b) Polypeptid, das eine Aminosäuresequenz einschließlich Substitution, Deletion, Insertion oder Transposition einer oder einiger Aminosäuren in der Aminosäuresequenz von (a) umfasst und enzymatische Aktivität besitzt, eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)

Unter diesen ist das Polypeptid (a) bevorzugt.

In dieser Spezifikation bedeutet der Ausdruck „Polypeptid, das eine Aminosäuresequenz einschließlich Substitution, Deletion, Insertion oder Transposition einer oder einiger Aminosäuren in der Aminosäuresequenz von (a) umfasst und die enzymatische Aktivität besitzt, eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I (GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc) befindet" dass ein oder mehrere Aminosäurereste des Polypeptids substituiert, entfernt, eingefügt oder verlagert sein können, solange eine solche Modifikation die Aktivität, eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende von GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc befindet, nicht wesentlich beeinträchtigt.

Eine Mutation wie eine Substitution, Deletion, Insertion oder Transposition von Aminosäureresten kann in der Aminosäuresequenz des natürlich vorkommenden Polypeptids auftreten, z.B. auf Grund einer modifizierenden Reaktion der biosythetisierten Polypeptide in lebenden Organismen oder während ihrer Aufreinigung ebenso wie auf Grund von Polymorphismus und Mutationen der die Polypeptide kodierenden DNS, jedoch ist bekannt, dass manche der mutierten Polypeptide im Wesentlichen dieselbe physiologische und biologische Aktivität wie die intakten, nicht mutierten Polypeptide haben. Das erfindungsgemäße Polypeptid schließt solche mit geringfügig anderen Strukturen aber ohne signifikanten Unterschied der Funktionen ein. Das erfindungsgemäße Polypeptid schließt auch solche ein, die künstlich behandelt wurden, so dass sie in den Aminosäuresequenzen eine Mutation wie oben beschrieben, haben. In diesem Fall kann eine weitere Vielfalt an Mutanten hergestellt werden. Es ist z.B. bekannt, dass ein Polypeptid mit einer Aminosäuresequenz des Interleukin-2 (IL-2) des Menschen, bei dem ein Cysteinrest durch einen Serinrest ersetzt ist, die Interleukin-2-Aktivität beibehält (Science 224, 1431 (1984)). Weiterhin ist von einem Polypeptid einer bestimmten Art bekannt, dass es einen Peptidbereich hat, der zum Ausüben seiner Aktivitäten nicht essentiell ist. Beispiele für solche Polypeptide schließen ein im einem Polypeptid enthaltenes Signalpeptid ein, das extrazellulär ausgeschieden wird, und eine in einem Protease-Precursor gefundene Prosequenz und ähnliche ein. Die meisten dieser Bereiche sind nach einer Translation oder werden während der Überführung in eine aktive Form des Polypeptids entfernt. Diese Polypeptide existieren in unterschiedlichen Primärstrukturen, aber haben letztendlich äquivalente Funktionen. Solche Polypeptide sind beim erfindungsgemäßen Polypeptid ebenfalls eingeschlossen.

Der hier verwendete Ausdruck „einige Aminosäuren" bedeutet, die Anzahl an Aminosäureresten, die mutiert sein können, bis zu einem Ausmaß, dass die Aktivität des erfindungsgemäßen Polypeptids nicht verloren geht. Es können z.B. in einem aus 400 Aminosäureresten bestehenden Polypeptid etwa 20 oder weniger Aminosäurereste mutiert sein.

Die enzymatische Aktivität zur Übertragung einer Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetylglucosaminrestes, der sich am nichtreduzierenden Ende eines Oligosaccharids GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc befindet, kann mittels des Verfahrens bestimmt werden, bei dem die Aktivität des erfindungsgemäßen Polypeptids gemessen wird, wie später beschrieben wird. Zur Bestimmung des Vorhandenseins oder Fehlens der Aktivität des erfindungsgemäßen Polypeptids als Index, würde der Durchschnittsfachmann schnell Substitution, Deletion, Insertion oder Transposition von einem oder mehreren Aminosäureresten, die die Aktivität des Polypeptids nicht wesentlich beeinflussen, auswählen.

Dieses Polypeptid wurde ursprünglich von Mäusen erhalten. Selbstverständlich schließt das erfindungsgemäße Polypeptid auch solche Polypeptide ein, die mittels genetischer Engineering-Verfahren oder chemischer Synthese hergestellt werden.

Das erfindungsgemäße Polypeptid schließt auch ein Polypeptid gemäß den folgenden (a) oder (b) ein:

  • (a) Polypeptid, das aus einer durch die SEQ ID Nr. 4 repräsentierten Aminosäuresequenz besteht, oder
  • (b) Polypeptid, das eine Aminosäuresequenz einschließlich Substitution, Deletion, Insertion oder Transposition einer oder einiger Aminosäuren in der Aminosäuresequenz von (a) umfasst und enzymatische Aktivität besitzt, eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)

Unter den oben genannten Polypeptiden ist das Polypeptid (a) (Polypeptid, das aus einer durch die SEQ ID Nr. 4 repräsentierten Aminosäuresequenz besteht) bevorzugt, weil es zu 85% oder darüber homolog zu dem oben beschriebenen erfindungsgemäßen Polypeptid (a) ist (Polypeptid, das aus einer durch die SEQ ID Nr. 2 repräsentierten Aminosäuresequenz besteht). So schließt das erfindungsgemäße Polypeptid Polypeptide ein, die zu 85% oder darüber homolog zu dem von der Aminosäuresequens SEQ ID Nr. 2 repräsentierten Polypeptid sind.

Dieses Polypeptid wurde ursprünglich vom Menschen erhalten. Selbstverständlich schließt das erfindungsgemäße Polypeptid auch solche Polypeptide ein, die mittels genetischer Engineering-Verfahren oder chemischer Synthese hergestellt werden.

Das erfindungsgemäße Polypeptid schließt auch Polypeptide mit den folgenden Eigenschaften ein:

  • (1) Wirkung: Es überträgt eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetylglucosaminrestes, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)
  • (2) Substrat-Spezifizität: Es überträgt eine Sulfatgruppe nicht auf Chondroitin, Chontroitin-4-sulfat, Chontroitin-6-Sulfat, Dermatansulfat, Keratansulfat, desulfatiertes Keratansulfat, CDSNS-Heparin, Muzin aus Schweinemagen, Muzin aus submandibulären Rinderdrüsen, und ein Oligosaccharid der Formel II Gal&bgr;1-4GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(II)und
  • (3) N-terminale Aminosäuresequenz: Es umfasst eine Aminosäuresequenz, die durch die Aminosäuren Nr. 1 bis 48 in der SEQ ID Nr. 2 repräsentiert wird.

Für das erfindungsgemäße Polypeptid wird vorzugsweise 3'-Phosphoadenosin-5'-phosphosulfat (im Folgenden manchmal als „PAPS" bezeichnet) als Sulfatgruppen-Donor verwendet.

Diese erfindungsgemäßen Polypeptide können aus natürlichen Quellen durch Isolierung und Aufreinigung oder durch chemische Synthese gewonnen werden, weil ihre Aminosäuresequenzen und Eigenschaften durch diese Erfindung offenbart werden. Vorzugsweise wird das Polypeptid unter Verwendung der erfindungsgemäßen DNS, wie weiter unten beschrieben, hergestellt. Das Verfahren zur Herstellung des erfindungsgemäßen Peptids unter Verwendung der erfindungsgemäßen DNS wird später beschrieben. Das erfindungsgemäße Polypeptid ist nicht notwendigerweise ein einzelnes Polypeptid sondern kann, falls nötig, Teil eines Fusionsproteins sein. Als Beispiel kann ein Fusionsprotein angegeben werden, das das erfindungsgemäße Polypeptid und ein anderes für die Exprimierung nötiges Polypeptid umfasst.

Weil das erfindungsgemäße Polypeptid die Aktivität besitzt, spezifisch eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetylglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende von GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc befindet, kann das erfindungsgemäße Polypeptid dazu verwendet werde, spezifisch die 6-Stellung eines N-Acetylglucosaminrestes zu sulfatieren, der sich an einem nichtreduzierenden Ende befindet, und so Zuckerketten mit GlyCAM-1-Strukut usw. zu synthetisieren.

<2> Erfindungsgemäße DNS

Die erfindungsgemäße DNS ist eine DNS, die ein Polypeptid gemäß den folgenden (a) oder (b) kodiert:

  • (a) ein Polypeptid, das aus einer durch SEQ ID Nr. 2 repräsentierten Aminosäuresequenz besteht, oder
  • (b) ein Polypeptid, das eine Aminosäuresequenz einschließlich Substitution, Deletion, Insertion oder Transposition einer oder einiger Aminosäuren in der Aminosäuresequenz von (a) umfasst und die enzymatische Aktivität besitzt, eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I).

Unter diesen ist eine DNS, die das Polypeptid (a) kodiert, vorteilhaft.

Als Beispiel für eine solche DNS, kann eine DNS angegeben werden, die eine durch die Nukleotide mit den Nummern 470 bis 1918 in der SEQ ID Nr. 1 repräsentierte Nukleotidsequenz enthält.

Diese DNS wurde ursprünglich von Mäusen erhalten. Selbstverständlich ist die Quelle für die erfindungsgemäße DNS nicht eingeschränkt und sie schließt auch DNS ein, die mittels genetischer Engineering-Verfahren oder chemischer Synthese hergestellt wird.

Die erfindungsgemäße DNS schließt auch eine DNS ein, die ein Polypeptid gemäß den folgenden (a) oder (b) kodiert:

  • (a) ein Polypeptid, das aus einer durch SEQ ID Nr. 4 repräsentierten Aminosäuresequenz besteht, oder
  • (b) ein Polypeptid, das eine Aminosäuresequenz einschließlich Substitution, Deletion, Insertion oder Transposition einer oder einiger Aminosäuren in der Aminosäuresequenz von (a) umfasst und enzymatische Aktivität besitzt, eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes zu übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I).

Unter diesen ist eine DNS, die das Polypeptid (a) kodiert, vorteilhaft, weil das von der DNS kodierte erfindungsgemäße Polypeptid zu 85% oder darüber homolog zu dem oben beschriebenen erfindungsgemäßen Polypeptid ist, das aus einer durch die SEQ ID Nr. 2 repräsentierten Aminosäuresequenz besteht.

Als spezifisches Beispiel für eine solche DNS kann eine DNS angegeben werden, die eine durch die Nukleotide mit den Nummern 390 bis 1841 in der von SEQ ID Nr. 3 repräsentierten Nukleotidsequenz enthält.

Diese DNS wurde ursprünglich von Menschen erhalten. Selbstverständlich ist die Quelle für die erfindungsgemäße DNS nicht eingeschränkt und schließt auch DNS ein, die mittels genetischer Engineering-Verfahren oder chemischer Synthese hergestellt wird.

Weiterhin ist für den Durchschnittsfachmann klar, dass die erfindungsgemäße DNS wegen der Entartung der genetischen Codes, DNS mit einer anderen als der oben beschriebenen Nukleotidsequenz einschließt.

Die erfindungsgemäße DNS schließt auch DNS oder RNS ein, die zu der erfindungsgemäßen DNS komplementär ist. Weiterhin kann die erfindungsgemäße DNS entweder eine das erfindungsgemäße Polypeptid kodierende Einzelstrang-Kette sein oder eine Doppelstrang-Kette, die aus der oberen Einzelstrang-Kette und einer DNS oder RNS mit dazu komplementärer Nukleotidsequenz besteht.

Wie oben unter <1> beschrieben, schließt das erfindungsgemäße Polypeptid auch Polypeptide mit einer leicht abweichenden Struktur ein, deren Funktion sich aber nicht wesentlich vom erfindungsgemäßen Polypeptid unterscheidet. Die erfindungsgemäße DNS schließt auch eine DNS ein, die Polypeptide mit einer leicht abweichenden Struktur kodiert, deren Funktion sich aber nicht wesentlich vom erfindungsgemäßen Polypeptid unterscheidet.

Ein spezifisches Beispiel für eine solche DNS ist eine DNS, die auf Grund von Polymorphismus oder Mutation leicht von der erfindungsgemäßen DNS verschieden ist, die aber ein Polypeptid kodiert, dessen Funktionen im Wesentlichen äquivalent zu den Funktionen des erfindungsgemäßen Polypeptids sind.

Von dem Gen, das das erfindungsgemäße Polypeptid kodiert und aus einem Chromosom stammt, wird angenommen, dass es im Kodierungsbereich Intronen enthält. Die erfindungsgemäße DNS enthält auch von den Intronen getrennte DNS-Fragmente, solange die Fragmente das erfindungsgemäße Polypeptid kodieren. Und zwar beinhaltet die Bedeutung des hier verwendeten Ausdrucks „kodieren", dass sie eine Nukleotidsequenz hat, die bei der Transkription Processing unterliegt und schließlich in der Lage ist, ein gewünschtes Polypeptid zu exprimieren.

Für die erfindungsgemäße DNS ist PAPS als Sulfatgruppen-Donor bevorzugt.

1. Verfahren zur Herstellung der erfindungsgemäßen DNS

Weil die Nukleotidsequenz der erfindungsgemäßen DNS durch die vorliegende Erfindung offenbart wird, kann die DNS auf der Grundlage der Sequenz synthetisiert werden. Alternativ kann die DNS erhalten werden, indem erfindungsgemäße DNS aus chromosomaler DNS oder mRNS mittels eines Poylmerasekettenverfahrens (PCR) unter Verwendung von Oligonukleotidprimern auf Basis der Sequenz angereichert wird. Die erfindungsgemäße DNS wurde zuerst mittels cDNS-Klonen erhalten, das die folgenden Schritte in den unten beschriebenen Beispielen umfasst.

(1) Herstellung der erfindungsgemäßen von Mäusen stammenden DNS

  • i) Herstellung von Oligonukleotidprimern für PCR;
  • ii) Anreicherung mittels inverser Transkriptions-PCR (RT-PCR) unter Verwendung einer Total-Maus-RNS;
  • iii) Screening der erfindungsgemäßen DNS mit einer Maus-cDNS-Sammlung unter Verwendung der PCR-Produkte.

(2) Herstellung der erfindungsgemäßen vom Menschen stammenden DNS

  • i) Screening der erfindungsgemäßen DNS mit einer humanen cDNS-Sammlung unter Verwendung in iii) in (1) oben erhaltenen cDNS;
  • ii) Sequenzierung der so erhaltenen Nukleotidsequenz der cDNS.

Aber das Verfahren zur Herstellung der erfindungsgemäßen DNS ist nicht auf das obige Verfahren beschränkt. Die erfindungsgemäße DNS kann mittels anderer bekannter cDNS-Klonverfahren hergestellt werden.

Ein Verfahren zur Herstellung erfindungsgemäßer DNS wird im Folgenden beschrieben.

(1) Herstellung von Herstellung von Oligonukleotidprimern für PCR

Oligonukleotidprimer (ein gleichsinniger und ein entgegengesetzt gerichteter Primer) werden auf der Basis einer von Mäusen exprimierten Markierungssequenz (EST), Hinterlegungsnummer der Genbank: AA103962) hergestellt, die eine Homologie zum katalytischen Bereich von Mäuse-Chondroitin-6-sulfotransferase haben. Spezifische Beispiele für die Oligonukleotidprimer sind 5'-GTCGTCGGACTGGTGGACGA-3' (SEQ ID Nr. 5) als gleichsinniger Primer, und 5'-CCCAGAGCGTGGTAGTCTGC-3' als gegensinniger Primer, respektive. Diese werden bevorzugt verwendet.

(2) Anreicherung mittels RT-PCR unter Verwendung von Total-Maus-RNS als Templat

Eine Total-RNS kann mittels eines bekannten Verfahrens erhalten werden (z.B. Kingston, R. S., (1991) in Current Protocols in Molecular Biology, Supplement 14, Einheit 4.2, Greene Publishing Associates und Wiley InterScience, New York). Es kann ohne Einschränkung jedes Startmaterial verwendet werden, solange es mRNS des erfindungsgemäßen Polypeptids kodiert. Zum Beispiel können Mäusembryonen, insbesondere 13 Tage alte Mausembryonen verwendet werden.

Eine das erfindungsgemäße Polypeptid kodierende partielle cDNS kann mittels RT-PCR unter Verwendung der obigen Total-RNS als Templat und Oligonukleotidprimern angereichert werden. PCR kann entsprechend des gewöhnlichen Verfahrens durchgeführt werden.

(3) Screening der erfindungsgemäßen DNS aus einer Maus-cDNS-Sammlung unter Verwendung der PCR-Produkte

Die bei der oberen RT-PCR in (2) erhaltenen PCR-Produkte werden mit 32P oder ähnlichem markiert und dann als Hybrisisierungssonden für das Screening von cDNS-Fragmenten (erfindungsgemäßen DNS) aus einer cDNA-Sammlung verwendet. Die zu verwendende Maus-cDNS-Sammlung ist nicht besonders eingeschränkt. Als Beispiel kann eine &lgr;gtII-Sammlung, die Mäuseembryonen-cDNS enthält (&lgr;gtII-Mäuseembryonen-cDNS-Sammlung) genannt werden.

Die Hybridisierung kann mittels eines bekannten Verfahrens durchgeführt werden (z.B. J. Biol. Chem., 270, 18575–18580 (1995)).

Ein DNS-Insert wird aus einem positiven Klon mittels Abbau mit EcoRI isoliert und in z.B. pBluescript II SK (STRATGENE) subkloniert. Danach kann die Nukleotidsequenz mittels eines bekannten Verfahrens wie des Verfahrens der Bestimmung von Dideoxi-Kettenabbruch bestimmt werden (Proc. Natl. Acad. Sci. USA, 74, 5463–5467 (1977)).

Die mittels einer Folge der oben beschriebenen Verfahren erhaltene Nukleotidsequenz der erfindungsgemäßen DNS und die von dieser Nukleotidsequenz abgeleitete Aminosäuresequenz sind werden in der SEQ ID Nr. 1 gezeigt und dieselbe Aminosäuresequenz alleine wird in der SEQ ID Nr. 2 gezeigt.

(4) Screening einer humanen cDNS-Sammlung und Sequenzierung der Nukleotidsequenz unter Verwendung der oben erhaltenen (Maus) cDNS

Die erfindungsgemäße humane DNS kann durch Screening einer humanen cDNS-Sammlung (z.B. eine &lgr;gtII-Sammlung, die cDNS des Gehirns menschlicher Föten enthält) unter Verwendung der oben erhaltenen (Maus) cDNS erhalten werden. Die Nukleotidsequenz kann auch mittels des oben beschriebenen Verfahrens bestimmt werden.

Die mittels des oben beschriebenen Verfahrens erhaltene Nukleotidsequenz der erfindungsgemäßen DNS und die von dieser Nukleotidsequenz abgeleitete Aminosäuresequenz sind werden in der SEQ ID Nr. 3 gezeigt und dieselbe Aminosäuresequenz alleine wird in der SEQ ID Nr. 4 gezeigt.

2. Verfahren zur Herstellung des erfindungsgemäßen Polypeptids unter Verwendung der erfindungsgemäßen DNS

Zellen, in die erfindungsgemäße DNS eingeschleust wurde, werden ein einem Medium kultiviert, das sich dazu eignet, das durch die erfindungsgemäße DNS kodierte Polypeptid herzustellen, und in der Kultur angereichert. Das erfindungsgemäße Polypeptid kann gewonnen werden, indem es aus der Kultur gewonnen wird.

Die Zellen, in die erfindungsgemäße DNS eingeschleust wurde, können erhalten werden, indem ein Fragment der erfindungsgemäßen DNS in einen bekannten Exprimierungsvektor zum Herstellen eines rekombinanten Plasmids eingeführt wird, und das rekombinante Plasmid in die Zellen eingeschleust wird. Die hier verwendete erfindungsgemäße DNS ist nicht besonders eingeschränkt, solange sie erfindungsgemäße DNS ist. Es ist vorteilhaft, eine DNS zu verwenden, die die durch die Nukleotide mit den Nummern 470 bis 1918 in der SEQ ID Nr. 1 repräsentierte Nukleotidsequenz umfasst, und es ist besonders vorteilhaft, eine DNS zu verwenden, die die durch die Nukleotide mit den Nummern 467 bis 1921 in der SEQ ID Nr. 1 repräsentierte Nukleotidsequenz umfasst. Es ist auch vorteilhaft, eine DNS zu verwenden, die die durch die Nukleotide mit den Nummern 390 bis 1841 in der SEQ ID Nr. 3 repräsentierte Nukleotidsequenz umfasst und es ist besonders vorteilhaft, eine DNS zu verwenden, die die durch die Nukleotide mit den Nummern 387 bis 1844 in der SEQ ID Nr. 3 repräsentierte Nukleotidsequenz umfasst.

Was die Zellen betrifft, so können als Beispiel prokaryontische Zellen wie Escherichia coli und eukaryotische Zellen wie Säugetierzellen gegeben werden. Wenn prokaryontische Zellen wie Escherichia coli verwendet werden, addiert sich an das mittels der Expression der erfindungsgemäßen DNS hergestellte Polypeptid keine Zuckerkette, und so kann ein erfindungsgemäßes Polypeptid ohne Zuckerkette erhalten werden. Wenn eukaryontische Zellen wie Säugetierzellen verwendet werden, kann sich an das mittels der Expression der erfindungsgemäßen DNS hergestellte Polypeptid eine Zuckerkette addieren, und so erfindungsgemäßes, eine Zuckerkette umfassendes Polypeptid erhalten werden.

In diesem Herstellungsverfahren kann ein gewöhnlich für die Herstellung von Proteinen verwendetes Wirtsvektor-System verwendet werden. Es ist z.B. vorteilhaft, eine Kombination von von Säugetieren erhaltenen kultivierten Zellen wie COS-7-Zellen und einen Exprimierungsvektor für Säugetierzellen wie den pcDNS3-Exprimierungsvektor (Invitrogen) zu verwenden. Das Kulturmedium und die Kultivierungsbedingungen werden in Abhängigkeit vom Wirt, also den verwendeten Zellen, geeignet ausgewählt.

Die erfindungsgemäße DNS kann direkt exprimiert werden. Alternativ kann sie mit einem anderen Polypeptid als Fusionspolypeptid exprimiert werden. Die erfindungsgemäße Gesamt-DNS kann exprimiert werden. Sie kann auch teilweise als partielles Peptid exprimiert werden.

Das erfindungsgemäße Polypeptid kann aus dem Kultivierungsprodukt mittels der bekannten Extraktions- und Reinigungsverfahren für Polypeptide gewonnen werden. Das hier verwendete Kultivierungsprodukt schließt das Medium und die Zellen im Medium ein.

Spezifische Verfahren zum Extrahieren des erfindungsgemäßen Polypeptids schließen Extraktion durch Aufreißen der Zellen wie Homogenisieren, das Mahlverfahren mit Glaskugeln, Ultraschallbehandlung, Verfahren mit osmotischem Schock und das Einfrier-Auftau-Verfahren, die Extraktion mit einem oberflächenaktiven Stoff oder irgend eine Kombination davon ein.

So ist z.B. Homogenisierung zum Extrahieren des erfindungsgemäßen Polypeptids aus dem oben beschriebenen Kultivierungsprodukt vorteilhaft.

Spezifischer werden die Zellen aus dem Kultivierungsprodukt gewonnen und ein Puffer (der einen oberflächenaktiven Stoff enthalten kann) wird zugegeben. Die resultierende Zellsuspension wird mit einem Homogenisiergerät homogenisiert und anschleißend kann die Extraktion durchgeführt werden, indem sie mittels eines Trennverfahrens wie Zentrifugieren in einen Zell-Niederschlag und einen Überstand (Extrakt) getrennt wird, und diese Methode ist vorteilhaft.

Spezifische Verfahren zum Aufreinigen des erfindungsgemäßen Peptids schließen Aussalzen mit einem Salz wie Ammoniumsulfat oder Natriumsulfat, Zentrifugieren, Dialyse, Ultrafiltration, Absorptionschromatographie, Ionenaustauschchromatographie, Hydrophobe Chromatographie, Inversphasenchromatographie, Gelfiltration, Gelpermeationschromatographie, Affinitätschromatographie, Elektrophorese und irgend eine ihrer Kombination ein.

Der Nachweis, ob das erfindungsgemäße Polypeptid hergestellt wurde oder nicht, kann mittels Analysieren der Aminosäuresequenz, der Wirkung und der Substratspezifität des gereinigten Polypeptids und vergleichen mit den physikalischen Eigenschaften des erfindungsgemäßen Polypeptids wie in <1> beschrieben, erfolgen.

Die erfindungsgemäße DNS sollte zur Herstellung des erfindungsgemäßen Peptids in großem Maßstab, künstlicher Synthese von GlyCAM-1 in lebenden Organismen (Zellen) oder Ähnlichem verwendbar sein.

<3> Erfindungsgemäßes Herstellverfahren 1

Das erfindungsgemäße Herstellverfahren 1 ist ein Verfahren zur Herstellung eines sulfatierten Zuckers der Formel III, das einen Schritt umfasst, bei dem das erfindungsgemäße Polypeptid mit einer Zuckerkette der Formel IV reagiert: (SO4-6)GlcNAc-R(III)GlcNAc-R(IV),worin -R ein Wasserstoffatom oder einen mittels einer glycosidischen Bindung gebundenen Zuckerrest repräsentiert.

Das im erfindungsgemäßen Herstellverfahren 1 verwendbare erfindungsgemäße Polypeptid ist nicht besonders eingeschränkt, solange es das erfindungsgemäße Polypeptid ist. Das hier verwendbare erfindungsgemäße Polypeptid ist nicht notwendigerweise vollständig aufgereinigt, solange die Aktivität des Polypeptids nicht wesentlich beeinträchtigt ist. So kann auch das teilweise gereinigte Polypeptid oder das Polypeptid in der Form des Zellextrakts verwendet werden.

Es zeigte sich, dass mittels des erfindungsgemäßen Herstellverfahrens 1 hergestelltes erfindungsgemäßes Polypeptid eine Aktivität aufwies, spezifisch eine Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetylglucosaminrestes, der sich am nichtreduzierenden Ende eines Oligosaccharids befindet, zu übertragen. Das erfindungsgemäße Herstellverfahren 1 ist ein Verfahren zur Herstellung von sulfatiertem Zucker unter Verwendung oder obigen Erkenntnis. Das wichtigste und essentielle Element im erfindungsgemäßen Herstellverfahren 1 ist der Teil mit Ausnahme von -R in den oberen Formeln III und IV. Anders ausgedrückt, kann -R eine optionale Struktur haben und der Zuckerrest ist nicht besonders eingeschränkt. Z. B. kann -R eine Zuckerkette (Glycolipid) mit einem Lipid (wie einem Ceramidrest) an seinem Ende sein.

In den oberen Formeln III und IV sind die Zuckerketten der Formeln V und VI, respektive, vorteilhaft: (SO4-6)GlcNAc&bgr;1-3Ga1&bgr;1-4GlcNAc-R'(V)GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc-R'(VI),worin -R ein Wasserstoffatom oder einen mittels einer glycosidischen Bindung gebundenen Zuckerrest repräsentiert.

R' ist vorteilhafterweise ein Wasserstoffatom oder eine Zuckerkette mit 1 bis 15 Sacchariden, noch vorteilhafter ein Wasserstoffatom oder eine Zuckerkette mit 1 bis 10 Sacchariden und besonders vorteilhaft ein Wasserstoffatom oder eine Zuckerkette mit 1 bis 2 Sacchariden und am vorteilhaftesten ein Wasserstoffatom. Wenn R' eine Zuckerkette ist, hat sie vorteilhafterweise eine Hauptkette, die aus einer sich wiederholenden Struktur von (-3Gal&bgr;1-4GlcNAc&bgr;1-) (Lactosamin) besteht. In diesem Fall kann an die Hauptkette von R' ein Sialinsäurerest, ein Fucoserest, eine Sulfatgruppe usw. addiert sein.

Wenn das erfindungsgemäße Polypeptid mit der Zuckerkette nach IV beim erfindungsgemäßen Herstellverfahren 1 zur Reaktion gebracht wird, ist es vorteilhaft, wenn sie zusammen mit einem Sulfatgruppen-Donor vorliegt.

Beim erfindungsgemäßen Herstellverfahren 1 wird gewöhnlich PAPS als Sulfatgruppen-Donor verwendet.

Die Reaktion, der das erfindungsgemäße Polypeptid mit der Zuckerkette nach IV unterzogen wird, kann durchgeführt werden, indem die Zuckerkette nach IV zusammen mit dem erfindungsgemäßen Polypeptid und dem Sulfatgruppen-Donor vereinigt wird. Der pH-Wert ist bei dieser Reaktion nicht besonders eingeschränkt, solange die Aktivität des erfindungsgemäßen Polypeptids erhalten bleibt. Die Reaktion wird vorteilhafterweise bei einem etwa neutralen pH-Wert durchgeführt (z.B. bei etwa 6.8), bevorzugter in einer Pufferlösung, die bei diesem pH-Wert puffernde Wirkung hat. Die Reaktionstemperatur ist nicht besonders eingeschränkt, solange die Aktivität des erfindungsgemäßen Polypeptids erhalten bleibt. Als Beispiel kann eine Temperatur von etwa 30 bis 40°C angegeben werden. Weiterhin kann dann, wenn irgendeine Substanz die Aktivität des erfindungsgemäßen Polypeptids steigert, diese Substanz zugegeben werden. Ein Durchschnittsfachmann würde die Reaktionszeit in Abhängigkeit von der verwendeten Menge Zuckerkette, Sulfatgruppen-Donor und erfindungsgemäßem Polypeptid und anderen Reaktionsbedingungen bestimmen. Bei der Reaktion kann auch MnCl2 oder Ähnliches vorhanden sein.

Im Falle der Herstellung in kleinem Maßstab kann das erfindungsgemäße Polypeptid gleichzeitig mit der Zuckerkette nach Formel IV und dem Sulfatgruppen-Donor vorliegen und das besagte Polypeptid kann zur Reaktion gebracht werden. Im Falle einer Herstellung in großem Maßstab kann das erfindungsgemäße Polypeptid unter Verwendung von immobilisiertem Enzym, das durch Immobilisierung des erfindungsgemäßen Polypeptids an eine geeignete feste Phase (Perlen oder Ähnliches), oder einen Membranreaktor wie eine Ultrafiltrationsmembran oder eine Dialysemembran hergestellt wurde, kontinuierlich hergestellt werden. Ein Bioreaktor zur Regenerierung (Synthese) des Sulfatgruppen-Donors kann damit kombiniert verwendet werden.

Durch die Wirkung des erfindungsgemäßen Polypeptids wird eine Sulfatgruppe spezifisch auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetylglucosaminrestes hat, der sich am nichtreduzierenden Ende der Zuckerkette nach Formel IV befindet, übertragen, um die Zuckerkette nach Formel III zu erzeugen.

Die Zuckerkette nach Formel III kann aus dem Reaktionsgemisch mittels gewöhnlicher Verfahren zum Isolieren und Aufreinigen von Zuckerketten gewonnen werden. Beispiele für solche Verfahren schließen Adsorptionschromatographie, Anionenaustauschchromatographie, Hydrophobe Chromatographie, Gelfiltration, Gelpermeationschromatographie, Papierelektrophorese, Papierchromatographie, Dünnschichtchromatographie, Fraktionierung mit organischen Lösemitteln (vorzugsweise Alkohol, Aceton und ähnlichen) und irgend eine Kombination dieser Verfahren ein. Jedoch sind die Gewinnungsverfahren nicht darauf beschränkt.

Die so erhaltene Zuckerkette nach Formel III kann als Zwischenprodukt zur Herstellung von z.B. GlyCAM-1 oder seiner Zuckerhauptkettenstruktur verwendet werden.

<4> Erfindungsgemäßes Herstellverfahren 2

Das erfindungsgemäße Herstellverfahren 2 ist ein Verfahren zur Herstellung sulfatierter Zucker, das Schritte umfasst, bei denen in Zellen erfindungsgemäße DNS eingeschleust wird und die Zellen dann kultiviert werden.

Solange das Verfahren mindestens diese Schritte umfasst, ist in das erfindungsgemäße Herstellverfahren 2 jedes Verfahren eingeschlossen, das zusätzliche Schritte umfasst. Zum Beispiel schließt das erfindungsgemäße Herstellverfahren 2 ein Verfahren zur Herstellung sulfatierter Zucker ein, das das Kultivieren von Zellen, in die erfindungsgemäße DNS eingeschleust worden ist, in einem geeigneten Medium, das Isolieren der Zellen aus dem Kultivierungsprodukt und das Gewinnen der von den Zellen exprimierten sulfatierten Zuckerkette umfasst.

Der hergestellte sulfatierte Zucker wird nicht notwendigerweise isoliert und von den Zellen gereinigt. Wenn die Zellen selbst, an deren Oberfläche sulfatierter Zucker exprimiert wird, gewünscht sind, werden die Zellen im Kultivierungsprodukt gewonnen und so, wie sie sind, verwendet.

Die erfindungsgemäße DNS kann mittels eines bekannten Verfahrens unter Verwendung von DEAE-Dextran, Calciumphosphat, Polybren und Ähnlichem oder anderen auf dem Gebiet des Genetic Engineering wohlbekannten Verfahren in Zellen eingeschleust werden.

Die erfindungsgemäße DNS, die in Zellen eingeschleust werden soll, wird in die Zellen vorzugsweise in Form eines rekombinanten Plasmids eingeschleust, das durch Einfügen der erfindungsgemäßen DNS in einen bekannten Exprimierungsvektor gewonnen wird. Die hier verwendete erfindungsgemäße DNS ist nicht besonders eingeschränkt, solange sie zur erfindungsgemäßen DNS gehört. Es ist vorteilhaft eine DNS zu verwenden, die die durch die Nukleotide mit den Nummern 470 bis 1918 in der SEQ ID Nr. 1 repräsentierte Nukleotidsequenz umfasst, insbesondere eine DNS mit der durch die Nummern 467 bis 1921 in der SEQ ID Nr. 1 repräsentierten Nukleotidsequenz.

Beispiele für Zellen sind prokaryontische Zellen wie Escherichia coli und eukaryotische Zellen wie Säugetierzellen.

Bei diesem Herstellungsverfahren kann ein Wirts-Vektorensystem, das gewöhnlich zur Herstellung von Proteinen verwendet wird, verwendet werden. Es ist z.B. vorteilhaft, eine Kombination von kultivierten, von Säugetieren stammenden Zellen wie COS-7-Zellen und einem Exprimierungsvektor für Säugetierzellen wie den pcDNS3-Exprimierungsvektor (Invitrogen Co.) zu verwenden. Das Kulturmedium und die Kultivierungsbedingungen werden in Abhängigkeit vom verwendeten Wirt, nämlich den Zellen, geeignet ausgewählt. Das Kultivierungsprodukt kann durch Durchführung einer Kultivierung unter solchen Bedingungen erhalten werden.

Der sulfatierte Zucker kann aus dem Kultivierungsprodukt mittels bekannter Extraktions- und Reinigungsverfahren für Glycolipide gewonnen werden. Das hier verwendete Kultivierungsprodukt schließt das Medium und die Zellen im Medium ein.

Spezifische Verfahren zum Extrahieren von Glycolipiden schließen Extraktion mit einem organischen Lösemittel wie Methanol oder Chloroform, Extraktion durch Aufreißen der Zellen wie Homogenisieren oder Ultraschallbehandlung und jede Kombination davon ein. Die Zellen im Kultivierungsprodukt werden solchen Extraktionsverfahren unterzogen, um Extrakt, der sulfatierten Zucker enthält, zu erhalten.

Der sulfatierte Zucker kann aus dem Extrakt mittels gewöhnlicher Extraktions- und Reinigungsverfahren für Zuckerketten gewonnen und gereinigt werden. Dazu können Verfahren wie Adsorptionschromatographie, Anionenaustauschchromatographie, Hydrophobe Chromatographie, Gelfiltration, Gelpermeationschromatographie, Papierelektrophorese, Papierchromatographie, Dünnschichtchromatographie, Fraktionierung mit organischen Lösemitteln (vorzugsweise Alkohol, Aceton und ähnlichen) und irgend eine Kombination dieser Verfahren durchgeführt werden. Jedoch sind die Gewinnungsverfahren nicht darauf beschränkt.

Durch den Schritt, bei dem die Hydroxylgruppe in der 6-Stellung eines N-Acetylglucosaminrestes, der sich am nichtreduzierenden Ende der Zuckerkette befindet, durch die Wirkung des erfindungsgemäßen Polypeptids sulfatiert wird, welches durch Einschleusen der erfindungsgemäßen DNS in Zellen exprimiert wird, wird der durch das erfindungsgemäße Herstellverfahren 2 hergestellte sulfatierte Zucker auf der Zelloberfläche exprimiert. Der exprimierte sulfatierte Zucker hat mindestens eine Zuckerkettenstruktur der Formel VII: NeuAc&agr;2-3Gal&bgr;1-4(SO4-6)GlcNAc-R, in der -R ein Wasserstoffatom oder ein mittels einer glycosidischen Bindung gebundener Zuckerrest ist. Ein Lipid wie Ceramid kann an das Wasserstoffatom oder den mittels einer glycosidischen Bindung gebundenen Zuckerrest gebunden sein.

Diese Zuckerkettenstruktur wird von Antikörpern erkannt, die mit 6-sulfatierem Sialyl-Lewis-X-Ceramid (6-Sulfo-SLeX-Ceramid) und SL2L4 (NeuAc&agr;2-3Gal&bgr;1-4(SO4-6)GlcNAc-&bgr;1-3(SO4-6)Gal&bgr;1-4(SO4-6)GlcNAc) reagieren, aber nicht mit 6'-sulfatiertem Sialyl-Lewis-X-Ceramid (6'-Sulfo-SLeX-Ceramid) und Sialylparaglobosid (SPG) (die zur Reaktion mindestens nötige Struktur ist NeuAc&agr;2-3Gal&bgr;1-4(SO4-6)GlcNAc). Solche Antikörper können mittels gewöhnlicher Verfahren zur Herstellung von Antikörpern unter Verwendung von 6-sulfatierem Sialyl-Lewis-X-Ceramid hergestellt werden. Die Antikörper sind vorzugsweise monoklonale Antikörper.

Die monoklonalen Antikörper können mittels des Verfahrens von Kohler und Milstein (Nature 256, 495–497 (1975)) hergestellt werden. Zum Beispiel lässt man 6-sulfatieres Sialyl-Lewis-X-Ceramid an Bakterienzellen wie Salmonella minnesota adsorbieren. Das resultierende Konjugat wird einem zum immunisierenden Tier wie Mäusen, Ratten, Meerschweinchen, Kaninchen, Ziegen, Schafen und ähnlichen intraperitoneal, subkutan oder in die Fußsohlen verabreicht. Die Milz oder Lymphknoten aus der Kniekehle werden entnommen und aus diesen Geweben gewonnene Zellen werden einer Zellfusion mit einer Tumorzelllinie, Myelom, unterzogen, um Hybrid-Myelomzellen zu bilden. Die so erhaltenen Hybrid-Myelomzellen werden subkultiviert, damit aus diesen Hybrid-Myelomzellen solche selektiert werden können, die kontinuierlich einen Antikörper herstellen, der mit 6-sulfatierem Sialyl-Lewis-X-Ceramid und SL2L4 reagiert, aber nicht mit 6'-sulfatiertem Sialyl-Lewis-X-Ceramid (6'-Sulfo-SLeX-Ceramid) und Sialylparaglobosid (SPG) (einem Antikörper, der die zur Reaktion mindestens nötige Struktur NeuAc&agr;2-3Gal&bgr;1-4(SO4-6)GlcNAc hat). Die so kultivierte Ziellinie wird in einem geeigneten Medium kultiviert und in dem Medium wird ein monoklonaler Antikörper hergestellt. Alternativ kann der monoklonale Antikörper in großem Maßstab hergestellt werden, indem die oben geschriebenen Hybrid-Myelomzellen in vivo kultiviert werden, z.B. in der Bauchhöhle von Mäusen. Als Zellen für die Zellfusion können Lymphknotenzellen und Lymphozyten in peripherem Blut ebenso wie Milzzellen verwendet werden. Die Myelom-Zelllinie stammt vorzugsweise von derselben Zelllinie wie diejenigen, die aus einer heterologen Ziellinie stammen, so dass Hybrid-Myelomzellen erhalten werden, die stabil Antikörper produzieren. Ein Beispiel für den Antikörper ist der G72-Antikörper, wie später in den Beispielen beschrieben wird.

Die Herstellung des mittels des erfindungsgemäßen Herstellverfahrens 2 hergestellten sulfatierten Zuckers kann unter Verwendung des oben beschriebenen Antikörpers überprüft werden. Ein bekanntes immunologisches Verfahren unter Verwendung des Antikörpers kann zur Überprüfung der Herstellung verwendet werden. Solche Verfahren schließen z.B. Immunoblotting, Immunoassays mit Markierungen (z.B. EIA, ELISA, Radioimmunoassay, Fluoroimmunoassay oder ähnliche) ein. Wenn der auf den Zellflächen exprimierte sulfatierte Zucker nachgewiesen werden soll, kann auch Durchflusscytometrie verwendet werden. Selbstverständlich kann der mittels des erfindungsgemäßen Herstellverfahrens 2 hergestellte sulfatierte Zucker mittels bekannter Techniken zur Analyse von Zuckerkettenstrukturen nachgewiesen werden.

Beim erfindungsgemäßen Herstellverfahren 2 kann Fucosyltransferase codierende cDNS gleichzeitig in Zellen eingeschleust werden, wenn die erfindungsgemäße DNS in Zellen eingeschleust wird. So schließt das erfindungsgemäße Herstellverfahren 2 ein Verfahren zur Herstellung sulfatierter Zucker ein, das Schritte des gleichzeitigen Einschleusens von erfindungsgemäßer DNS und Fucosyltransferase codierender cDNS in Zellen und anschließende Kultivierung der Zellen umfasst.

Die einzuschleusende Fucosyltransferase ist nicht besonders eingeschränkt. Es ist bekannt, dass Fucosyltransferase IV durch Übertragung von Fucose auf N-Acetyllactosamin die Lewis-X-Struktur bilden kann (Gal&bgr;1-4(Fuc&agr;1-3)GlcNAc) (J. Biol. Chem. 266, 17467–17477 (1991), Cell 63, 1349–1356 (1990)), und daher wird sie bevorzugt verwendet. Die Fucosyltransferase codierende cDNS kann in einem geeigneten Exprimierungsvektor eingeführt sein und in die Zellen gleichzeitig mit der erfindungsgemäßen DNS eingeschleust werden. Bevorzugte Exprimierungsvektoren sind solche, die für die erfindungsgemäße DNS verwendet werden.

Der mittels dieses Verfahrens hergestellte sulfatierte Zucker wird auf der Zelloberfläche durch das Verfahren exprimiert, bei dem die Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes, der sich am nichtreduzierenden Ende der Zuckerkette befindet, durch die Wirkung des erfindungsgemäßen Polypeptids sulfatiert wird, welches seinerseits dadurch exprimiert wird, dass die erfindungsgemäße DNS in Zellen eingeführt wird, Fucosyltransferase und dann Fucose auf N-Acetyllactosamin durch die Wirkung von Fucosyltransferase übertragen wird, die ihrerseits durch die cDNS exprimiert wird. Der exprimierte sulfatierte Zucker hat mindestens eine Zuckerkettenstruktur der Formel VIII: Gal&bgr;1-4(Fuc&agr;1-3)(SO4-6)GlcNAc-R(VIII),in der -R ein Wasserstoffatom oder ein mittels einer glycosidischen Bindung gebundener Zuckerrest ist. Ein Lipid wie Ceramid kann an das Wasserstoffatom oder den mittels einer glycosidischen Bindung gebundenen Zuckerrest gebunden sein.

Diese Zuckerkettenstruktur wird von monoklonalen Antikörpern erkannt, die spezifisch mit einer 6-sulfatieren Lewis-X-Struktur (Gal&bgr;1-4(Fuc&agr;1-3)(SO4-6)GlcNAc; 6-SulfoLeX) reagieren, aber nicht einer Lewis-X-Struktur (Gal&bgr;1-4(Fuc&agr;1-3)GlcNAc; LeX) oder mit einer 6'-sulfatierten Lewis-X-Struktur (SO4-6)Gal&bgr;1-4(Fuc&agr;1-3)GlcNAc; 6'-Sulfo-LeX). Solche Antikörper können mittels gewöhnlicher Verfahren zur Herstellung von Antikörpern unter Verwendung von 6-sulfatierem Lewis-X-Ceramid (Gal&bgr;1-4(Fuc&agr;1-3)(SO4-6)GlcNAc&bgr;1-3Gal&bgr;1-4Glc&bgr;1-Cer) hergestellt werden. Die Antikörper sind vorzugsweise monoklonale Antikörper.

Die monoklonalen Antikörper können mittels des oben beschriebenen Verfahrens hergestellt werden. Ein für die Immunisierung vorzugsweise zu verwendendes Antigen ist 6-sulfatierers Lewis-X-Ceramid, das an Bakterienzellen wie Salmonella minnesota adsorbiert ist.

Unter den mittels des oberen Verfahrens hergestellten Hybrid-Myelomzellen werden die Ziellinien ausgewählt, die einen Antikörper produzieren, der spezifisch mit 6-sulfatierten Lewis-X-Strukturen reagiert aber nicht mit 6'-sulfatierten Lewis-X-Strukturen. Ein monoklonaler Antikörper wird im Medium erhalten, indem die so ausgewählte Zelllinie in einem geeigneten Medium kultiviert wird. Alternativ kann der monoklonale Antikörper in großem Maßstab hergestellt werden, indem die oben geschriebenen Hybrid-Myelomzellen in vivo kultiviert werden, z.B. in der Bauchhöhle von Mäusen. Die für die Zellfusion zu verwendenden Zellen sind dieselben, wie die oben beschriebenen.

Ein Beispiel für den Antikörper ist der AG223-Antikörper, wie später in den Beispielen beschrieben wird.

Die Herstellung des mittels dieses Verfahrens hergestellten sulfatierten Zuckers kann unter Verwendung des oben beschriebenen Antikörpers überprüft werden. Ein bekanntes immunologisches Verfahren unter Verwendung des Antikörpers kann zur Überprüfung der Herstellung verwendet werden. Selbstverständlich kann der hergestellte sulfatierte Zucker mittels bekannter Techniken zur Analyse von Zuckerkettenstrukturen nachgewiesen werden. Diese Verfahren sind die oben beschriebenen.

Die so erhaltenen Zuckerketten der Formeln VII und VIII können als Zwischenprodukte zur Herstellung von z.B. GlyCAM-1 oder seiner Zuckerhauptkettenstruktur verwendet werden.

Das erfindungsgemäße Polypeptid ist ein N-Acetylglucosamin-6-O-sulfotransferase-Polypeptid, das die Aktivität hat, spezifisch einen Sulfatrest auf eine Hydroxylgruppe in der 6-Stellung eines N-Acetoglucosaminrestes, der sich am nichtreduzierenden Ende einer Zuckerkette befindet, zu übertragen. Daher ist es zur Synthese funktioneller Zuckerketten wie GlyCAM-1 nützlich (von denen erwartet wird, dass sie als entzündungshemmender Wirkstoff oder ähnliches verwendbar sind). Die erfindungsgemäße DNS kann zur Synthese des erfindungsgemäßen Polypeptids in großem Maßstab und künstlicher Exprimierung funktioneller Zuckerketten wie GlyCAM-1 in lebenden Organismen (Zellen) verwendet werden.

Die erfindungsgemäßen Verfahren 1 und 2 sind als Verfahren zur Herstellung funktioneller Zuckerketten wie GlyCAM-1 oder ihrer synthetischen Zwischenprodukte nützlich.

Beschreibung der bevorzugten Ausführungsform

Im Folgenden wird die Erfindung spezifischer mit Bezug auf Beispiele beschrieben.

<1> Gewöhnlich in den Beispielen verwendete Materialien und Verfahren (1) Materialien

35S-PAPS (3'-Phosphoadenosin-5'-phosphosulfat, 58,1 GBq/mmol) stammte von DuPont NEN; 3H-Na-BH4 (16,3 GBq/mmol) und &agr;-32P-dCTP (110 GBq/nmol) von Amersham; Chondroitinsulfat A (Walgerippe), Chondroitinsulfat C (Haifischknorpel), Dertansulfat, vollständig desulfatiertes und am Stickstoff resulfatiertes Heparin (CDSNS-Heparin) und Streptococcus-&bgr;-galactosidase von der Seikagaku Corporation, ummarkiertes PAPS, Muzin aus Schweinemagen und Muzin aus submandibulären Rinderdrüsen von Sigma, Hiload Superdex 30 HR 16/60 und die schnell entsalzende Säule HR 10/10 von Pharmacia Biotech; Partisil SAX-10 von Whatman, die 5'-STRETCH PLUS &lgr;gtII-cDNS-Sammlung 7 Tage alter Mäuseembyonen von CLONTECH und der Anti-Lewis-X-Antikörper LeuM1 von Becton Dickinson.

Keratansulfat aus Rinderhornhaut und Gal&bgr;1-4GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc (hier manchmal als „L1L1" bezeichnet) stammten von der Seikagaku Corporation. Teilweise desulfatiertes Keratansulfat (Sulfat/Glucosamin = 0,62) wurde wie beschrieben aus Keratansulfat aus Hornhaut hergestellt (J. Biol. Chem., 272, 32321–32328 (1997), J. Biochem. (Tokyo) 86, 1323–1329 (1979)).

GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc wurde aus L1L1 mittels Abbau durch &bgr;-Galactosidase hergestellt. Das Reaktionsgemisch zum Abbau durch &bgr;-Galactosidase enthielt 2 mg L1L1, 5 &mgr;mol Natriumacetatpuffer, pH 5,5 und 40 mU Enzym in einem Endvolumen von 100 &mgr;L (J. Biochem (Tokyo) 80, 9–17 (1976)). Das Reaktionsgemisch wurde 24 Stunden lang bei 37°C inkubiert. Nach dem Abbau mit &bgr;-Galactosidase wurde GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc mittels Superdex-30-Chromatographie gereinigt und mittels Gefriertrocknen entsalzt. Gal&bgr;1-4-3H-(SO4-6)-2,5-Anhydromannitol wurde aus Keratansulfat mittels einer Reaktionsfolge aus N-Deacetylierung, Deaminierung, Reduktion mit NaB3H4 und partieller saurer Hydrolyse erhalten (Glycobiology, 6, 51–57 (1996), Biochem J. 235, 225–236 (1986)).

Die Struktur der in den folgenden Beispielen verwendeten synthetischen Glycolipide war folgendermaßen: Sialyl-Lewis-Ceramid = NeuAc&agr;2-3Gal&bgr;1-4(Fuc&agr;1-3)GlcNAc&bgr;1-3Gal&bgr;1-4Glc&bgr;1-Cer; 6-Sulfo-Sialyl-Lewis-X-Ceramid = NeuAc&agr;2-3Gal&bgr;1-4(Fuc&agr;1-3)(SO4-6)GlcNAc&bgr;1-3Gal&bgr;1-4Glc&bgr;1-Cer; 6'-Sulfo-Sialyl-Lewis-X-Ceramid = NeuAc&agr;2-3(SO4-6)Gal&bgr;1-4(Fuc&agr;1-3)GlcNAc-&bgr;1-3Gal&bgr;1-4Glc&bgr;1-Cer; 6,6'-Bissulfo-Sialyl-Lewis-X-Ceramid = NeuAc&agr;2-3(SO4-6)Gal&bgr;1-4(Fuc&agr;1-3)(SO4-6)GlcNAc-&bgr;1-3Gal&bgr;1-4Glc&bgr;1-Cer (Carbohydr. Res., 209, c1–c4 (1991), Carbohydr. Res., 285, c1–c8 (1996), J. Med. Chem., 39, 1339–1343 (1996)). Diese Glycolipide wurden großzügigerweise von Dr. Makoto Kiso, Fakultät für Ackerbau, Gifu-Universität, zur Verfügung gestellt. Die Asialo-Verbindungen wurden aus den korrespondierenden synthetischen Glycolipiden durch Abbau mit Neuraminidase von Artheobacter ureafaciens (Nakarai Tresque Co.) hergestellt. Die sialylierten Paragloboside (NeuAc&agr;2-3Gal&bgr;1-4GlcNAc-&bgr;1-3Gal&bgr;1-4Glc&bgr;1-Cer und NeuAc&agr;2-6Gal&bgr;1-4GlcNAc-&bgr;1-3Gal&bgr;1-4Glc&bgr;1-Cer) wurden aus humanem Darm- und Leberkrebsgewebe hergestellt. NeuAc&agr;2-3Gal&bgr;1-4(SO4-6)GlcNAc-&bgr;1-3(SO4-6)Gal&bgr;1-4(SO4-6)GlcNAc (hier manchmal als „SL2L4" bezeichnet) und GlcNAc-&bgr;1-3Gal&bgr;1-4GlcNAc-&bgr;1-3Gal&bgr;1-4GlcNAc wurden großzügigerweise von Dr. Keiichi Yoshida (Seikagaku Corporation) zur Verfügung gestellt. Letzteres wurde durch reduktive Aminierung an Cholesterin gekoppelt (Blood, 82, 2797–2805 (1993)).

(2) Isolierung der erfindungsgemäßen DNS (2-1) Isolierung von erfindungsgemäßer von Mäusen stammender DNS

Eine von Mäusen exprimierte Gen-Markierungs-Sequenz (EST) (Hinterlegungsnummer der Genbank AA103962) mit einer Ähnlichkeit zum katalytischen Teil von Maus-Chondroitin-6-sulfotransferase wurde mittels des RT-PCR-Verfahrens unter Verwendung von Total-RNS von 13 Tagen alten Mausembryonen als Templat angereichert. Der gleichgerichtete Primer, GTCGTCGGACTGGTGGACGA (SEQ ID Nr. 5) und der gegengleiche Primer, CCCAGAGCGTGGTAGTCTGC (SEQ ID Nr. 6) wurden zur PCR-Anreicherung verwendet, die bei 94°C 3 Minuten lang, mit 35 Zyklen von 0,5 Minuten bei 94°C, 60°C 1 Minute lang und 72°C 1 Minute lang durchgeführt wurde. Das PCR-Produkt (368 bp) wurde mit einem MegaprimeTM-Kit mit markierter DNS (Amersham Co.) 32P-markiert und zum Screening der &lgr;gtII-cDNS-Sammlung 7 Tage alter Mäuseembryonen- verwendet.

Die Hybridisierung wurde wie beschrieben durchgeführt (J. Biol. Chem., 270, 18575–18580 (1995)). Ein DNS-Einschub wurde aus positiven &lgr;gtII-Klonen mittels Abbau mit EcoRI isoliert und in pBluescriptIISK-(STRATAGENE Co.) subkloniert. Dann wurde die Nukleotidsequenz mittels des Verfahrens des Abbruchsvon Dideoxi-Ketten unter Verwendung eines automatischen Sequenzbestimmers von Applied Biosystems bestimmt (Proc. Natl. Acad. Sci. USA, 74, 5463–5467 (1977)).

(2-2) Isolierung von erfindungsgemäßer von Menschen stammender DNS

Die oben erhaltene erfindungsgemäße von Mäusen stammende DNS wurde mit einem DNS-markierenden Megaprimesystem (Amersham Co.) 32P-markiert. Unter ihrer Verwendung als Sonde wurde die cDNS aus dem Gehirn menschlicher Föten enthaltende &lgr;gtII-Sammlung (CLONTECH Co.) gescreent. Die Hybridisierung wurde wie beschrieben durchgeführt (J. Biol. Chem., 272, 32321–32328 (1997)).

Ein DNS-Einschub wurde aus positiven &lgr;gtII-Klonen mittels Abbau mit EcoRI isoliert und in pBluescriptIISK-(STRATAGENE Co.) subkloniert. Dann wurde die Nukleotidsequenz mittels des Verfahrens für die oben beschriebene von Mäusen stammende erfindungsgemäße DNS bestimmt.

(3) Aufbau von Exprimierungsvektoren

Ein das offene Leseraster des erfindungsgemäßen Peptids kodierendes cDNS-Fragment (die von Mäusen stammende erfindungsgemäße DNS) wurde mittels PCR unter Verwendung des klonierten cDNS-Fragments von Mäusen als Templat angereichert.

Der gleichgerichtete Primer, ACGAATTCGGGATGAAGGTATTTCGCAGG (SEQ ID Nr. 7 und der gegengleiche Primer, ATGAATTCTCAAAGCCGGGGCTTCCTGAG (SEQ ID Nr. 8) wurden zur PCR-Anreicherung verwendet, die bei 94°C 3 Minuten lang, mit 35 Zyklen eine Minute lang bei 94°C, 60°C 1 Minute lang und 72°C 2 Minuten lang in 5% (V/V) Dimethylsulfoxid durchgeführt wurde. Das PCR-Produkt einschließlich des offenen Leserasters des erfindungsgemäßen Polypeptids (Nukleotide Nummern 467 bis 1921 in SEQ ID Nr. 1) wurde mit EcoRI abgebaut und in einen pcDNS3-Exprimierungsvektor subkloniert (Invitrogen Co.). Rekombinante Plasmide, die das DNS-Fragment, pcDNS3-GlcNAc6ST, in korrekter Ausrichtung enthielten, wurden für die Exprimierung verwendet. Die das DNS-Fragment, pcDNS3-GlcNAc6STA, in inverser Ausrichtung enthaltenden rekombinanten Plasmide wurden für Vergleichsversuche verwendet.

Ein Exprimierungsvektor wurde auf dieselbe Weise wie oben beschrieben unter Verwendung der vom Menschen stammenden erfindungsgemäßen DNS aufgebaut. Zunächst wurde unter Verwendung von CTGAATTCGGAATGAAGGTGTTCCGTA (SEQ ID Nr. 9) und GAGAATTCTTAGAGACGGGGCTTCCGA (SEQ ID Nr. 10) als Primer und dem geklonten humanen cDNS-Fragment als Templat PCR durchgeführt, um PCR-Produkte herzustellen (Nukleotide Nummer 387 bis 1844 in SEQ ID Nr. 3), die ein offenes Leseraster des erfindungsgemäßen Polypeptids enthielten. Die PCR-Produkte wurden mit EcoRI abgebaut und in einen pcDNS3-Exprimierungsvektor subkloniert. Ein rekombinantes Plasmid (pcDNS3-hGlcNAc6ST), das das DNS-Fragment in korrekter Ausrichtung enthielt, wurde für die Exprimierung verwendet, während ein rekombinantes Plasmid (pcDNS3-hGlcNAc6STA), das das DNS-Fragment in inverser Ausrichtung enthielt, für Vergleichsversuche verwendet wurde.

Ein zuvor geklontes 1544bp-Fragment des Maus-FucosyltransferaseIV-Gens (J. Biochem. (Tokyo), 119, 302–308 (1996)) wurde in die BamHI- und EcoRI-Stellen des pcDNS3-Exprimierungsvektors wie oben beschrieben subkloniert. Das rekombinante, das DNS-Fragment in korrekter Ausrichtung enthaltende Plasmid, pcDNS3-FucTIV, wurde verwendet.

(4) Transiente Exprimierung der erfindungsgemäßen DNS in COS-7-Zellen

In COS-7-Zellen (3 × 106 Zellen in einem 10 cm Gefäß, von der Riken-Zell-Bank) wurden 15 &mgr;g Exprimierungsplasmid mittels des DEAE-Dextran-Verfahrens eingeschleust (Aruffo, A. (1991) in Current Protocols in Molecular Biology, Supplement 14, Einheit 16.13, Greene Publishing Associates und Wiley InterScience, New York). Nach 65 stündiger Kultivierung in einem Dulbecco-modifizierten minimalem essentiellen Medium, das 10% fötales Kalbsserum enthielt, wurden die Zellen mit phosphatgepufferter physiologischer Kochsalzlösung gewaschen (PBS) und von den Gefäßen gekratzt. Diese Zellen wurden gewonnen und mit einem Dounce Homogenisiergerät in 1,5 mL/Gefäß 0,25 M Sucrose, 10 mM Tris-HCl, pH 7,2 und 0.5% Triton X-100 homogenisiert. Die Homogenisate wurden bei 10 000 × g 15 Minuten lang zentrifugiert und der Überstand wurde gewonnen. Dieser Überstand wird im Folgenden als „Extrakt" bezeichnet. Für eine FACS-Analyse (Fluoreszenzaktivierter Zellensortierer) wurden die Zellen mit der eingeschleusten DNS 48 Stunden lang kultiviert, in 25 cm3 Kultivierungskolben überführt (3 × 105 Zellen pro Kolben) und weitere 36 Stunden kultiviert.

(5) Sulfotransferaseaktivitätsassay bei Substraten mit großer Molmasse

Die Sulfotransferaseaktivität wurde unter Verwendung verschiedener Glycosaminoglycane als Substrate (Akzeptoren) wie beschrieben untersucht (J. Biol. Chem., 272, 32321–32328 (1997)). Wenn als Akzeptoren Muzine verwendet wurden, wurde eine Reaktionsmischung aus 2,5 &mgr;mol Imidazol-HCl, pH 6,8, 0,25 &mgr;mol CaCl2, 0,1 &mgr;mol Dithiothreitol, 0,1 &mgr;mol NaF, 0,1 &mgr;mol AMP, 2,0 &mgr;mol Muzine, 50 pmol 35S-PAPS (etwa 5,0 × 105 cpm) und 5 &mgr;L der Extrakte in einem Endvolumen von 50 &mgr;L bei 37°C eine Stunde lang inkubiert. Nach dem Isolieren mit einer Schnellentsalzungssäule wurde die in den Muzinen vorhandene Radioaktivität bestimmt.

(6) Sulfotransferaseaktivitätsassay bei Oligosacchariden

Die Reaktionsmischung enthielt 25 &mgr;mol Imidazol-HCl, pH 6,8, 0,5 &mgr;mol MnCl2, 0,1 &mgr;mol AMP, 1,0 &mgr;mol NaF, 25 nmol Oligosaccharide, 50 pmol 35S-PAPS (etwa 5,0 × 105 cpm) und 5 &mgr;L der Extrakte in einem Endvolumen von 50 &mgr;L. Das Reaktionsgemisch wurde bei 30°C 5 Stunden lang inkubiert und die Reaktion wurde beendet, indem die Reaktionsröhrchen eine Minute lang in ein kochendes Wasserbad gebracht wurden 35S-markierte Oligosaccharide wurden von 35SO4 und 35S-PAPS mittels Superdex 30-Gelchromatographie abgetrennt und die Radioaktivität wurde bestimmt. Wenn als Akzeptor GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc verwendet wurde, fand die Sulfotransferasereaktion unter den Assay-Bedingungen bis zu 5 Stunden lang linear statt.

(7) Superdex 30-Chromatographie, Papierelektrophorese, Papierchromatographie, HPLC und TLC

Eine Hiload Superdex 30 16/60-Säule wurde mit 0,2 M NH4HCO3 äquilibriert. Die Durchflussgeschwindigkeit betrug 1 mL/min. Ein mL-Fraktionen wurden gewonnen und mit 4 mL Cleasol (Nakari Tesque Co.) vermischt und die Radioaktivität bestimmt. Die Oligosaccharide wurden mittels der Absorption bei 210 nm untersucht. Mit einem Whatman Nr. 3-Papier (2,5 × 57 cm) wurde in Pyridin/Essigsäure/Wasser (1:10:400 bezogen auf Volumen) 40 min lang eine Papierelektrophorese durchgeführt: Proben für die Papierchromatographie wurden auf ein Whatman Nr. 3-Papier getropft (2,5 cm × 57 cm) und mit 1-Butanol/Essigsäure/1M NH4OH (3:2:1, bezogen auf Volumen) entwickelt. Die getrockneten Papierstreifen nach der Papierelektrophorese oder der Papierchromatographie wurden in 1.25 cm große Segmente geschnitten und die Radioaktivität wurde mittels Zählen mit einem Flüssigkeitsszintigraphen bestimmt. Eine HPLC-Analyse des 35S-markierten Produkts, das aus 35S-sulfatiertem GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc erhalten wurde, wurde mit einer Partisil SAX-10-Säule (4,5 mm × 25 cm), die mit 5 mM KH2PO4 äquilibriert war, durchgeführt. Die Säule wurde mit 5 mM KH2PO4 entwickelt. Die Fließgeschwindigkeit betrug 1 mL/min und die Säulentemperatur 40°C. 0,5 mL-Fraktionen wurden gewonnen und mit 4 mL Clearsol vermischt und die Radioaktivität bestimmt. TLC wurde auf Aluminiumplatten durchgeführt, die 0,1 mm dick mit Cellulose beschichtet waren (Merck Co.), in Ethylacetat/Pyridin/Tetrahydrofuran/Wasser/Essigsäure (50:22:15:15:4, bezogen auf Volumen) (Biochem. J. 319, 209–216 (1996)).

(8) Deacetylierung, Deaminierung und Reduktion mit NaBH4 des 35S-markierten sulfatierten GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc

35S-markiertes GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc wurde unter Verwendung des exprimierten erfindungsgemäßen Polypeptids (2,1 &mgr;g als Protein im Extrakt), so wie oben beschrieben, mit der Ausnahme, dass die Konzentration von 35S-PAPS 6-fach erhöht worden war und die Inkubierung 25 Stunden lang durchgeführt wurde. Das von der Superdex 30-Säule eluierte 35S-markierte sulfatierte GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc wurde gefriergetrocknet, mittels Papierelektrophorese gereinigt und mit 70% Hydrazin, das 1,0% Hydrazinsulfat enthielt, bei 95°C 6 Stunden lang deacetyliert (Anal. Biochem. 176, 96–104 (1989)). Die deacetylierten Stoffe wurden mittels Superdex 30-Chromatographie gereinigt, Deaminierung mit Salpetriger Säure bei pH 4 unterzogen und mit NaBH4 reduziert (Biochem. J. 235, 225–236 (1986)). Schließlich wurde die Probe in 60 &mgr;L Wasser gelöst und einer Papierchromatographie unterzogen.

(9) Immunologische Verfahren

Eine Hybridom-Zelllinie, AG223, die den monoklonalen Murin IgM-Antikörper (AG223) ausscheidet, der mit 6-Sulfo-Lewis-X (Gal&bgr;1-4(Fuc&agr;1-3)(SO4-6)GlcNAc) reagiert, wurde entsprechend des von Köhler und Milstein (Nature 256, 495–497 (1975)) beschriebenen Verfahrens erzeugt und anschließend dazu verwendet, Anti-Kohlenhydrat-Antikörper herzustellen (Kannagi, R., und Hakomori, S. (1986) in: Handbook of Experimental Immunology, Vol. 4, Applications of Immunological Methods in Biomedical Sciences (Weir, D. M., Herzenberg L., Blackwell, C., und Herzenberg, L. A., Herausgeber, S 117.1–117.20, Blackwell Scientific Publ. Inc., Boston).

Kurz zusammengefasst wurde 6-Sulfo-Lexis-X-Ceramid (Gal&bgr;1-4(Fuc&agr;1-3)(SO4-6)GlcNAc&bgr;1-3Gal&bgr;1-4Glc&bgr;1-Cer an einen Salmonella minnesota R595-Stamm adsorbiert und zur wiederholten intraperitonealen Immunisierung von BALB/c-Mäusen verwendet, am Tag 0 (5 &mgr;g Glycopeptid) am Tag 3 (10 &mgr;g), Tag 7 (15 &mgr;g), Tag 12 (20 &mgr;g) Tag 17 (25 &mgr;g) und Tag 31 (35 &mgr;g). Drei Tage nach der letzten Immunisierung wurden die Milzzellen gewonnen und mit Maus-Myelom p3/X63-Ag8U1 fusioniert. Dasselbe Glycolipid wurde als Antigen in ELISA verwendet, wie es als Hybidomkultur-Überstand für die Klonierungsverfahren verwendet wurde. ELISA wurde unter Verwendung von Glycolipid-Antigenen, die am Boden von 96-Loch Kultivierungsplatten immobilisiert worden sind, mittels des Standard-Verfahrens (Hakomori S, und Kannagi, R., (1986) in: Handbook of Experimental Immunology, Vol. 1, Immunochemistry (Weir, D. M., Herzenberg L., Blackwell, C., und Herzenberg, L. A., Herausgeber, S. 9.1–9.39, Blackwell Scientific Publ. Inc., Boston) durchgeführt. Peroxidase-konjugierte Ziegen-Anti-Maus IgM (&mgr;-Kettenspezifisch, Cappel Inc.) wurde als sekundärer Antikörper verwendet. Eine Hybridom-Zelllinie, die den monoklonalen Murin IgM-Antikörper (G72) absondert, der mit der 6-Sulfo-Sialyl-N-acetyllactosaminstruktur (NeuAc&agr;2-3Gal&bgr;1-4(SO4-6)GlcAc) reagiert, wurde auf ähnliche Weise unter Verwendung von 6-Sulfo-Sialyl-Lewis-X-Ceramid hergestellt.

Monoklonaler IgM-Maus-Antikörper (G152), der mit 6-sulfatiertem Sialyl-Lewis-X-Ceramid reagiert aber nicht mit 6'-sulfatiertem Sialyl-Lewis-X-Ceramid, 6,6'-bissulfatiertem Sialyl-Lewis-X-Ceramid, 6-sulfatiertem Lewis-X-Ceramid, Lewis-X-Ceramid oder Ähnlichen (und so das 6-sulfatierte Sialyl-Lewis-X-Ceramid-Antigen erkennt) wurde unter Verwendung von 6-sulfatiertem Sialyl-Lewis-X-Ceramid als Antigen mittels des in J. Biol. Chem. 273, 11225–11233 beschriebenen Verfahrens hergestellt.

Der CSLEX-1 monoklonale Antikörper (Cancer Res. 44., 5279–5285 (1984), der mit dem Sialyl-Lewis-X-Antigen reagiert) wurde zum Nachweis von Sialyl-Lewis-X-Antigen verwendet.

Die Exprimierung von antigenen Epitopen auf der Zellenoberfläche wurde mittels FACS überwacht, wie in Biochem. Biophys. Res. Commun., 230, 546–551 (1997) beschrieben, unter Verwendung eines FACScan-Gerätes (Becton Dickinson Co.).

(10) Nothern und genomische Southern Blot-Analysen (10-1) Maus

Aus C57/BL/6J-Mausgewebe wurde (20 &mgr;g) wurde Total-RNS wie beschrieben, hergestellt (Anal. Biochem. 162, 156–159 (1987)). Genom-DNS (10 &mgr;g), die aus Murin-D3-Embryonenstammzellen hergestellt wurde (J. Embryol. Exp. Morphol.), 87, 27–45 (1985)) wurde 4 Stunden lang mit geeigneten Restriktionsenzymen abgebaut. Die radioaktive Sonde war dieselbe, wie die, die zum Screening cDNS-Sammlung –7 Tage alter Mäuseembryonen verwendet wurde. Die Blots wurden bei 55°C in 2 × SSPE, 0,1% SDS und schließlich in 0,1 × SSPE, 0,1% SDS bei 55°C gewaschen. Die Membranen wurden einer BAS-Bildplatte ausgesetzt und dann wurde die Radioaktivität auf der Membran mit einem BAS 2000 Strahlungsbildanalysegerät (Fuji-Film Co.) bestimmt.

(10-2) Mensch

Total-RNS wurde aus menschlichem Gewebe auf dieselbe Weise wie unter (10-1, oben) hergestellt. Das Bpu1102 I-BamHI 368 bp-Fragment (Nukleotide Nummern 910 bis 1277 in SEQ ID Nr. 3) der erfindungsgemäßen vom Menschen stammenden DNS wurde als Sonde verwendet. Das Blotting wurde auf dieselbe Weise wie unter (10-1) oben durchgeführt.

(11) In-situ-Hybridisierung

Proben von C57 BL/6J von Mäusen wurden der Anfärbung mit Hämatoxylin-Eosin oder der in-situ-Hybridisierung unterzogen. Als Sonde für das erfindungsgemäße Polypeptid wurde ein 0,6 kbp Pst I-Fragment der cDNS (Nukleotide Nr. 962 bis 1561 in der SEQ ID Nr. 1) in pBluescript II SK-subkloniert. Gleichgerichtete und entgegengesetzt gerichtete cRNS-Sonden wurden durch in vitro-Transkription mit einem DIG RNS-Markierungsset hergestellt (Boehringer Mannheim Co., Deutschland).

(12) Fluoreszenz-in situ-Hybridisierungsanalyse

Die Fluoreszenz in situ-Hybridisierungsanalyse (FISH) wurde entsprechend des in Genomics, 17, 514–515 (1993) beschriebenen Verfahrens unter Verwendung der vom Menschen stammenden erfindungsgemäßen DNS (Nukleotide Nummer 1 bis 2409 in der SEQ ID Nr. 3) als Sonde verwendet.

<Ergebnisse> (1) Klonen der erfindungsgemäßen RNS

Maus-Chondroitin-6-sulfatotransferase ist bereits geklont worden. Durch Durchsuchen der EST-Datenbank fanden wir eine kleine Sequenz mit einer Ähnlichkeit zum katalytischen Teil von Maus-Chonroitin-6-sulfotransferase (Hinterlegungsnummer bei der Genbank: AA103962). Wir erhielten das korrespondierende cDNS-Fragment mittels RT-PCR (Nukleotide Nummer 1139 bis 1506 in der SEQ ID Nr. 1). Ungefähr 8 × 105 Plättchen einer cDNS-Sammlung von 7 Tage alten Mäuseembryonen wurden unter Verwendung des cDNS-Fragments als Sonde gescreent und sechs unabhängige Klone wurden erhalten. Die Nukleotidsequenz des größten cDNS-Einschubs (2.2 kb) wurde bestimmt (SEQ ID Nr. 1). Die bestimmte 2150-bp cDNS hatte ein einzelnes offenes, aus 483 Aminosäuren bestehendes Leseraster mit einer Molmasse von 52829 Da und vier potentiellen N-verknüpften Glycosylierungsstellen (SEQ ID Nr. 1). Die Sequenz um das erste ATG-Kodon erfüllte die Regel von Kozak (Cell, 44, 283–292 (1986)), und der up-stream-Bereich enthielt ein Stop-Kodon im Raster. Eine Analyse der Auftragung der Hydrophobie belegte die Gegenwart eines prominenten hydrophoben Segmentes mit einer Länge von 20 Aminosäuren im Bereich des Aminoendes (Ala8-Leu27) und sagt voraus, dass das erfindungsgemäße Polypeptid ein Typ II-Transmembranprotein ist (1). Das erfindungsgemäße Polypeptid zeigte eine 25%ige und 28%ige Homologie mit Maus-Chontdroitin-6-sulfotransferase und menschlicher Keratansulfat-Gal-6-sulfotransferase, respektive. Es wurde jedoch keine signifikante Homologie bei der Aminosäuresequenz zwischen dem Protein und anderen bekannten Sulfattransferasen beobachtet (J. Biol. Chem., 267, 15744–15750 (1992), J. Biol. Chem., 272, 13980–13985 (1997), J. Biol. Chem., 272, 28008–2809 (1997), J. Bio. Chem., 272, 29942–29946 (1997), J. Biol. Chem., 272, 4864–4868 (1997)).

Die vom Menschen stammende erfindungsgemäße DNS (SEQ ID Nr. 3) wurde durch Screenen der &lgr;gtII-Sammlung erhalten, die cDNS vom Gehirn menschlicher Föten enthält, unter Verwendung der durch die SEQ ID Nr. 1 repräsentierten DNS. Die erhaltene DNS bestand aus 2409 bp und enthielt ein einzelnes offenes Leseraster, das aus 484 Aminosäureresten besteht (SEQ ID Nr. 3). Eine Analyse der Auftragung der Hydrophobie legt nahe, dass das Polypeptid ein Typ II-Transmembranprotein ist, das in der Aminoendregion eine Transmembrandomäne hat.

Die Sequenz in der Nähe des ersten ATG-Kodons stimmte mit der Regel von Kozak überein (Cell, 44, 283–292 (1986)).

Ein anderes ATG-Kodon existiert 41 Nukleotidnummern upstream vom ersten ATG-Kodon. Die Sequenz in der Nähe von diesem Kodon erfüllte ebenfalls die Regel nach Kozak. Dieses ATG-Kodon wurde auch in der korrespondierenden Position der erfindungsgemäßen von Mäusen stammenden DNS gefunden. Es gibt weder bei der von Mäusen noch die der von Menschen stammenden DNS ein Abbruchkodon zwischen dem ersten ATG-Kodon und diesem ATG-Kodon. Daher können beide oben genannten Kodone in der erfindungsgemäßen DNS als Initierungskodon wirken.

Die von der erfindungsgemäßen DNS der SEQ ID Nr. 1 codierete Aminosäuresequenz des Polypeptids und die von der erfindungsgemäßen DNS der SEQ ID Nr. 3 codierte Aminosäuresequenz des Polypeptids werden durch die SEQ ID Nr. 2 und die SEQ ID Nr. 4, respektive, dargestellt. SEQ ID Nr. 2 und SEQ ID Nr. 4 sind zu 85% oder darüber homolog.

(2) Exprimierung des erfindungsgemäßen Polypeptids von der erfindungsgemäßen DNS

Die erfindungsgemäße DNS, von der der Großteil der nicht-kodierenden 5'- und 3'-Bereiche entfernt worden waren (Nukleotide Nummern 467 bis 1921 in SEQ ID Nr. 1) wurde in einen Säugetierexprimierungsvektor pcDNS3 eingeschleust und in COS-7-Zellen überexprimiert. Extrakte der Zellen mit der eingeschleusten DNS wurden im Hinblick auf ihre Sulfotransferaseaktivität unter Verwendung von 35S-markiertem PAPS als Sulfatgruppen-Donor und verschiedenen Glycokonjugaten als Sulfatgruppenakzeptoren untersucht: Chondroitin, Chondroitin-4-sulfat, Chondroitin-6-sulfat, Dermatansulfat, Keratansulfat, desulfatiertes Keratansulfat, CDSNS-Heparin, Muzin aus Schweinemagen und Muzin aus submandibulären Rinderdrüsen dienten nicht als Akzeptoren. Es wurde GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc als Sulfatgruppenakzeptor untersucht. Superdex 30-Chromatographie des Reaktionsgemisches zeigte tatsächlich einen radioaktiven Peak in den Zellen, in die ein Vektor (pcDNS3-GlcNAc6ST) eingeschleust worden war, der die cDNS in korrekter Orientierung (gleichgerichtete DNS) enthielt, die etwas größer als der Akzeptor war und damit anzeigte, dass der Akzeptor sulfatiert worden war (2A). Der Extrakt von Zellen ohne eingeschleuste DNS oder solchen, in die ein Vektor (pcDNS3-GlcNAc6STA) eingeschleust worden war, der die cDNS in entgegengesetzter Orientierung (entgegengesetzt gerichtete cDNS) enthielt, zeigte wesentlich geringere Sulfotransferaseaktivität (Tabelle 1). Die Aktivität wurde über die Radioaktivität bestimmt, die in Fraktion Nr. 85 bis 89 der Superdex 30-Chromatographie enthalten war (2A). Die dargestellten Werte sind die in Abwesenheit des Akzeptors erhaltenen, subtrahiert von den Werten, die in Gegenwart des Akzeptors erhalten wurden. Die Mittelwerte ± S. D. dreimaliger Kultivierung sind aufgeführt.

Im Gegensatz dazu, diente Gal&bgr;1-4GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc nicht als Akzeptor (2B). Daher wurde bestätigt, dass das erfindungsgemäße Polypeptid eine Sulfatgruppe auf GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc aber nicht auf Gal&bgr;1-4GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc überträgt.

In COS-7-Zellen wurde die erfindungsgemäße DNS, von der der Großteil der nicht-kodierenden 5'- und 3'-Bereiche entfernt worden war (Nukleotide Nr. 387 bis 1844 in SEQ ID Nr. 3) auf die selbe Weise wie oben beschrieben eingeschleust und die Extrakte der resultierenden Zellen mit eingeschleuster DNS wurden auf dieselbe Weise wie oben beschrieben im Hinblick auf ihre Sulfattransferaseaktivität untersucht (unter Verwendung von GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc als einen Sulfatgruppenakzeptor). Ein Ergebnis ist, dass die Zellen, in die der Vektor (pcDNS3-hGlcNAc6ST) eingeschleust worden war, der die cDNS in korrekter Orientierung (gleichgerichtete DNS) enthielt, eine etwa fünffache oder darüber liegende Sulfattransferaseaktivität ausübten wie Zellen ohne eingeschleuste DNS oder solche, in die ein Vektor (pcDNS3-hGlcNAc6STA) eingeschleust worden war, der die cDNS in entgegengesetzter Orientierung (entgegengesetzt gerichtete cDNS) enthielt (Tabelle 2). Die Aktivität wurde über die Radioaktivität der durch Superdex 30-Chromatographie enthalten Fraktionen berechnet. Die dargestellten Werte sind die in Abwesenheit des Akzeptors erhaltenen, subtrahiert von den Werten, die in Gegenwart des Akzeptors erhalten wurden. Die Mittelwerte ± S. D. dreimaliger Kultivierung sind aufgeführt.

(3) Bestimmung der Position, auf die durch das erfindungsgemäße Peptid eine Sulfatgruppe übertragen wird (Verfahren zum Messen der Aktivität des erfindungsgemäßen Polypeptids)

Um die Position zu bestimmen, auf die 35SO4 an GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc übertragen worden war, wurde das radioaktive Produkt mittels einer Reaktionsfolge von N-Deacetylierung, Deaminierung und NaBH4-Reduzierung abgebaut. Nach dem Abbau wurden auf dem Papierchromatogramm zwei radioaktive Produkte nachgewiesen (3A). Der sich schneller bewegende Peak migrierte zur Position von (SO4-6)-2,5-Anhydromannitol. Vom langsamer migrierenden Peak wird angenommen, dass es als Folge unvollständiger Deacetylierung nicht abgebautes Material war, weil der Anteil des sich langsamer bewegenden Peaks abnahm, wenn 35S-markiertes GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc einer verlängerten Hydrazinolysereaktion unterzogen wurde. Wenn der sich schneller bewegende Peak durch HPLC analysiert wurde, wurde 35S-Radioaktivität gemeinsam mit (SO4-6)3H-2,5-Anhydritomanitol eluiert (3B). Die 35S- und die 3H-Radioaktivitäten migrierten auch bei TLC unter Verwendung eines Lösemittelssystems, das 6-Sulfo-2,5-Anhydromannitol von 4-Sulfo- oder 3-Sulfo-2,5-Anhydridomannitol trennen kann, zusammen (Biochem. J., 319, 209–216 (1996)). Diese Ergebnisse zeigen, dass 35SO4 an die 6-Stellung des sich am nicht reduzierenden Ende von GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc befindenden GlcNAc übertragen wurde.

Damit wurde nachgewiesen, dass die geklonte erfindungsgemäße DNS das erfindungsgemäße Polypeptid kodiert.

(4) Exprimierung von sulfatiertem Zucker mittels Einschleusen der erfindungsgemäßen DNS in Zellen

Die Exprimierung eines neuen Antigen-Epitops wurde in COS-7-Zellen untersucht, in die erfindungsgemäße DNS von Mäusen eingeschleust worden war. Zur Analyse der Exprimierung einer sulfatierten Sialyl-N-acetyllactosaminstruktur wurde der G72-Antikörper verwendet. Er reagierte mit 6-Sulfo-Sialyl-Lewis-X-Ceramid ebenso wie mit SL2L4, aber nicht mit 6'-Sulfo-Sialyl Lewis-X-Ceramid oder Sialylparaglobosiden (4), und belegt, dass die für die Reaktivität des Antikörpers mindestens benötige Struktur NeuAc&agr;2-3Gal&bgr;1-4(SO4-6)GlcNAc ist. COS-7-Zellen, in die die erfindungsgemäße DNS eingeschleust worden war, exprimierten das G72 Antigen (5B). Die Zellen ohne eingeschleuste DNS (5A) oder die Zellen, in die entgegengesetzt gerichtete cDNS eingeschleust worden ist (5C) reagierten nicht mit dem Antikörper. Abbau mit Neuraminidase vernichtete die Antigenizität (5E). So ergab sich die Schlussfolgerung, dass das erfindungsgemäße Polypeptid an der Synthese des NeuAc&agr;2-3Gal&bgr;1-4(SO4-6)GlcNAc-Antigens beteiligt ist.

Um weitere Beweise zu erhalten, dass das erfindungsgemäße Polypeptid an der Bildung der 6-Sulfo-N-acetyllactosaminstruktur beteiligt ist, wurde in COS-7-Zellen erfindungsgemäße von Mäusen stammende DNS und cDNS der Fucosyltransferase IV eingeschleust. Vom letztgenannten Enzym ist bekannt, dass es durch Übertragung von Fucose auf N-Acetyllactosamin eine Lewis X-Struktur bilden kann (Gal&bgr;1-4(Fuc&agr;1-3)GlcNAc). (J. Biol. Chem., 266, 17467–17477 (1991), Cell, 63, 1349–1356 (1990)). Um die Veränderung der Zellenoberfläche auf Grund des Einschleusens zu untersuchen, wurde der monoklonale Antikörper AG223 verwendet, der spezifisch mit der 6-Sulfo-Lewis-X Struktur (Gal&bgr;1-4(Fuc&agr;1-3)(SO4-6)GlcNAc) und nicht mit Lewis-X (Gal&bgr;1-4(Fuc&agr;1-3)GlcNAc) oder mit der 6'-Sulfo-Lewis-X Struktur ((SO4-6)Gal&bgr;1-4(Fuc&agr;1-3)GlcNAc) reagierte (4). Einschleusen der erfindungsgemäßen DNS und der cDNS von Fucosyltransferase führte tatsächlich zu Zellen, die positiv auf das 6-Sulfo-Lewis-X-Antigen reagieren (6C), was Zellen, in die nur eine cDNS eingeführt worden war, nicht taten (6A, B). Wenn nur die cDNS von Fucosyltransferase eingeschleust worden war, wurden die Zellen positiv für das Lewis X-Antigen (6D).

Darüber hinaus wurde die Exprimierung neuer Antigen-Epitope in COS-7-Zellen untersucht, in die erfindungsgemäße, vom Menschen stammende DNS eingeschleust worden war.

Die Exprimierung von sulfatiertem Zucker auf der Zelloberfläche wurde auf die selbe Weise wie oben, unter Verwendung des CSLEX-1-Antikörpers untersucht (Cancer Res., 44, 5279–5285 (1984); der mit dem Sialyl-Lewis-Antigen reagiert) und dem G72-Antikörper und dem G152-Antikörper (der mit 6-sulfatierem Sialyl-Lewis-X-Ceramid reagierte, aber nicht mit 6'-sulfatierem Sialyl-Lewis-X-Ceramid, 6,6'-bissulfatierem Sialyl-Lewis-X-Ceramid, 6-sulfatierem Lewis-X-Ceramid, Lewis-X-Ceramid und ähnlichen. Die Ergebnisse sind in 7 dargestellt.

Ein Ergebnis ist, dass Zellen ohne eingeschleuste DNS mit keinem der Antikörper reagierten. Die Zellen, in die ausschließlich cDNS der Fucosyltransferase eingeschleust worden war, reagierten nur mit dem CELEX-1-Antikörper. Die Zellen, in die erfindungsgemäße vom Menschen stammende DNS eingeschleust worden war, reagierten nur mit dem G72-Antikörper. Die Zellen, in die gleichzeitig erfindungsgemäße vom Menschen stammende DNS und cDNS der Fucosyltransferase eingeschleust worden waren, reagierten jeweils mit dem CLSEX-1-Antikörper, G72-Antikörper und G152-Antikörper.

Diese Ergebnisse zeigen, dass sulfatierter Zucker mit einer 6-sulfatierten Sialyl-N-acetyllactosamin-Struktur hergestellt werden konnte, indem die erfindungsgemäße DNS in Zellen eingeschleust wurde, und dass sulfatierter Zucker mit einer 6-sulfatierten Sialyl-Lewis-X-Struktur hergestellt werden konnte, indem gleichzeitig erfindungsgemäße DNS und cDNS der Fucosyltransferase in Zellen eingeschleust wurden.

(5) Northern Blot- und Southern Blot-Analysen

Das Ergebnis der Untersuchung unter Verwendung der Organe erwachsener Mäuse (Kleinhirn, Großhirn, Augapfel, Herz, Lunge, Muskel, Milz, Thymus, Leber, Bauchspeicheldrüse, Niere, Magen, Darm, Uterus, Eierstöcke und Hoden) zeigte, dass das erfindungsgemäße Polypeptid stark in Kleinhirn, Großhirn, Augapfel, Lunge und Bauchspeicheldrüse exprimiert wurde (8A). Schwache Signale wurden auch im Darm, Uterus, Eierstöcken, mesentrischen Lymphknoten und Lymphozyten in peripherem Blut festgestellt (8A). Die Größe des Haupt-Transkrips betrug 3,9 kb. Bei den Southern Blots ließ man eine einzelne Bande mit der Sonde nach Abbau mit EcoRI, RcoRV oder SacI reagieren, was zeigte, dass das erfindungsgemäße Polypeptid ein einzelnes Kopie-Gen war (8B).

Als Ergebnis der Untersuchung menschlicher Gewebe (Herz, Gehirn, Plazenta, Lunge, Leber, Skelettmuskel, Niere, Buchspeicheldrüse, Milz, Thymus, Prostata, Hoden, Eierstock, Darm, Dickdarm, Lymphozyten in peripherem Blut, Magen, Schilddrüse, Rückenmark, Lymphknoten, Luftröhre, Nebenniere und Knochenmark), zeigte sich, dass das erfindungsgemäße Polypeptid stark in Knochenmark, Lymphozyten in peripherem Blut, Milz, Gehirn, Rückenmark, Eierstöcken und Plazenta exprimiert wurde. Ein schwaches Signal wurde in Lymphknoten, Thymus, Herz, Lunge, Luftröhre, Magen, Darm, Dickdarm, Schilddrüse, Prostata und Nebenniere beobachtet. Die Größe des Haupt-Transkrips betrug 3,6 kb.

(6) In-situ-Hybrisierungsanalyse

Eine In-situ-Hybrisierungsanalyse wurde durchgeführt, um die Exprimierungsstellen des erfindungsgemäßen Polypeptids zu bestimmen. Beim Hirn erwachsener Mäuse wurden in den pyramidalen Zellen der CA3-Subregion des Hippocampus, Kleinhirnkern und Purkinje-Zellen starke Signale nachgewiesen. Mäßige Signale wurden in anderen Subregionen einschließlich der CA1-Subregion des Hippocampus, Thalamus-Pontinkern, Geruchstuberkel und Riechkolben nachgewiesen.

Mesenteriale Lymphknoten wurden verwendet, um die Lokalisierung der DNS-Transkripte in Lyphknotengewebe herauszufinden. HEV (Hochgradig endothele Venolen), wo sich der Ligand für L-Selectin befindet (J. Cell Biol., 113, 1213–1221 (1991)) liegen in der Paracordex vor. Sie haben ein überwiegend kubisches Endothel mit ziemlich großen ovalen Kernen und etwas Zytoplasma. Das erfindungsgemäße Polypeptid wurde speziell auf diesen Endothelen exprimiert.

(7) Fluoreszenz-in-situ-Hybrisierungsanalyse

Fluoreszenz-in-situ-Hybrisierungsanalyse wurde durchgeführt, um die Position der vom Menschen stammenden erfindungsgemäßen DNS auf dem Chromosom zu bestimmen. Als Ergebnis wurde gefunden, dass sich die vom Menschen stammende erfindungsgemäße DNS an der Position von Chromosom 7q31 befindet.


Anspruch[de]
Isoliertes Polypeptid gemäß den folgenden (a) oder (b):

(a) Polypeptid, das aus einer durch die SEQ ID Nr. 2 repräsentierten Aminosäuresequenz besteht, oder

(b) Polypeptid, das aus einer Aminosäuresequenz besteht, die eine Mutation von einer oder mehreren Aminosäuren in der Aminosäuresequenz von (a) enthält und das enzymatische Aktivität zur Übertragung einer Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Position eines N-Acetylglucosaminrestes hat, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung.
Isoliertes Polypeptid gemäß den folgenden (a) oder (b):

(a) Polypeptid, das aus einer durch die SEQ ID Nr. 4 repräsentierten Aminosäuresequenz besteht, oder

(b) Polypeptid, das aus einer Aminosäuresequenz besteht, die eine Mutation von einer oder mehreren Aminosäuren in der Aminosäuresequenz von (a) enthält und das enzymatische Aktivität zur Übertragung einer Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Position eines N-Acetylglucosaminrestes hat, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung.
Isoliertes Polypeptid gemäß Anspruch 1 mit folgenden Eigenschaften:

(1) Wirkung: eine Sulfatgruppe wird von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Position eines N-Acetylglucosaminrestes überfragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung;

(2) Substrat-Spezifizität: Eine Sulfatgruppe wird nicht auf Chondroitin, Chontroitin-4-sulfat, Chontroitin-6-Sulfat, Dermatansulfat, Keratansulfat, desulfatiertes Keratansulfat, CDSNS-Heparin, Muzin aus Schweinemagen, Muzin aus submandibulären Rinderdrüsen, und ein Oligosaccharid der Formel II Gal&bgr;1-4GlcNAc&bgr;1-3Gal&bgr;1-4GlcNac(II)übertragen, in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung; und

(3) die N-terminale Aminosäuresequenz umfasst eine Aminosäuresequenz, die durch die Aminosäuren Nr. 1 bis 48 in der SEQ ID Nr. 2 repräsentiert wird.
Isolierte DNS, die ein Polypeptid gemäß den folgenden (a) oder (b) codiert:

(a) Polypeptid, das aus einer durch SEQ ID Nr. 2 repräsentierten Aminosäuresequenz besteht, oder

(b) Polypeptid, das aus einer Aminosäuresequenz besteht, die eine Mutation von einer oder mehreren Aminosäuren in der Aminosäuresequenz von (a) enthält und das enzymatische Aktivität zur Übertragung einer Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Position eines N-Acetoglucosaminrestes hat, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung.
DNS, die eine durch die Nukleotide mit den Nummern 470 bis 1918 in der SEQ ID Nr. 1 repräsentierte Nukleotidsequenz umfasst. Isolierte DNS, die ein Polypeptid gemäß den folgenden (a) oder (b) codiert:

(a) Polypeptid, das aus einer durch die SEQ ID Nr. 4 repräsentierten Aminosäuresequenz besteht, oder

(b) Polypeptid, das aus einer Aminosäuresequenz besteht, die eine Mutation von einer oder mehreren Aminosäuren in der Aminosäuresequenz von (a) enthält und das enzymatische Aktivität zur Übertragung einer Sulfatgruppe von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Position eines N-Acetylglucosaminrestes hat, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung.
DNS, die eine durch die Nukleotide mit den Nummern 390 bis 1841 in der SEQ ID Nr. 3 repräsentierte Nukleotidsequenz umfasst. Verfahren zur Herstellung eines sulfatieren Zuckers der folgenden Formel III: (SO4-6)GlcNAc-R(III)in der GlcNAc einen N-Acetylglucosaminrest darstellt, (SO4-6) bedeutet, dass eine Hydroxylgruppe in 6-Stellung sulfatiert ist und -R ein Wasserstoffatom oder einen Zuckerrest darstellt, der über eine glycosidische Bindung gebunden ist, wobei das Verfahren einen Reaktionsschritt des in irgendeinem der Ansprüche 1 bis 3 beschriebenen Polypeptids mit einer Zuckerkette der Formel IV umfasst: GlcNAc-R(IV)in der GlcNAc einen N-Acetylglucosaminrest repräsentiert und -R ein Wasserstoffatom oder einen Zuckerrest darstellt, der über eine glycosidische Bindung gebunden ist. Verfahren zur Herstellung eines sulfatieren Zuckers, das einen Gentransfer einer Zelle mit der in irgendeinem der Ansprüche 4 bis 7 beschriebenen DNS und anschließende Kultivierung der besagten Zelle umfasst. Verfahren zur Herstellung eines in Anspruch 9 beschriebenen sulfatieren Zuckers, das einen gleichzeitigen Gentransfer einer Zelle mit der in irgendeinem der Ansprüche 4 bis 7 beschriebenen DNS und einer Fucosyltransferase codierenden cDNS umfasst. Isoliertes Polypeptid gemäß Anspruch 2 mit folgenden Eigenschaften:

(1) Wirkung: eine Sulfatgruppe wird von einem Sulfatgruppen-Donor auf eine Hydroxylgruppe in der 6-Position eines N-Acetylglucosaminrestes übertragen, der sich am nichtreduzierenden Ende eines Oligosaccharids der Formel I befindet: GlcNAc&bgr;1-3Gal&bgr;1-4GlcNAc(I)in der GlcNAc einen N-Acetylglucosaminrest darstellt, Gal einen Galactoserest, &bgr;1-3 eine &bgr;1-3-glycosidische Bindung und &bgr;1-4 eine &bgr;1-4-glycosidische Bindung;

(2) die N-ständige Aminosäuresequenz umfasst eine Aminosäuresequenz, die durch die Aminosäuren Nr. 1 bis 48 in der SEQ ID Nr. 4 repräsentiert wird.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com