PatentDe  


Dokumentenidentifikation DE102006004871A1 09.08.2007
Titel Mikroorganismenstamm zur Produktion von rekombinanten Proteinen
Anmelder Wacker Chemie AG, 81737 München, DE
Erfinder Leonhartsbeger, Susanne, Dipl.-Biol. Dr., 80634 München, DE;
Wich, Günter, Dipl.-Biol. Dr., 81377 München, DE
Vertreter Potten, H., Dr., 81737 München
DE-Anmeldedatum 02.02.2006
DE-Aktenzeichen 102006004871
Offenlegungstag 09.08.2007
Veröffentlichungstag im Patentblatt 09.08.2007
IPC-Hauptklasse C12N 1/21(2006.01)A, F, I, 20060202, B, H, DE
Zusammenfassung Die Erfindung betrifft einen Mikroorganismenstamm, der ein Gen kodierend ein rekombinantes Protein sowie ein mutiertes Gen kodierend ein Wirtsprotein umfasst, dadurch gekennzeichnet, dass das rekombinante Protein in einer Fermentation sekretiert wird und das mutierte Gen kodierend das Wirtsprotein derart mutiert ist, dass es eine im Vergleich zu dem dem mutierten Gen zugrunde liegenden Wildtyp Gen eine verminderte Expression des Wirtsproteins bewirkt.

Beschreibung[de]

Die Erfindung betrifft Mikroorganismenstämme, die eine verbesserte Herstellung von rekombinanten Proteinen ermöglichen, Verfahren zur Herstellung derartiger Stämme und Verfahren zur Herstellung von rekombinanten Proteinen unter Einsatz dieser Stämme.

Die großvolumige wirtschaftliche Herstellung von rekombinanten Proteinen ist für die biotechnologische und pharmazeutische Industrie von wachsender Bedeutung. Generell werden rekombinante Proteine entweder in Säugerzellkulturen oder in mikrobiellen Systemen hergestellt. Mikrobielle Systeme weisen gegenüber Säugerzellkulturen den Vorteil auf, dass auf diese Weise rekombinante Proteine in kürzerer Zeit und zu geringeren Kosten hergestellt werden können. Das Bakterium E. coli ist der für die Produktion von rekombinanten Proteinen am weitesten verbreitete mikrobielle Organismus. In E. coli können Proteine prinzipiell auf verschiedene Arten hergestellt werden:

  • 1. intrazelluläre Produktion als lösliches Protein;
  • 2. intrazelluläre Produktion als Einschlusskörperchen („inclusion bodies");
  • 3. Sekretion in das Periplasma oder in das umgebende Nährmedi um.

Aufwand und Kosten der Herstellung des erwünschten Proteins werden neben den Produktionskosten des Rohproduktes, welches direkt nach der Fermentation als Gemisch umfassend das rekombinante Protein sowie Wirtsproteine, die von der Zelle natürlicherweise sekretiert werden, vorliegt, auch wesentlich bestimmt durch die Aufreinigungskosten des Rohproduktes zum erwünschten Protein. Die Aufreinigung erfolgt in den meisten Fällen über mehrere Stufen mittels chromatographischer Verfahren. Dabei spielt die Abreinigung von verunreinigenden Wirtsproteinen, die z. T. immunogen oder toxisch sind, eine bedeutende Rolle.

Die Sekretion von Proteinen in E. coli erfolgt in den meisten Fällen über den sogenannten sec-pathway. Dafür wird das Gen für das zu produzierende Protein mit einer Signalsequenz verknüpft, was zu einer Produktion einer Signalpeptid-Protein-Fusion führt. Das Signalpeptid vermittelt die Sekretion des Proteins über die Cytoplasma-Membran in das Periplasma durch das bakterieneigene sec-System. Dabei wird die Signalsequenz abgespalten und das gewünschte Protein im Periplasma erhalten. Das Protein kann danach aus dem Periplasma gereinigt werden. Unter bestimmten Bedingungen oder in bestimmten Bakterien-Stämmen wird das Protein aus dem Periplasma in das umgebende Nährmedium freigesetzt (z. B. Ray et al. 2002; EP0338410B1; Nagahari et al. 1985; Yang et al., 1998) und kann aus diesem aufgereinigt werden.

Die Sekretion bietet im Vergleich zu den anderen Herstellungsverfahren den Vorteil, dass natives, lösliches, korrekt gefaltetes Protein erhalten wird, welches im Vergleich zum „inclusion body"-Verfahren nicht denaturiert und wieder renaturiert werden muss; ein Schritt, der mit hohen Verlusten an Ausbeute einhergeht. Außerdem ist das erhaltene Produkt im Vergleich zur intrazellulären, löslichen Produktion mit weniger Wirtsproteinen verunreinigt, da das Periplasma von Bakterien weitaus weniger an Wirtsproteinen enthält, als das Cytoplasma.

Die Sekretion der Proteine in das umgebende Nährmedium bietet, verglichen mit Sekretion ins Periplasma, den weiteren Vorteil, dass das Protein dann in noch reinerer Form vorliegt. Außerdem ist als erster Aufreinigungsschritt keine aufwändige Präparation des Periplasmas nötig, sondern eine viel einfachere und reproduzierbar verlaufende Abtrennung der ganzen Zellen.

Bei der Herstellung von Proteinen durch Sekretion ist das Rohprodukt insgesamt mit weniger Wirtsproteinen verunreinigt als bei der intrazellulären Produktion. Trotzdem spielen auch hier verunreinigende Wirtsproteine eine Rolle, vor allem Wirtsproteine, die auch natürlicherweise vom Bakterium sekretiert werden und dann im Periplasma oder in der äußeren Membran lokalisiert sind. Diese Proteine zeichnen sich dadurch aus, dass ihre Gene natürlicherweise eine Signalsequenz enthalten, welche diese Sekretion vermittelt. Außer der Tatsache, dass diese Wirtsproteine das Rohprodukt verunreinigen, konkurrieren sie mit dem zu produzierenden Protein um die Komponenten des Sekretionsapparates, was zu einer verringerten Sekretion des zu produzierenden Proteins führen kann. Diese Wirtsproteine, die zu einer Verunreinigung des Rohproduktes führen, erfüllen aber natürlich in der Wirtszelle eine physiologische Rolle. Sie können zum Beispiel an Chemotaxis und speziellen Transportvorgängen beteiligt sein.

In der Literatur ist beschrieben, dass durch die Deletion von Genen, welche für periplasmatische Proteasen codieren, z. B. degP, ompT, ptr, die Produktion proteolyseempfindlicher, sekretierter Proteine verbessert werden kann (US5264365; Baneyx & Georgiou, 1991; Wadensten et al., 1991). Dieser Effekt ist auf das Ausschalten der Aktivität der Proteasen zurückzuführen, welche in der Ausgangszelle das produzierte Protein abbauen. Vor allem heterolog produzierte Proteine in Zellen werden oft durch wirtseigene Proteasen abgebaut. Mengenmäßig spielen die Proteasen als Verunreinigungen jedoch keine Rolle, da sie aufgrund ihrer hohen Aktivität und enzymatischen Funktion in der Wirtszelle nur in sehr geringen Mengen produziert werden. Die Deletion dieser Gene hat also keine Auswirkung auf den Reinheitgrad der produzierten Proteine.

WO2004/035792A1 beschreibt die Veränderung von bestimmten Wirtsproteinen (z. B. PhoS/PstS, DppA, MBP, Trx) durch Mutationen in einzelnen Aminosäuren, welche zu einer Veränderung der physikalischen bzw. biochemischen Eigenschaften führen (Isoelektrischer Punkt, Hydrophobizität, Größe). Diese Veränderung der physikalischen bzw. biochemischen Eigenschaften hat zur Folge, dass die resultierenden veränderten verunreinigenden Wirtsproteine nicht mehr mit dem jeweils erwünschten produzierten Protein co-gereinigt werden, da sie sich beispielweise auf einer Chromatographie-Säule unterschiedlich verhalten. Das Verfahren ist nicht für die Produktion von beliebigen Proteinen nutzbar, da die verunreinigenden Wirtsproteine speziell für jedes zu produzierende Protein verändert werden müssen, weil jedes Protein unterschiedliche biochemische Eigenschaften hat. Im Verfahren gemäß WO2004/035792A1 wird trotz Veränderung der verunreinigenden Wirtsproteine ihre Produktion und Funktionalität beibehalten. Der Reinheitsgrad des Rohproduktes des produzierten Proteines ändert sich also nicht, es erleichtert aber jeweils die Abtrennung der verunreinigenden Wirtsproteine vom Protein.

WO98/18946 beschreibt Zellen, die zusätzlich zum zu produzierenden Protein Dsb-Proteine co-exprimieren und eine Deletion im Wildtyp pstS-Gen haben, die aber gleichzeitig eine pstS-Variante exprimieren. Auch hier ist die Menge an verunreinigendem Wirtsprotein also unverändert.

Eine Aufgabe der vorliegenden Erfindung ist die Bereitstellung von Mikroorganismenstämmen, welche die Produktion von rekombinanten Proteinen erleichtern.

Die Aufgabe wird gelöst durch einen Mikroorganismenstamm, der ein Gen kodierend ein rekombinantes Protein sowie ein mutiertes Gen kodierend ein Wirtsprotein umfasst, dadurch gekennzeichnet, dass das rekombinante Protein in einer Fermentation sekretiert wird und das mutierte Gen kodierend das Wirtsprotein derart mutiert ist, dass es eine im Vergleich zu dem dem mutierten Gen zugrunde liegenden Wildtyp Gen eine verminderte Expression des Wirtsproteins bewirkt.

Für eine wirtschaftliche Produktion eines Proteins ist es von Vorteil, wenn das produzierte rekombinante Protein schon im Rohprodukt, also direkt nach der Fermentation, wenn es als Gemisch umfassend das rekombinante Protein sowie verunreinigende Wirtsproteine vorliegt, mit möglichst wenigen Wirtsproteinen in möglichst geringer Menge verunreinigt ist. Damit kommt es nämlich zu einer Erhöhung der spezifischen Ausbeute an rekombinantem Protein. Die nachfolgende Aufreinigung des rekombinanten Proteins wird dadurch vereinfacht. Diesen Vorteil bieten die erfindungsgemäßen Bakterienstämme.

Unter einer verminderten Expression ist im Sinne der vorliegenden Erfindung vorzugsweise zu verstehen, dass produzierte und sekretierte Menge des betreffenden Proteins im Vergleich zu einer Wildtyp-Zelle um 25 bis 100 %, besonders bevorzugt um 75 bis 100 % verringert ist. Ganz besonders bevorzugt ist die Produktion und Sekretion des betreffenden Proteins völlig ausgeschaltet. Vorzugsweise ist das Wirtsprotein ausgewählt aus der Gruppe oppA, ompA, dppR, yddS, fliC, phoA und phoS.

Das rekombinante Protein wird in einer Fermentation vorzugsweise in das Periplasma oder in das Fermentationsmedium sekretiert. Besonders bevorzugt wird das rekombinante Protein in das Fermentationsmedium sekretiert.

Bei dem rekombinanten Protein handelt es sich vorzugsweise um ein heterologes Protein.

Bei dem Mikroorganismenstamm handelt es sich vorzugsweise um einen Bakterienstamm, besonders bevorzugt um einen Bakterienstamm aus der Familie der Enterobacteriaceae, insbesondere bevorzugt um einen Stamm der Art Escherichia coli. Besonders bevorzugt ist ein Escherichia (E.) coli-Stamm, der sich dadurch auszeichnet, dass er nach Fermentation eine höhere Konzentration des rekombinanten Proteins im Periplasma oder ganz besonders bevorzugt im umgebenden Nährmedium aufweist als der Stamm E. coli W3110 (ATCC 27325). Derartige Stämme werden im Folgenden als Sekretionsstämme bezeichnet.

Besonders bevorzugt sind Sekretionsstämme, die nach Fermentation mehr als 50 mg/l, besonders bevorzugt mehr als 100 mg/l, ganz besonders bevorzugt mehr als 200 mg/l des rekombinanten Proteins im umgebenden Nährmedium aufweisen.

Weitere bevorzugte Merkmale eines erfindungsgemäßen Stammes sind im Rahmen seiner Herstellung genannt. Die im Folgenden genannten Merkmale der Ausgangsstämme gelten damit analog auch für einen erfindungsgemäßen Stamm.

Ein erfindungsgemäßer Mikroorganismenstamm wird erhalten durch ein Verfahren, bei dem eine Wirtszelle, die mit einem Gen codierend ein rekombinantes Protein transformiert ist, in einer Fermentation zur Herstellung des rekombinanten Proteins eingesetzt wird, wobei die Wirtszelle das rekombinante Protein sowie weitere Wirtsproteine in das Fermentationsmedium sekretiert und so ein Rohprodukt enthaltend das rekombinante Protein sowie weitere Wirtsproteine erhalten wird, die weiteren Wirtsproteine charakterisiert werden und eine Expression eines Gens kodierend eines dieser Wirtsproteine verringert oder verhindert wird.

Vorzugsweise wird das Gen kodierend ein rekombinantes Protein während des Verfahrens zur Verringerung oder Verhinderung der Expression der Wirtsproteine aus dem Mikroorganismenstamm entfernt.

Bei den Wirtszellen, handelt es sich um Zellen eines Mikroorganismenstammes, zum Beispiel eines Hefe- oder Bakterienstammes. Bevorzugt handelt es sich um einen Bakterienstamm aus der Familie der Enterobacteriaceae, besonders bevorzugt um einen Stamm der Art Escherichia coli. Besonders bevorzugt ist ein Escherichia (E.) coli-Stamm, der sich dadurch auszeichnet, dass er nach Fermentation eine höhere Konzentration des rekombinanten Proteins im Periplasma oder ganz besonders bevorzugt im umgebenden Nährmedium aufweist als der Stamm E. coli W3110 (ATCC 27325).

Besonders bevorzugt sind solche Sekretionsstämme, die nach Fermentation mehr als 10 mg/l, besonders bevorzugt mehr als 50 mg/l, ganz besonders bevorzugt mehr als 100 mg/l des rekombinanten Proteins im umgebenden Nährmedium aufweisen.

Ganz besonders bevorzugt handelt es sich um einen der folgenden E. coli-Stämme:

  • – BLR: Ray et al. 2002, käuflich erhältlich bei Novagen
  • – K802 = CGSC 5610: Yang et al., 1998
  • – WCM105: herstellbar gemäß EP0338410B1
  • – MM28 = CGSC #5892: Nagahari et al. 1985
  • – RV308 = ATCC 31608; EP0677109B1
  • – RR1 : ATCC 31434: Nagahari et al., 1985
  • – KG1005 ompT: Wadensten et al., 1991

Das sekretierte Protein ist ein rekombinantes Protein, welches von der Wirtszelle produziert und sekretiert wird. Bevorzugt wird die Sekretion des Proteins durch Fusion seines Gens an eine Signalsequenz ermöglicht. Bevorzugt handelt es sich bei dem produzierten Protein um ein Protein, das Verwendung in technischen Ansätzen findet oder um ein Protein, das als Pharmawirkstoff eingesetzt wird (Biologics, Biopharmazeutikum).

Die Identifizierung von das produzierte Protein verunreinigenden Wirtsproteinen erfolgt nach dem Fachmann bekannten Methoden, etwa durch Auftrennung des zellfreien Überstandes nach Kultivierung in einem SDS-Polyacrylamid-Gel und durch anschließende Analyse der einzelnen Banden durch N-terminale Sequenzierung oder Peptide-Fingerprinting.

Beispiele von Proteinen, die in E. coli das sekretierte Produkt verunreinigen, sind: OppA, DppA, OmpA, YddS, FliC, PhoA, PhoS, außerdem jegliche Kombination dieser Proteine.

  • – Oligopeptid-Bindeprotein OppA: Swiss Prot # P23843 61 kDa, eines der Haupt-Proteine im Periplasma, Komponente der Oligopeptid-Permease (Bindeprotein-abhängiges Transportsystem), bindet Peptide bis zu 5 AA mit hoher Affinität, wird von SecB gebunden, besitzt auch Chaperon-Funktion, beteiligt an der Aufnahme von Aminoglycosid-Antibiotika.
  • – Dipeptid-Bindeprotein DppA: Swiss Prot # P23847 61 kDa, periplasmatisch, Dipeptid-Bindungsprotein eines Transportsystems, nötig für Peptid-Chemotaxis, Chaperon-ähnliche Funktion (in Rhodobacter).
  • – Outer membrane protein Omp3a = OmpA: NCBI # NP_286832 37 kDa, in äußerer Membran lokalisiert, nötig für die Wirkung der Colicine K und L, Stabilisierung während der Konjugation, Rezeptor für Phagen, Porin mit niedrigerer Permeabilität für kleine Solute.
  • – Flaqellin FliC: Swiss Prot # P04949, 51 kDa, Untereinheit der Flagellen
  • – putatives Hemin-Bindeprotein YddS: Swiss Prot # Q8XAU4 57 kDa, putatives Dipeptid-Transport-Protein.
  • – Alkalische Phosphatase PhoA: E.C.3.1.3.1, 49 kDa, periplasmatisches Protein, welches die Orthophosphat-Monoester-Spaltung katalysiert.
  • – Phosphat-Bindeprotein PhoS: 37 kDa, periplasmatisches Protein; Komponente des PTS-Phosphat-Aufnahmesystems.

Die alkalische Phosphatase PhoA und das Phosphat-Bindeprotein PhoS sind beide an der Phosphat-Versorgung von E. coli beteiligt.

Danach wird in den Wirtszellen die Expression der Gene dieser Proteine verringert oder verhindert. Da diese Proteine natürlich in den Bakterien eine physiologische Rolle erfüllen, ist es für den Fachmann völlig unerwartet, dass die drastisch verminderte Bildung dieser Proteine mit einem Überleben der Zellen und einem effektiven Stoffwechsel, wie er für die Überproduktion von Proteinen nötig ist, vereinbar ist.

Methoden, wie die Expression von Genen verringert oder verhindert wird, so dass die speziellen, in der Ausgangszelle von diesem Gen codierten Wirtsproteine weniger oder nicht mehr produziert werden, sind bekannt.

Die Expression eines der Gene kann zum Beispiel durch eine der folgende Maßnahmen verringert oder verhindert werden:

  • – Abschwächung des dem Gen zugehörigen Promotors durch geeignete Basensubstitutionen
  • – Inaktivierung/Veränderung eines für die Expression nötigen Transkriptionsaktivators
  • – Abschwächung von Translationsstartsignalen (z. B. Ribosomenbindestelle, Startcodon) durch geeignete Basensubstitutionen
  • – Entfernung von mRNA-stabilisierenden Regionen des Gens
  • – Überexpression von für spezifische Antisense-RNA codierenden DNA-Bereichen
  • – Deletion des gesamten Gens oder zumindest eines Teils davon
  • – Zerstörung des Gens durch Insertion von beispielsweise einer Antibiotikumsresistenzkassette
  • – Einführung von Leserasterverschiebungen in das entsprechende Gen aufgrund von Nukleotid-Deletionen oder -Insertionen

Methoden zum Austausch einer beliebigen chromosomalen DNA-Sequenz gegen eine zwar homologe, aber durch Baseninsertionen, -deletionen oder -substitutionen veränderte Sequenz sind dem Fachmann bekannt. So kann in Escherichia coli beispielsweise das von Link et al. (1997) beschriebene System verwendet werden, um mittels integrativer Plasmide über den Mechanismus der homologen Rekombination die chromosomale Wildtyp-Sequenz des Gens für ein verunreinigendes Protein gegen ein mutiertes Allel auszutauschen.

Bevorzugt ist die Einführung einer Deletion in ein Gen für ein verunreinigendes Wirtsprotein. Dies kann dadurch erreicht werden, dass das Gen nach der Amplifikation mittels PCR unter Einsatz von spezifischen Primern, die das komplette Gen erfassen, zunächst in einen Plasmid-Vektor (z. B. pUC18, pBR322, pACYC184) kloniert wird. Durch Restriktion des so erhaltenen Plasmids mit geeigneten Restriktionsendonukleasen, die nur im Bereich des Gens schneiden, können interne Regionen des Gens entfernt werden. Auf diese Weise kann nach Religation des restringierten Plasmids eine interne Deletion in das Gen eingeführt werden. Alternativ zur Religation des im Gen restringierten Plasmids kann auch eine Antibiotikumsresistenzkassette in das Gen kloniert werden.

Beispielsweise kann die Deletion eines Gens mit Hilfe des &lgr;-Red Rekombinase-System von Datsenko und Wanner (2000, PNAS, 97 (12), S. 6640–6645) erfolgen.

Die Erfindung betrifft ferner ein Verfahren zur fermentativen Produktion eines rekombinanten Proteins mittels eines Bakterienstammes enthaltend ein rekombinantes Gen kodierend für das rekombinante Protein in einem Fermentationsmedium, welches dadurch gekennzeichnet ist, dass ein erfindungsgemäßer Mikroorganismenstamm in dem Fermentationsmedium kultiviert wird und das Fermentationsmedium nach der Fermentation von den Zellen des Bakterienstammes abgetrennt wird.

Vorzugsweise wird nach dem Abtrennen des Fermentationsmediums das rekombinante Protein aus dem Fermentationsmedium aufgereinigt. Durch das erfindungsgemäße Verfahren wird die Aufreinigung des produzierten rekombinanten Proteins aus dem Fermentationsmedium vereinfacht.

Vorzugsweise wird das Gen, welches für das zu produzierende Protein codiert, mit in diesem Wirtsorganismus funktionellen Expressionssignalen versehen (Promotor, Transkriptions-, Translationsstart, Ribosomenbindestelle).

Zusätzlich wird das für das zu produzierende Protein codierende Gen mit einer Signalsequenz verknüpft, welche bewirkt, dass das zu produzierende Protein zunächst als Fusion mit dem von der Signalsequenz codierten Signalpeptid produziert wird. Dieses Signalpeptid bewirkt die Sekretion des produzierten Proteins.

Als Signalsequenz werden beispielsweise phoA, ompA, pelB, ompF, ompT, lamB, malE, Staphylococcal protein A, stII verwendet.

Die Sekretion des produzierten Proteins erfolgt beispielsweise durch den sec-Apparat der Zelle. Nach erfolgter Sekretion in das Periplasma wird von einer Signalpeptidase (z. B. LepB bei E. coli) das Signalpeptid abgespalten und es entsteht das gewünschte Protein.

Das Gen für das zu produzierende Protein inklusive der Expressions- und Sekretionssignale wird in die Wirtszelle eingebracht. Dies erfolgt auf einem Vektor, z. B. mit einem Plasmid wie etwa einem Abkömmling eines bekannten Expressionsvektors wie pUC18, pBR322, pACYC184, pASK-IBA3 oder pET. Das Gen kann auch vom Chromosom der Wirtszelle aus exprimiert werden.

Die Fermentation des Bakterienstammes zur erfindungsgemäßen Produktion von Proteinen erfolgt vorzugsweise in einem Vollmedium oder Minimalsalzmedium. Diese Medien sind aus der Literatur bekannt.

Als Kohlenstoffquelle können prinzipiell alle verwertbaren Zucker, Zuckeralkohole, organische Säuren bzw. deren Salze, Stärkehydrolysate, Melasse oder andere Stoffe verwendet werden. Dabei werden bevorzugt Glucose oder Glycerin eingesetzt. Auch ist eine kombinierte Fütterung mehrerer verschiedener Kohlenstoffquellen möglich. Als Stickstoffquellen können Harnstoff, Ammoniak und seine Salze, Nitratsalze sowie andere N-Quellen dienen. Zu den möglichen Stickstoffquellen gehören auch komplexe Aminosäuregemische wie Hefeextrakt, Pepton, Malzextrakt, Sojapepton, Casaminosäuren, Maisquellwasser (Corn Steep Liquor) und NZ-Amine (z. B. Kerry Bio-Science, Chicago, USA).

Des weiteren können dem Medium weitere Komponenten zugegeben werden wie Vitamine, Salze, Hefeextrakt, Aminosäuren und Spurenelemente, durch die das Zellwachstum verbessert wird.

Die Inkubation des Stammes erfolgt vorzugsweise unter aeroben Kultivierungsbedingungen über einen Zeitraum von 16–150 h und im Bereich der für den jeweiligen Stamm optimalen Wachtumstemperatur.

Als optimaler Temperaturbereich werden 15–55°C bevorzugt. Besonders bevorzugt ist eine Temperatur zwischen 30 und 37°C.

Die Anzucht des Stammes kann im Schüttelkolben oder Fermenter erfolgen, wobei keine Beschränkungen hinsichtlich Volumen gegeben sind. Die Anzucht kann im Batch-Verfahren, im Fed-Batch- oder in einem kontinuierlichen Verfahren erfolgen.

Die Aufreinigung von Proteinen aus dem Periplasma bzw. dem Kulturmedium kann nach dem Fachmann bekannten Verfahren, wie Zentrifugation des Mediums zur Abtrennung der Zellen und anschließende chromatographische Reinigung, Komplexierung, Filtration oder Fällung des Proteins erfolgen.

1 zeigt die Überstände von 48 h-Anzuchten in LB, aufgetrennt auf 12 % NuPAGE-Gel (Invitrogen) und identifizierte Proteine aus Beispiel 1.

2 zeigt die Überstände von Anzuchten in LB + 1 % Glc, aufgetrennt auf 12 % NuPAGE-Gel und mit Coomassie gefärbt aus Beispiel 3 und 5.

3 zeigt die Überstände von Anzuchten in LB + 1 % Glc, aufgetrennt auf 12 % NuPAGE-Gel und mit Coomassie gefärbt. Von allen Überständen wurden jeweils 1 &mgr;l aufgetragen. Der Pfeil zeigt das gebildete DsbG (26 kDa), die Ellipse die deletierten Proteine.

4 zeigt die Überstände von Anzuchten in LB + 1 % Glc, aufgetrennt auf 12 % NuPAGE-Gel und mit Coomassie gefärbt. Von allen Überständen wurden jeweils 10 &mgr;l aufgetragen. Der Pfeil zeigt das gebildete DsbG (26 kDa), die Ellipse die deletierten Proteine.

Die folgenden Beispiele dienen der weiteren Erläuterung der Erfindung.

Beispiel 1: Identifizierung von verunreinigenden Wirtsproteinen

Folgende aus der Literatur bekannten, allgemein zugänglichen und käuflich erhältlichen E. coli-Sekretionsstämme wurden in LB-Medium in 100 ml-Erlenmeyer-Kolben für 48 h bei 30°C kultiviert:

  • – BLR: Ray et al. 2002, erhältlich über Novagen
  • – K802 = CGSC #5610: Yang et al., 1998
  • – WCM105: herstellbar gemäß EP0338410B1
  • – MM28 = CGSC #5892: Nagahari et al. 1985
  • – RV308 = ATCC 31608; EP0677109B1
  • – RR1 : ATCC 31434: Nagahari et al., 1985
  • – KG1005 ompT: Wadensten et al., 1991

Danach wurden die Zellen durch Zentrifugation für 10 Min. bei 13000 g abgetrennt. Vom Überstand (Medium) wurden jeweils 30 &mgr;l mit SDS-Probenpuffer (5 × SDS-Probenpuffer: 125 mM Tris pH 6,8; 10 % Glycerol; 0,5 % SDS; 0,05 % Bromphenol-Blau; 5 % &bgr;-Mercaptoethanol) versetzt und in einem 12 % NuPAGE® Bis-Tris-Gel (Invitrogen Cat.No. NP0341) mit 1 × MES-haltigem Running Buffer (20 × MES – Running Buffer, Invitrogen Cat.No. NP0002) aufgetrennt (Elektrophorese-Parameter: 40 Min. bei 200 V). Danach wurde das Gel mit Coomassie Blue Färbelösung (1 Tablette PlusOne Coomassie Tabletts, Phast Gel Blue R-350 (Amersham 17-0518-01) in 80 ml H2O lösen, + 120 ml Methanol, + 200 ml Essigsäure 20 %) 1 h gefärbt und in Entfärbelösung (300 ml Methanol, 100 ml Eisessig, 600 ml vollentsalztes H2O) entfärbt. Nach Waschen in vollentsalztem Wasser wurden prominente Banden auf dem Gel identifiziert (s. 1). Diese werden durch das Rohprodukt verunreinigende Proteine verursacht. Die entsprechenden Banden wurden ausgeschnitten und abwechselnd mit Acetonitril und 50 % Ammomiumbicarbonatpuffer (pH 8.5) gewaschen. Bei Bedarf erfolgte die Reduzierung der Disulfidbrücken mit DTT und Jodacetamid. Nach Proteolyse mit Trypsin wurden die entstandenen Peptide mittels MALDI-TOF Massenspektrometrie gemessen. Durch Vergleich mit theoretisch errechneten Massen (erwartete Peptide) bzw. Datenbank-Einträgen wurden die untersuchten Proteine identifiziert.

Es wurden sieben auffällige Proteine identifiziert:

  • – Oligopeptid-Bindeprotein OppA: Swiss Prot # P23843
  • – Dipeptid-Bindeprotein DppA: Swiss Prot # P23847
  • – Outer membrane protein Omp3a = OmpA: NCBI # NP_286832
  • – Flagellin FliC: Swiss Prot # P04949
  • - putatives Hemin-Bindeprotein YddS: Swiss Prot # Q8XAU4
  • – Alkalische Phosphatase PhoA: E.C.3.1.3.1 Swiss Prot # P00634
  • – Phosphat-Bindeprotein PhoS Swiss prot Swiss Prot # P06128

Beispiel 2. Deletion von Genen für verunreinigende Wirtsproteine

Die Deletion eines großen internen Bereichs der jeweiligen Gene in den jeweiligen Stämmen erfolgte mit dem &lgr;-Red Rekombinase-System von Datsenko und Wanner (2000, PNAS, 97 (12), S. 6640–6645). Dazu wurde zunächst der zu entfernende Genbereich gegen eine Chloramphenicol-Resistenzkassette ausgetauscht, welche anschließend durch Einsatz der Hefe FLP Rekombinase und spezielle "FRT" Flanken an der Kassette wieder eliminiert werden konnte.

Die Deletion wurde folgendermaßen durchgeführt:

PCR:

  • • Template:

    Als Template wird pKD3 (Chloramphenicol-Resistenz; erhältlich über das E. coli Genetic Stock Center CGSC als CGSC #7631) eingesetzt.
  • • Oligos:

    Forward Oligo: 36–50 bp homologer Sequenz vom Anfang des zu entfernenden Gens + 20 bp homologer Plasmidsequenz:

    5'- 36–50 bp Chrom. -GTG TAG GCT GGA GCT GCT TC-3' (SEQ. ID NO 1) Reverse Oligo: 36–50 bp homologe Sequenz vom Ende des zu entfernenden Gens + 20 bp Plasmidsequenz (Gegenstrang): 5'- 36–50 chrom. -CAT ATG AAT ATC CTC CTT AG-3' (SEQ. ID NO 2)
  • • Polymerase:

    Pfu oder Taq
  • • Produktlänge:

    pKD3: 1,1 kb

Reinigung des PCR-Produktes:

Das PCR Produkt wird gereinigt (z. B. über Qiapräp Säulchen) und mit DpnI verdaut (2 h 37°C in zugehörigem Puffer), danach nochmals gereinigt und in 30 &mgr;l dest. Wasser eluiert (= PCR-Präp).

Präparation der elektrokompetenten Zellen:

  • • pKD46 = &lgr; Red Rekombinase Expressionsplasmid (Arabinoseinduzierbar) erhältlich über das E. coli Genetic Stock Center CGSC als CGSC #7739, Amp-Resistenz, temperatursensitiver Origin: alle Schritte bei max. 30°C
  • • Transformation des Plasmids in den zu verändernden Ziel-Stamm (Expression/Inkubation bei 30°C)
  • • Aus Ziel-Stamm + Plasmid kompetente Zellen für Elektroporation herstellen.
  • • Medium für die Anzucht der Zellen: SOB Medium:

    20 g/l Trypton

    5 g/l Hefeextrakt

    0,5 g/l NaCl

    2,5 g/l KCl

    10 mM MgCl

    + 0,2 % Arabinose

    + 100 mg/l Ampicillin
  • • Herstellung Elektroporation-kompetenter Zellen:

    – Anzucht bei 30°C

    – Ernte der Zellen bei OD600 ~ 0,6

    – ca. 100fach auf konzentrieren und 3 × mit eiskaltem Glycerin (10 %) waschen

Rekombination

  • • 10 &mgr;l des PCR-Präps (ca. 10–100 ng gereinigte PCR-DNA) werden in die elektrokompetenten Zellen transformiert
  • • Phänotypische Expression: Transformationsansatz in 1 ml LB aufnehmen und 1 h bei 37°C inkubieren) und auf LBcam Platten selektiert. Inkubation bei 37°C.

Curing von pKD46 (CGSC #7739):

  • • Ein so erhaltener Klon mit Resistenzkassette wird auf 2 LB Platten ausgestrichen und parallel bei 37°C und 43°C bebrütet.
  • • Von diesen Platten werden Einzelkolonien auf LB amp (LB mit 100 mg/l Ampicillin) und LB ausgestrichen und bei 30°C inkubiert.
  • • Ca. 8 Klone davon werden auf LB cam (LB mit 30 mg/l) (37°C) gereinigt.

PCR Kontrolle der Klone:

  • • Mit geeigneten Oligos (s. u. und Datsenko und Wanner, 2000) wird überprüft, ob die Resistenzkassette tatsächlich an Stelle des zu entfernenden Gens im Chromosom sitzt.

Entfernung der chromosomalen Antibiotikumsresistenzkassette:

  • • pCP20 (erhältlich über das E. coli Genetic Stock Center CGSC als CGSC #7629) = "FLP"-Rekombinase Expressionsplasmid, Amp-Resistenz, temperatursensitiver Origin: alle Schritte bei max. 30°C.
  • • Ein amp-sensitiver Klon (cam-resistenter aus dem Curing!) wird mit pCP20 transformiert, Selektion auf LB amp bei 30°C.
  • • 8 Transformanten werden auf LB gereinigt, Inkubation bei 37°C,
  • • Einzelkolonien werden nochmals auf LB ausgestrichen und bei 43°C inkubiert.
  • • Davon werden ca. 12 Klone auf cam und amp Sensitivität getestet.
  • • amp/cam-sensitive Klone haben die Resistenzkassette und pPC20 verloren.
  • ⇒ Deletionsklon ohne integrierter Cam-Kassette.

Im speziellen wurden für die Konstruktion der einzelnen Deletionsmutanten folgende Oligos verwendet und folgende PCR-Produkte erhalten:

Deletion von OmpA

Primer für PCR:

OmpA5:

CCAGTACCAT GACACTGGTT TCATCAACAA CAATGGCCCG ACCCRTGAAA ACCAA CAT ATG AAT ATC CTC CTT AG (SEQ ID NO. 3)

OmpR6:

GACCCTGGTT GTAAGCGTCA GAACCGATGC GGTCGGTGTA ACCCAGAACA ACTAC GTG TAG GCT GGA GCT GCT TC (SEQ ID NO. 4)

→ PCR mit pKD3 (erhältlich über das E. coli Genetic Stock Center CGSC als CGSC #7631): Produkt: 1114 bp; 598 bp von ompA werden bei Rekombination ersetzt durch 1014 bp Cam-Resistenz Überprüfung der Integration/Deletion mit Primern:

OmpA3: GACAGCTATCGCGATTGCAG (SEQ ID NO. 5)

OmpA4: GCTGAGTTACAACGTCTTTG (SEQ ID NO. 6)

Produkte: WT: 1022 bp; Insertionsmutante: 1486 bp; Deletionsmutante: ca 430 bp

Wie beschrieben wurden die folgenden Stämme hergestellt:

  • – BLR&Dgr;ompA
  • – K802&Dgr;ompA
  • – WCM105&Dgr;ompA
  • – MM28&Dgr;ompA
  • – RV308&Dgr;ompA
  • – RR1&Dgr;ompA
  • – KG1005ompT&Dgr;ompA

Deletion von OppA

Primer für PCR:

OppA5:

CACTGGCGGA AAAACAAACA CTGGTACGTA ACAATGGTTC AGAAGTTCAG TCATT CAT ATG AAT ATC CTC CTT AG (SEQ ID NO. 7)

OppA6:

CATTCACGTA GTAATAAACA GGAACAATGG CCGAATCCTT ATCCAGCTGT TGTTC GTG TAG GCT GGA GCT GCT TC (SEQ ID NO. 8)

→ PCR mit pKD3: Produkt: 1114 bp; 1331 bp von oppA werden bei Rekombination ersetzt durch 1014 bp Cam-Resistenz Überprüfung der Integration/Deletion mit Primern:

OppA3: GCG GAT CTT TGC CGG TAT AG (SEQ ID NO. 9)

OppA4: GAC CAA CAT CAC CAA GAG AA (SEQ ID NO. 10)

Produkte: WT: 1587 bp; Insertionsmutante: 1270 bp; Deletionsmutante: ca. 260 bp

Es entstanden folgende Stämme:

  • – BLR&Dgr;oppA
  • – K802&Dgr;oppA
  • – WCM105&Dgr;oppA
  • – MM28&Dgr;oppA
  • – RV308&Dgr;oppR
  • – RR1&Dgr;oppA
  • – KG1005ompT&Dgr;oppA

Deletion von dppA

Primer für PCR:

DppA1:

AAGGGTTTAACCCGCAGCTGTTTACCTCCGGCACCACCTATGACGCCTCT CAT ATG AAT ATC CTC CTT AG (SEQ ID NO. 11)

DppA2:

TGCCGGAGCCTGATCGTGCATCACCACCTGCGCTTGTTTGTACAGTTCAA GTG TAG GCT GGA GCT GCT TC (SEQ ID NO. 12)

→ PCR mit pKD3: Produkt: 1114 bp; 1381 bp von dppA werden bei Rekombination ersetzt durch 1014 bp Cam-Resistenz Überprüfung der Integration/Deletion mit Primern:

DppA3: GTCAGGGATGCTGRAGCTTG (SEQ ID NO. 13)

DppA4: TGTTTGCCTAATGGATCAAC (SEQ ID NO. 14)

Produkte: WT: 1587 bp; Insertionsmutante: 1193 bp; Deletionsmutante: ca. 566 bp

Es entstanden folgende Stämme:

  • – BLR&Dgr;dppA
  • – K802&Dgr;dppA
  • – WCM105&Dgr;dppA
  • – MM28&Dgr;dppA
  • – RV308&Dgr;dppA
  • – RR1&Dgr;dppA
  • – KG1005ompT&Dgr;dppA

Deletion von fliC

Primer für PCR:

FliC1:

TGCGTATTAACAGCGCGAAGGATGACGCAGCGGGTCAGGCGATTGCTAAC CAT ATG AAT ATC CTC CTT AG (SEQ ID NO. 15)

FliC2:

GGAGTTACCGGCCTGCTGGATGATCTGCGCTTTCGACATATTGGACACTT GTG TAG GCT GGA GCT GCT TC (SEQ ID NO. 16)

→ PCR mit pKD3: Produkt: 1114 bp; 1334 bp von fliC werden bei Rekombination ersetzt durch 1014 bp Cam-Resistenz Überprüfung der Integration/Deletion mit Primern:

FliC3: TATCAACARGAACCAGTCTGC (SEQ ID NO. 17)

FliC4: AGACAGAACCTGCTGCGGTA (SEQ ID NO. 18)

Produkte: WT: 1432 bp; Insertionsmutante: 1112 bp; Deletionsmutante: ca. 110 bp

Es entstanden folgende Stämme:

  • – LR&Dgr;fliC
  • – K802&Dgr;fliC
  • – WCM105&Dgr;fliC
  • – MM28&Dgr;fliC
  • – RV308&Dgr;fliC
  • – RR1&Dgr;fliC
  • – KG1005ompT&Dgr;fliC

Deletion von yddS

Primer für PCR:

YddS1:

ATTGGTAAGGCCGCCGATCCACAAACCCTCGACCCGGCGGTAACAATAGA CAT ATG AAT ATC CTC CTT AG (SEQ ID NO. 19)

YddS2:

ACAGGTACACATAAGCAGCGTCATCAATGACGATTTTCTGTGCCTGCTGG GTG TAG GCT GGA GCT GCT TC (SEQ ID NO. 20)

→ PCR mit pKD3: Produkt: 1114 bp; 1350 bp von fliC werden bei Rekombination ersetzt durch 1014 bp Cam-Resistenz Überprüfung der Integration/Deletion mit Primern:

YddS3: ATTGCTCGCGCTCGTCCTTG (SEQ ID NO. 21)

YddS4: CCTGTTCCAGCATGGGATTG (SEQ ID NO. 22)

Produkte: WT: 1432 bp; Insertionsmutante: 1156 bp; Deletionsmutante: ca. 160 bp

Es entstanden folgende Stämme:

  • – BLR&Dgr;yddS
  • – K802&Dgr;yddS
  • – WCM105&Dgr;yddS
  • – MM28&Dgr;yddS
  • – RV308&Dgr;yddS
  • – RR1&Dgr;yddS
  • – KG1005ompT&Dgr;yddS

Deletion von phoA und phoS

Vorgehen war analog.

Es entstanden folgende Stämme:

  • – BLR&Dgr;phoA
  • – K802&Dgr;phoA
  • – WCM105&Dgr;phoA
  • – MM28&Dgr;phoA
  • – RV308&Dgr;phoA
  • – RR1&Dgr;phoA
  • – KG1005ompT&Dgr;phoA
  • – BLR&Dgr;phoS
  • – K802&Dgr;phoS
  • – WCM105&Dgr;phoS
  • – MM28&Dgr;phoS
  • – RV308&Dgr;phoS
  • – RR1&Dgr;phoS
  • - KG1005ompT&Dgr;phoS

Beispiel 3: Erzeugung von Mehrfach-Deletionsmutanten

Bei der Erzeugung von Mehrfachmutanten wurden in einige der in Beispiel 2 erzeugten Stämmen schrittweise nach dem im Beispiel 2 beschriebenen Vorgehen auch die übrigen 6 identifizierten Gene deletiert.

Es entstanden unter anderem folgende Stämme:

  • – K802&Dgr;oppA&Dgr;fliC
  • – BLR&Dgr;phoA&Dgr;oppR
  • – BLR&Dgr;phoA&Dgr;oppA&Dgr;yddS&Dgr;phoA&Dgr;phoS
  • – BLR&Dgr;phoA&Dgr;yddS
  • – BLR&Dgr;phoA&Dgr;oppR&Dgr;yddS&Dgr;fliC
  • – WCM105&Dgr;oppA&Dgr;ompA
  • – WCM105&Dgr;ompA&Dgr;fliC
  • – WCM105&Dgr;oppA&Dgr;phoA
  • – WCM105&Dgr;oppA&Dgr;yddS
  • – WCM105&Dgr;fliC&Dgr;yddS
  • – WCM105&Dgr;oppA&Dgr;fliC
  • - WCM105&Dgr;oppA&Dgr;fliC&Dgr;yddS
  • - WCM105&Dgr;oppA&Dgr;fliC&Dgr;yddS&Dgr;phoA

Beispiel 4: Charakterisierung der Deletionsmutanten bezüglich Wachstum

Das Wachstum der verschiedenen Stämme bei 30°C in LB mit 1 Glucose wurde untersucht, indem die OD bei 600 nm nach 24 h und 48 h Wachstum gemessen wurde.

Alle Stämme zeigten normales Wachstum, d. h. das Wachstum war im Vergleich zum Ausgangsstamm nicht eingeschränkt. Die Deletionen haben also keinen negativen Effekt auf die Lebensfähigkeit und das Wachstum der Stämme.

Tabelle 1 zeigt Ergebnisse mit ausgewählten Stämmen:

Beispiel 5: Charakterisierung der Deletionsmutanten bezüglich verunreinigende Proteine im Überstand

Um die verunreinigenden Proteine in den Überständen der erfindungsgemäßen Stämme zu analysieren, wurden von den Anzuchten Aliquots durch SDS-PAGE und Coomassie-Färbung analysiert. Wie 2 an einem ausgewählten Stamm zeigt, sind die den deletierten Genen entsprechenden Hintergrundproteine bei diesen Stämmen nicht mehr im Überstand vorhanden. Die Gesamtheit der verunreinigenden Hintergrundbanden ist dadurch deutlich reduziert.

Beispiel 6: Gesteigerte spezifische Produktion einer Cyclodextrin-Glycosyl-Transferase

Verschiedene Stämme, erzeugt wie in Beispiel 2 und 3 beschrieben, wurden zur Produktion einer Cyclodextrin-Glycosyl-Transferase eingesetzt. Dazu wurden die Stämme mit Plasmid pCM301 nach gängigen Methoden (z. B. mittels CaCl2-Transformation) transformiert. Dieses Plasmid enthält das Strukturgen der Cyclodextrin-Glycosyl-Transferase aus Klebsiella oxytoca M5a1 unter Kontrolle des tac-Promotors und ist in EP0220714 beschrieben.

Diese erfindungsgemäßen Stämme werden in 10 ml in LB-Medium mit 1 % Glucose bei 30°C angezogen. Bei 0D 0,5 wird die Produktion der Cyclodextrin-Glycosyl-Transferase durch Zugabe von IPTG (Isopropylthiogalactosid) ad 0,5 mM induziert.

Im Überstand der Anzuchten der Stämme wurde sowohl der Gesamt-Proteingehalt bestimmt (nach der Bradford-Methode) als auch die Ausbeute an Cyclodextrin-Glycosyl-Transferase durch folgenden Aktivitätstest bestimmt:

Testpuffer: 5 mM Tris-HCl-Puffer > pH 6,5, 5 mM CaSO4·2 H2O

Substrat: 10 %ige Noreduxlösung in Test-Puffer (pH 6,5)

Testansatz: 1 ml Substratlösung + 1 ml abzentrifugierter Kulturüberstand (5 Min., 12 000 rpm) + 3 ml Methanol

Reaktionstemperatur: 40°C

Enzymtest:

  • – Vortemperieren der Lösungen (ca. 5 Min. bei 40°C)
  • – Zugabe der Enzymlösung zur Substratlösung; rasches Mischen (Whirl-Mixer)
  • – Inkubation für 3 Min. bei 40°C
  • – Stoppen der Enzymreaktion durch Methanol-Zugabe; rasches Mischen (Whirl-Mixer)
  • – Abkühlen des Ansatzes auf Eis (ca. 5 Min.)
  • – Abzentrifugieren (5 Min., 12 000 rpm) und Abpipettieren des klaren Überstandes
  • – Analyse des produzierten CDs mittels HPLC Enzymaktivität: A = G·V1·V2/(t·MG)(Units/ml) A = Aktivität

    G = Gehalt an CD in mg/l = Testansatz: Flächeneinheiten × 104 /Standardlösung (10 mg/ml)/Flächeneinheiten

    V1 = Verdünnungsfaktor/Testansatz (→ 5)

    V2 = Verdünnungsfaktor/Enzymlösung

    t = Reaktionszeit in Min. (→ 3)

    MG = Molekulargewicht in g/mol (CD → 973)

    1 Unit = 1 &mgr;Mol Produkt/Min.

Tabelle 2 zeigt die gesteigerte spezifische Cyclodextrin-Glycosyltransferase-Ausbeute ausgewählter erfindungsgemäßer Stämme.

Beispiel 7. Gesteigerte spezifische Produktion von DsbG mit Stämmen erzeugt gemäß Bsp. 2 und 3 7.1 Klonierung von dsbG

Ein Vektor zur Überproduktion von dsbG (Swiss Prot # P77202) wurde folgendermaßen konstruiert:

  • – PCR mit chromosomaler DNA aus W3110 (ATCC # 27325) als Template und folgenden Primern:

    dsbG-fw: GCT CTA GAG GAT CCG AAA AGG ACR AAT TAA TGT TAA AAA AG (SEQ ID NO. 23)

    dsbG-rev: CGA ATT CTT ATT TAT TCC CCA TAA TGA TAT TAA G (SEQ ID NO. 24)
  • – Restriktion des 783 bp PCR-Produkts mit XbaI und EcoRI
  • – Restriktion von pASK-IBA3 (Fa. IBA, Göttingen) mit XbaI und EcoRI
  • - Ligation der beiden DNA-Fragmente

Das entstandene Plasmid wurde pASK-dsbG (3961 bp) genannt und enthält das Gen für dsbG inklusive Signalsequenz unter Kontrolle des tet-Promotors.

7.2 Gesteigerte Produktion von DsbG

Stämme hergestellt gemäß Bsp. 2 und 3 wurden mit Plasmid pASK-dsbG nach gängigen Methoden (z. B. CaCl2-Transformation) transformiert und die in Tab. 3 genannten erfindungsgemäßen Stämme erhalten.

Der Stamm K802&Dgr;oppA/pASK-dsbG wurden am 26.01.2006 bei der DSMZ (Deutsche Sammlung für Mikroorganismen und Zellkulturen GmbH, D-38142 Braunschweig) unter der Nummer DSM 17899 gemäß Budapester Vertrag hinterlegt.

Der Stamm K802&Dgr;fliC/pASK-dsbG wurden am 26.01.2006 bei der DSMZ (Deutsche Sammlung für Mikroorganismen und Zellkulturen GmbH, D-38142 Braunschweig) unter der Nummer DSM 17898 gemäß Budapester Vertrag hinterlegt.

Die Stämme werden in 10 ml in LB-Medium mit 1 % Glucose und 100 mg/l Ampicillin bei 30°C angezogen. Bei OD 0,5 wird die Produktion von DsbG durch Zugabe von Anhydrotetracyclin ad 0,2 mg/l induziert.

Nach verschiedenen Zeiten wird jeweils zellfreier Überstand auf einem SDS-Polyacrylamidgel aufgetrennt und nach Färbung mit Coomassie Brilliant Blue analysiert. Eine quantitative Auswertung erfolgte nach Einscannen mit Biorad GS-800 Calibrated Densitometer mittels der Quantity One 1-D-Analysis Software (Biorad) im Vergleich zu einem Standard.

Wie 3 und 4 und Tabelle 3 an einigen Beispielen zeigt, ist die Produktion von DsbG in den erfindungsgemäßen Stämmen im Vergleich zu den Ausgangsstämmen verbessert.

Es folgt ein Sequenzprotokoll nach WIPO St. 25. Dieses kann von der amtlichen Veröffentlichungsplattform des DPMA heruntergeladen werden.


Anspruch[de]
Mikroorganismenstamm, der ein Gen kodierend ein rekombinantes Protein sowie ein mutiertes Gen kodierend ein Wirtsprotein umfasst, dadurch gekennzeichnet, dass das rekombinante Protein in einer Fermentation sekretiert wird und das mutierte Gen kodierend das Wirtsprotein derart mutiert ist, dass es eine im Vergleich zu dem dem mutierten Gen zugrunde liegenden Wildtyp Gen eine verminderte Expression des Wirtsproteins bewirkt. Mikroorganismenstamm gemäß Anspruch 1, dadurch gekennzeichnet, dass das durch das mutierte Gen kodierte Wirtsprotein in einer Menge produziert und sekretiert wird, die im Vergleich zu der Produktion und Sekretion in einer Wildtyp-Zelle um 25 bis 100 %, besonders bevorzugt um 75 bis 100 %, verringert ist. Mikroorganismenstamm gemäß Anspruch 1 oder 2, dadurch gekennzeichnet, dass das Wirtsprotein ausgewählt ist aus der Gruppe OppA, OmpA, DppA, YddS, FliC, PhoA, PhoS. Mikroorganismenstamm gemäß einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, dass das rekombinante Protein in das Fermentationsmedium sekretiert wird. Mikroorganismenstamm gemäß einem der Ansprüche 1 bis 4, dadurch gekennzeichnet, dass das rekombinante ein heterologes Protein ist. Mikroorganismenstamm gemäß einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass es sich um einen Stamm der Art Escherichia coli handelt. Mikroorganismenstamm gemäß Anspruch 6, dadurch gekennzeichnet, dass er ausgewählt ist aus der Gruppe BLR, WCM105, MM28 = N99 = CGSC #5892, K802 = CGSC #5610 = WA802, RV308 = ATCC 31608. Verfahren zur Herstellung eines Stammes gemäß einem der Ansprüche 1 bis 7, bei dem eine Wirtszelle, die mit einem Gen codierend ein rekombinantes Protein transformiert ist, in einer Fermentation zur Herstellung des rekombinanten Proteins eingesetzt wird, wobei die Wirtszelle das rekombinante Protein sowie weitere Wirtsproteine in das Fermentationsmedium sekretiert und so ein Rohprodukt enthaltend das rekombinante Protein sowie weitere Wirtsproteine erhalten wird, die weiteren Wirtsproteine charakterisiert werden und eine Expression eines Gens kodierend eines dieser Wirtsproteine verringert oder verhindert wird. Verfahren zur fermentativen Produktion eines rekombinanten Proteins mittels eines Bakterienstammes enthaltend ein rekombinantes Gen kodierend für das rekombinante Protein in einem Fermentationsmedium, welches dadurch gekennzeichnet ist, dass ein Mikroorganismenstamm gemäß einem der Ansprüche 1 bis 7 in dem Fermentationsmedium kultiviert wird und das Fermentationsmedium nach der Fermentation von den Zellen des Bakterienstammes abgetrennt wird. Verfahren gemäß Anspruch 9, dadurch gekennzeichnet, dass nach dem Abtrennen des Fermentationsmediums das rekombinante Protein aus dem Fermentationsmedium aufgereinigt wird.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com