PatentDe  


Dokumentenidentifikation DE102006008074A1 23.08.2007
Titel Behandlung von Krebs mit Geruchsrezeptor-Liganden
Anmelder Ruhr-Universität Bochum, 44801 Bochum, DE
Erfinder Neuhaus, Eva Maria, Dr., 44801 Bochum, DE;
Hatt, Hanns, Prof., Dr., Dr., 44801 Bochum, DE
Vertreter Patentanwälte von Kreisler, Selting, Werner et col., 50667 Köln
DE-Anmeldedatum 22.02.2006
DE-Aktenzeichen 102006008074
Offenlegungstag 23.08.2007
Veröffentlichungstag im Patentblatt 23.08.2007
IPC-Hauptklasse A61K 45/00(2006.01)A, F, I, 20060222, B, H, DE
IPC-Nebenklasse A61K 31/56(2006.01)A, L, I, 20060222, B, H, DE   
IPC additional class A61P 35/00  (2006.01)  A,  L,  N,  20060222,  B,  H,  DE
Zusammenfassung Die Erfindung betrifft die Verwendung eines Liganden, der an den Geruchsrezeptor 51E2 (PSGR) bindet, zur Behandlung von Krebs oder Tumoren der Haut und der Prostata. Darüber hinaus wird die Verwendung von spezifischen Geruchsrezeptorliganden zur Behandlung von bestimmten Krebs- und Tumorarten offenbart.

Beschreibung[de]

Die Erfindung betrifft die Verwendung eines Liganden, der an den Geruchsrezeptor 51E2 (PSGR) bindet, zur Behandlung von Krebs oder Tumoren der Haut und der Prostata. Darüberhinaus wird die Verwendung von spezifischen Geruchsrezeptorliganden zur Behandlung von bestimmten Krebs- und Tumorarten offenbart.

Hintergrund der Erfindung

In Europa und den Vereinigten Staaten von Amerika ist der Krebs der Vorsteherdrüse (Prostata) eine der häufigsten Krebskrankheiten beim Mann. Nach Schätzungen des Robert-Koch Instituts erkranken jährlich etwa 40.000 Männer neu daran. Der Häufigkeitsgipfel liegt dabei jenseits des 70. Lebensjahres. Die Ursache der Erkrankung ist bisher weitgehend unbekannt. Im Zuge der Bemühungen um eine bessere Vorhersage des Krankheitsverlaufs sind eine Reihe Prostata-spezifischer Gene entdeckt und identifiziert worden, wie etwa das inzwischen in der klinischen Routinediagnostik verwendet PSA, aber auch weitere Gene wie PSMA, NKX3.1, TMPRSS2, STEAP, PDEF, PART-1, PSGR, HOXB13, DD3, PCGEM1 und PMEPA1, die unterschiedlichste Charakteristiken aufweisen. Eines der beschriebenen Prostata-spezifischen Gene kodiert für einen G-Protein gekoppelten Rezeptor (PSGR – für prostate specific G-protein coupled receptor). Dieser Rezeptor gehört zur Familie der Geruchsrezeptoren, die sich normalerweise in der Membran der Riechsinneszellen in der Nase befinden. Dort detektieren diese Rezeptoren Duftmoleküle, woraufhin in der Zelle eine biochemische Signalkaskade gestartet wird die schlussendlich zur Auslösung von Aktionspotentialen führt, welche wiederum in das Gehirn geleitet werden.

Eine grundlegende Frage in diesem Zusammenhang ist, welche Bedeutung solche Geruchsrezeptoren in nicht-neuronalen Zellen haben. Dies deshalb, weil der bereits bekannte Geruchsrezeptor 51E2, der wegen seiner spezifischen Lokalisation in der Prostata auch als PSGR bezeichnet wird. Dieser Prostata-spezifische Geruchsrezeptor kommt in den Epithelzellen der Prostata vor und wird bei der Entstehung von Prostatakrebs im Prostataepithel überexprimiert. Er ist damit ein potentielles Ziel für die Behandlung von Prostatakarzinomen. Durch spezifische Stimulation dieses Rezeptors wird die Zellproliferation und/oder Differenzierung beeinflusst.

Andererseits ist aus der WO 01/064193 das Steroid 6-Methylenandrosta-1,4-dien-3,17-dion (Exemestan) bekannt, das zur Behandlung von Hormon abhängigem Brustkrebs (Aromasin® von Pharmacia & Upjohn Co.) sowie von metastasierendem fortgeschrittenen Hormon abhängigem Brustkrebs geeignet ist.

Aus der US 4808616 ist weiterhin bekannt, daß sich substituierte Derivate des Exemestans, nämlich solche mit C1-C6-Alkyl in der Position 1 und an der Methylengruppe in 6-Stellung sowie Halogen oder C1-C6-Alkyl in der Position 4 zur Behandlung von fortgeschrittenem Hormon abhängigem Brustkrebs, Pankreaskrebs, Gebärmutterkrebs und Eierstockkrebs sowie von Hypertrophie und Hyperplasie der Prostata eignen Zusammensetzungen mit wenigstens zwei Verbindungen ausgewählt aus Tocotrienolen, Statinen und Iononen, insbesondere mit Tocotrienol und &bgr;-Ionon sind aus der US 6133312 bekannt. Diese inhibieren das Tumorwachstum, wobei ein synergistischer Effekt der Zusammensetzung gegenüber den Einzelkomponenten beobachtet wird.

Schließlich wird in der WO 2005/070951 ein Verfahren zur Herstellung von Exemestan-Derivaten mit Halogen oder C1-C6-Alkyl in den Positionen 1, 4, 7 und 16, und in der US 4990635 ein Verfahren zur Herstellung von Exemestan-Derivaten mit C1-C6-Alkyl in den Positionen 1 und 7, Halogen oder C1-C6-Alkyl in der Position 4, sowie Fluor in der Position 16 offenbart.

Trotz alldem bestand Bedarf an strukturell relativ einfach aufgebauten Wirkstoffen, die erst noch spezifisch an einen bestimmten Rezeptor des Tumors binden, und sich somit für eine gezieltere Behandlung von Krebs eignen.

Kurzbeschreibung der Erfindung

Es wurde überraschenderweise gefunden, daß spezielle Substanzen, die sich als Geruchsrezeptorliganden eignen und dabei spezifisch an den Geruchsrezeptor 51E2 (auch PSGR genannt) binden, wie z.B. das Wachstum von Prostatatumoren deutlich verlangsamen. Da dieser Rezeptor im Zusammenhang mit der vorliegenden Erfindung auch in Hautkrebs-Biopsaten identifiziert werden konnte, und humane Melanocyten auf &bgr;-Ionon Applikation auch einen Calcium-Einstrom aufweisen, lassen sich &bgr;-Ionon und &bgr;-Ionon verwandte Substanzen generell zur Melanombehandlung einsetzen. Die vorliegende Erfindung betrifft somit

  • (1) die Verwendung eines Liganden, der an den Geruchsrezeptor 51E2 (PSGR) bindet, zur Behandlung von Krebs oder Tumoren ausgewählt aus Krebs/Tumoren der Haut, der Prostata (Prostatakarzinom), der Lunge und der Leber;
  • (2) eine bevorzugte Ausführungsform von (1), wobei der Geruchsrezeptorligand ausgewählt ist aus der Gruppe der Riech- oder Aromastoffe und Steroide; und
  • (3) die Verwendung eines steroidischen Geruchsrezeptorliganden, der ein Gonan, Estran- oder Pregnanderivat ist, zur Behandlung von Krebs und Tumoren, die den Geruchsrezeptor 51E2 exprimieren und vorzugsweise ausgewählt aus Krebs/Tumoren der Brust, der Ovars (Eierstöcke), der Leber und des Pankreas; und
  • (4) Verwendung eines Riech- oder Aromastoffes zur Behandlung von Krebs und Tumoren, die ausgewählt sind aus Krebs/Tumoren der Brust, der Ovars (Eierstöcke) und des Pankreas.

Die Erfindung betrifft auch ein Verfahren zur Behandlung der vorstehend genannten Krebs- oder Tumorarten, sofern diese den Geruchsrezeptor 51E2 exprimieren, umfassend die Verabreichung eines Geruchsrezeptor-liganden, wie in (1) bis (4) definiert, an einen Patienten, der einer solchen Behandlung bedarf.

Kurzbeschreibung der Figuren

1: (A) Calcium-Imaging in HEK293 Zellen (Beispielspuren) nach Transfektion mit einem erstellten Plasmid, welches für den Rezeptor PSGR kodiert. (A) aus einer Mischung mit 100 verschiedenen Duftsubstanzen der Firma Henkel wurde als Ligand für PSGR &bgr;-Ionon identifiziert. (B) aus einer Mischung strukturell ganz verschiedener Steroide wurde 6-Dehydrotestosteron, ADT und 1,4,6-Androstatrien-17&bgr;-ol-3-on, die alle ein dem &bgr;-Ionon vergleichbares Strukturmotiv enthalten, als Ligand identifiziert.

2: (A) &bgr;-Ionon erzeugt auch in Zellen der Prostataepithel-Zelllinie LNCaP Calcium-Anstiege (Beispielspuren). (B) Diese Calcium-Anstiege verschwinden nach Reduktion der PSGR Expression durch PSGR spezifische siRNA, was die Spezifität des beobachteten Effekts beweist. Die Quantifizierung des Calcium-Anstiegs in unbehandelten LNCaP Zellen (Control) und in Zellen, die das siRNA Plasmid aufgenommen haben (erkennbar durch Koexpression von auf demselben Plasmid kodiertem GFP), zeigt eine deutliche Abhängigkeit der Aktivierung der Zellen durch &bgr;-Ionon von der Expressionsstärke des PSGR. (C) Calcium-Imaging Experiment (beispielhaft), in dem der fehlende &bgr;-Ionon induzierte Calcium-Anstieg in den GFP exprimierenden LNCaP Zellen deutlich zu sehen ist. (D) Die als Liganden für den heterolog exprimierten PSGR Rezeptor identifizierten Steroide erzeugen auch in LNCaP Zellen Calcium-Anstiege: Beispielspuren für ADT induzierte Calcium-Anstiege in LNCaP Zellen. (E) Quantifizierung des ADT induzierten Calciumanstiegs in LNCaP Zellen, in denen die PSGR Expression durch Transfektion mit siRNA unterdrückt wurde. (F) Calcium-Imaging Experiment, in dem der fehlende ADT induzierte Calcium-Anstieg in den GFP exprimierenden LNCaP Zellen deutlich ist.

3: (A) Der durch &bgr;-Ionon induzierte Calcium-Anstieg (control) wird durch Inkubation der LNCaP Zellen mit U73122, aber nicht durch MDL geblockt. Der Anstieg der intrazellulären Calcium-Konzentration hängt somit von der Aktivierung der Phospholipase C vermittelten Signaltransduktionskaskade ab, Adenylatzyklasen scheinen nicht beteiligt zu sein. (B) Die intrazelluläre Calcium-Konzentration steigt auch in Calcium freier extrazellulärer Lösung nach Applikation von &bgr;-Ionon an, es findet also eine Calcium-Freisetzung aus intrazellulären Calciumspeichern statt. (C) Die Entleerung der intrazellulären Calciumspeicher mit Thapsigargin vor der Applikation von &bgr;-Ionon verhindert einen &bgr;-Ionon vermittelten Anstieg der intrazellulären Calcium-konzentration. Der Anstieg der Calciumkonzentration nach Aktivierung des PSGR führt also primär über eine Freisetzung von Calcium-Ionen aus intrazellulären Calciumspeichern. (D) Die Inkubation der Zellen mit Inhibitoren für zur TRP-Familie gehörende Calciumkanäle verhindert einen deutlichen &bgr;-Ionon vermittelten Anstieg der cytosolischen Calcium-konzentration. Diese Kanäle sind also essentiell am Calciumeinstrom beteiligt.

4: Western Blot Analyse der &bgr;-Ionon induzierten Phosphorylierung von zur MAPK Kaskade gehörenden Kinasen. LNCaP Zellen wurden hierzu für 5, 10, 20 und 30 Minuten mit dem Liganden stimuliert, die Zellen wurden lysiert und die entsprechenden Zelllysate wurden auf SDS-PAGE Gelen aufgetrennt. Jeweils gleiche Mengen der auf Nitrozellulose transferierten Lysate wurden dann mit Antikörpern, die nur gegen die phosphorylierte Form der p38 bzw. SAPK/JNK MAPK gerichtet sind inkubiert, und mit solchen verglichen, die die jeweilige MAPK unabhängig vom Phosphorylierungsstatus des Proteins detektieren. Erkennbar ist, dass durch Inkubation der LNCaP Zellen mit &bgr;-Ionon sowohl p38, als auch SAPK/JNK Kinasen phosphoryliert, und damit aktiviert werden.

5: (A und B) Die Proliferationsrate von LNCaP Zellen kann (im Vergleich zur unbehandelten Kontrolle) durch Dehydrotestosterone (DHT), wie in der Literatur beschrieben, stimuliert werden. Die Applikation von &bgr;-Ionon (250 &mgr;M) führt dagegen zur Inhibierung der Zellproli-feration. Die Koapplikation von DHT und &bgr;-Ionon führt zu einer deutlichen Senkung der DHT induzierten Proliferationsraten. (C und D) Auch die Proliferationsrate von primären Prostataepithelzellen kann durch DHT stimuliert und durch &bgr;-Ionon verringert werden. Auch hier führt die Koapplikation von DHT und &bgr;-Ionon zur Senkung der DHT induzierten Proliferationsraten. Die Behandlung von LNCaP und PCE Zellen mit 5 bzw. 250 &mgr;M &bgr;-Ionon führt im Vergleich zu unbehandelten Zellen zu einer deutlichen Fragmentiertung der aus den jeweiligen Zellen isolierten DNA (erkennbar an der starken Zunahme der Anzahl und Intensität an niedermolekularen DNA Banden).

6: (A) Die genaue Untersuchung der kultivierten Zellen mit Phasenkontrastmikroskopie zeigt, dass nahezu alle Zellen eine typische Morphologie von Epithelzellen aufweisen. (B) Die kultivierten Epithelzellen, und im Vergleich dazu die auch untersuchten LNCaP Zellen, wurden mit RT-PCR auf die Expression verschiedener Markerproteine hin untersucht. Beide Zelltypen exprimieren die typischen Marker von Prostataepithel-Karzinomzellen PSA (Prostata-spezifisches Antigen), AR (Androgen Rezeptor), CK8 (Cytokeratin 8) und CK18 (Cytokeratin 18). Beide Zelltypen exprimieren zudem den PSGR Rezeptor. (C) Primäre Prostataepithelzellen wurden mit Calcium-Imaging Experimenten untersucht. Die Zellen reagieren auf Applikation von &bgr;-Ionon und ADT mit einem Anstieg der intrazellulären Calcium-Konzentration, ähnlich wie die zuvor untersuchten LNCaP Zellen. Der Calcium-Einstrom konnte zudem hier auch mit einem pharmakologischen Blocker der Phospholipase C unterdrückt werden, was darauf hin deutet, dass in beiden Zelltypen derselbe Signaltransduktions-mechanismus abläuft.

Detaillierte Beschreibung der Erfindung

Bei der Ausarbeitung der vorliegenden Erfindung ist dazu gezielt nach Liganden für den Geruchsrezeptor 51E2 (PSGR) gesucht worden, und zwar in Mischungen von in der Parfümerie häufig verwendeten, chemisch sehr unterschiedlichen Duftsubstanzen (Alkohole, Aldehyde, Ketone, Amine, aliphatische und aromatische Kohlenwasserstoffe, Heterocyclen usw.). Hierzu wurde der Rezeptor kloniert, in einem heterologen Zellsystem zur Expression gebracht, und mit Calcium-Imaging Experimenten auf Aktivierbarkeit durch die erwähnten Duftsubstanzen hin untersucht. Durch diese Experimente konnte &bgr;-Ionon als Ligand identifiziert werden. Mit demselben Ansatz wurden weiterhin Steroide mit ähnlichen strukturellen Motiven wie &bgr;-Ionon auf eine mögliche Aktivierung des heterolog exprimierten Rezeptors hin untersucht und verschiedene Steroidliganden konnten identifiziert werden, nämlich 6-Dehydrotestosteron, ADT und 1,4,6-Androstatrien-17&bgr;-ol-3-on. Im Verlauf weiterer Experimente zeigte sich, dass diesselben Substanzen auch den endogenen PSGR in LNCaP-Zellen (humane Prostatakarzinomzellinie) und in Primärkulturen von Prostatatumoren aktivieren.

Es ist dann untersucht worden, welche Auswirkungen die Aktivierung des PSGR durch die identifizierten Liganden auf Zellzyklus und Apoptose von Prostatakarzinomzellinien und primären Prostatazellen haben, und welcher Mechanismus dieser Wirkung zugrunde liegt. Die Applikation von &bgr;-Ionon auf die erwähnten Zellen führt dabei zu einer Aktivierung (Phosphorylierung) von zur Familien der MAP-Kinasen gehörenden Proteinen (p38 und SAPK/Jnk). Die Aktivierung dieser Enzyme führt dann zur Inhibition der Proliferationsrate der Zellen und induziert den sogenannten programmierten Zelltod (Apoptose). Die proliferationshemmende Wirkung der Liganden bremst sogar die durch Testosteron induzierte vermehrte Zellproliferation ab.

In einem bevorzugten Aspekt der Ausführungsformen (1) oder (2) der Erfindung ist der Geruchsrezeptorligand ein Riech- oder Aromastoff und vorzugsweise ein Terpen oder Terpenderivat. Hierbei ist beonders bevorzugt, dass das Terpen oder Terpenderivat ein Ionon oder Iononderivat, insbesondere ein &bgr;-Ionon oder ein Derivat desselben ist.

In einem weiteren bevorzugten Aspekt der Ausführungsformen (1) oder (2) der Erfindung ist der Geruchsrezeptorligand ein ein Steroid ist. Hierbei ist das Steroid vorzugsweise ein Gonanderivat der nachfolgenden Formel (I), ein Androstanderivat der nachfolgenden Formel (II), ein Pregnanderivat der nachfolgenden Formel (III) oder ein Estranderivat der nachfolgenden Formel (IV).

Hierbei sind solche Derivate besonders bevorzugt, die

  • (i) wenigstens eine, vorzugsweise wenigstens zwei C-C-Doppelbindungen aufweisen, bevorzugt wenigstens zwei C-C-Doppelbindungen in den Positionen 4 und 6 aufweisen, und/oder
  • (ii) wenigstens eine, vorzugsweise wenigstens zwei funktionelle Gruppen ausgewählt aus OH, =O, NH2 und Derivate derselben (insbesondere Ester, Acetale Ketale, Amide oder Imide) in den Positionen 3 und/oder 17 tragen, bevorzugt unabhängig voneinander einen OH und/oder =O Rest in den Positionen 3 und 17 tragen.

Weiterhin können die genannten Derivate einen oder mehrere C1-6 Alkyl-, Alkylen- oder Cycloalkylenreste aufweisen, insbesondere einen oder zwei Methylreste in den Positionen 10 und 13, besonders bevorzugt zwei Methylreste in den Positionen 10 und 13 tragen, wie dies bei den Androstan- und Estranderivaten der Formeln (II) und (IV) der Fall ist.

Bevorzugte steroidische Geruchsrezeptorliganden sind z.B. 6-Dehydrotestosteron, 1,4,6-Androstatrien (ADT) und 1,4,6-Androstatrien-17&bgr;-ol-3-on, Exemestan (6-Methylenandrosta-1,4-dien-3,17-dion), 4,6-Androstadien-17&agr;-methyl-17&bgr;-ol-3-on, 4,6-Androstadien-17&bgr;-ol-3-on Acetat, 4,6-Androstadien-3,17-dion, 4,6-Androstadien-17&bgr;-ol-3-on Benzoat, 4,6-Androstadien-17&bgr;-ol-3-on Carboxymethyloxim, 4-Androsten-3,6,17-trion; 4,6-Estradien-3,17-dion, 4,6-Estradien-17&bgr;-ol-3-on, 4,6-Estradien-17&bgr;-ol-3-on Acetat, 4,6-Pregnadien-3,20-dion, 4,6-Pregnadien-6-methyl-17-ol-3,20-dion Acetat, und 1,4,6-Pregnatrien-3,20-dion. Besonders bevorzugt sind 6-Dehydrotestosteron, 1,4,6-Androstatrien, 1,4,6-Androstatrien-17&bgr;-ol-3-on und Exemestan.

Als Gonan, Estran- oder Pregnanderivate der Ausführungsform (3) bzw. Riech- oder Aromastoffe in der Ausführungsform (4) der Erfindung können die vorstehend erwähnten bevorzugten Verbindungen eingesetzt werden.

Die Menge an Geruchsrezeptorliganden, die zur Krebs-/Tumorbehandlung eingesetzt wird, kann von dem behandelnden Arzt durch sein Fachwissen bestimmt werden. Sie richtet sich dabei unter Anderem nach der Art des Krebses/Tumors, der Schwere der Erkrankung, dem Alter und der Konstitution des Patienten. Üblicherweise wird die verabreichte Dosis an Geruchsrezeptorligand im Bereich von 1 bis 10, vorzugsweise von 2 bis 5 mg/kg Körpergewicht des Patienten pro Tag liegen. Die Verabreichung der erforderlichen Dosis kann dabei in einer einzigen oder mehreren Gaben erfolgen.

Die Erfindung wird anhand der nachfolgenden Beispiele näher erläutert. Diese Beispiele sollen den Schutzbereich der Erfindung jedoch nicht einschränken.

Beispiele Materialien und Methoden Vektorkonstruktion:

Der komplette Leserahmen des PSGR Rezeptors (NM_030774 (erhältlich im Internet unter http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=1992363 0); gi:11875777) wurde von humaner genomischer DNA mittels PCR amplifiziert; die hierfür verwendeten spezifischen Primer PSGR_up GCGAATTCACCATGAGTTCCTGCAACTTCACACATGC (Seq ID NO:1)

und

PSGR_dw GCGAATTCTCACTTGCCTCCCACAGCCTGCAAGTCC (SEQ ID NO:2

enthielten Restriktionsstellen für die Klonierung und das PCR Produkt wurde in die EcoRI Restriktionsschnittstelle des Vektors pcDNA3 (Invitrogen) kloniert.

Zellkultur:

HEK293 cells wurden in MEM Medium (Invitrogen) kultiviert, welches mit 10 % FBS und Antibiotika (Penicillin/Streptomycin) supplementiert war. Semikonfluente HEK Zellen wurden in 35 mm Zellkulturschalen ausgesät und mittels Calcium-Phosphat Präzipitationstechnik mit dem PSGR Plasmid transfeziert. Die Messungen wurden 48–72 Stunden nach der Transfektion durchgeführt. LNCaP Zellen wurden in RPMI 1640 Medium (Invitrogen) kultiviert, welches mit 10 % FBS (Invitrogen) und Antibiotika (Penicillin/Streptomycin) supplementiert war. Primäre Epithelzellen der Prostata wurden aus Prostatakrebs-Biopsaten gewonnen. Die Biopsate wurden dazu dissoziiert (0,1 % Trypsin für 30 min, 37°C) und in KSF Medium (Invitrogen) supplementiert mit 50 &mgr;g/ml Hypophysenextrakt und 50ng/ml EGF ausgesät. Die Zellen wurden in 50 ml Zellkulturflaschen bei 37°C in einem humidifizierten Inkubator in einer 5%igen CO2-Atmosphäre angezogen. Für die Proliferationsassays und Calcium Imaging Experimente wurden die Zellen in Petrischalen (Nunc) kultiviert und nach 3–6 Tagen verwendet. Die Zellmorphologie wurde mit Phasenkontrast Mikroskopie überprüft.

Calcium-Imaging:

Für Calcium-Imaging-Messungen wurden HEK Zellen 2–3 Tage nach transienter Transfektion, LNCaP und primäre Prostataepithelzellen 3–6 Tage nach Aussaat benutzt. Die Zellen wurden vor Messbeginn 30 min bei 37°C in modifizierter Ringer-Lösung mit 3 &mgr;M Fura-2/AM (Molecular Probes) beladen und anschließend 30 min in modifizierter Ringerlösung inkubiert. Die Ringerlösung enthielt gegebenenfalls die jeweils verwendeten Inhibitoren (50 &mgr;M MDL (Sigma) als Blocker der Adenylatzyklase; 10 &mgr;M U73122 (Calbiochem) als Blocker der PhospholipaseC; Ruthenium Red (3 &mgr;M) und 2-APB (50 &mgr;M) als TRP-Kanal Inhibitoren; 1 &mgr;M Tharpasigargin (Calbiochem) zur Entleerung intrazellulärer Calciumspeicher).

Zur Messung wurde ein inverses Mikroskop Axiovert 100 der Firma Zeiss verwendet, die verschiedenen monochromatischen Wellenlängen wurde mit einem Monochromator der Firma T.I.L.L. Photonics erzeugt. Sämtliche Aufnahmen erfolgen über eine CCD-Kamera (Modell PXL37 der Firma Photometrics); die Kamerasteuerung, Aufzeichnung der Meßergebnisse, Datenspeicherung sowie Datenbearbeitung erfolgt mittels des Programms Till Vision 3.03 der Firma T.I.L.L. Photonics.

Die Liganden wurden automatisiert über druckluftbetriebene Kanülen appliziert, die verwendete Konzentration von &bgr;-Ionon und anderen Duftstoffen war 500 &mgr;M, Steroidhormone (Steraloids, USA) wurden in Konzentrationen von 50 &mgr;M auf die Zellen appliziert. Duftstoffe und Steroide wurden in mehreren unabhängigen Experimenten auf eine potentielle Aktivierung von PSGR in HEK Zellen getestet und dann auf Aktivität in LNCaP Zellen hin überprüft. Alle Komponenten wurden als Liganden gewertet, wenn eindeutige Ca2+ Antworten in mehreren unabhängigen Experimenten (n > 7) beobachtet werden konnten und keine Ca2+ Signale in untransfizierten HEK Zellen auftraten. ATP (200 &mgr;M) wurde als Positivkontrolle am Ende jedes Experimentes in HEK Zellen appliziert.

SiRNA Design und Transfektion:

PSGR hairpin siRNA wurde mit dem siRNA Target Designer (Version 1.51 von Promega) entworfen, und die nachfolgend gezeigten, von Invitrogen bezogenen Oligonukleotide

5'-TCTCGCTGCCTCCTGTCATCAATAAGTTCTATTGATGACAGGAGGCAGCCT-3' (SEQ ID NO:3)

5'-CTGCAGGCTGCCTCCTGTCATCAATAGAACTTATTGATGACAGGAGGCAGC-3' (SEQ ID NO:4)

wurden in den Vektor pGeneClipTM hMGFP (Promega) nach Angaben des Hersteller kloniert. LNCaP Zellen wurden in a 35 mm Zellkulturschalen mit 3 &mgr;g/Schälchen siRNA und 9.9 &mgr;l Exgene500 (Fermentas) transfiziert. Die Zellen wurden 48 h nach der Transfektion gemessen.

MAPK Assay:

LNCaP Zellen wurden mit 500 &mgr;M &bgr;-Ionon für 0, 5, 10, 20 und 30 Minuten inkubiert. Lyse-Puffer (50 mM Tris HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 % Triton® X-100, Protease Inhibitor Cocktail (Roche)) wurde direkt nach der Duftapplikation in die Kulturflaschen pipettiert, die Zellen wurden abgelöst und 10 Minuten bei 12,000 g zentrifugiert. Die Überstände wurden dann mit Laemmli Puffer (30 % Glycerin, 3 % SDS, 125 mM Tris/Cl, pH 6.8) gemischt, über 10%ige SDS-PAGE Gele aufgetrennt und auf Nitrozellulose (Protran; Schleicher & Schuell) transferiert. Die Nitrozellulosemembran wurde mit Ponceau 5 (Sigma) gefärbt, mit TBST-M (150 mM NaCl, 50 mM Tris-Cl, Tween20, pH 7.4, 5 % fettfreie Trockenmilch) blockiert und mit den primären Antikörpern inkubiert. Verwendet wurden polyklonale Antikörper gegen SAPK/JNK MAPK und gegen phosphorylierte SAPK/JNK MAPK, sowie polyklonale Antikörper gegen p38 MAPK und phosphorylierte p38 MAPK (alle von New England Biolabs). Nach Waschen und Inkubation mit HRP gekoppelten Sekundärantikörpern (Biorad) wurden die Signale mit ECL plus (Amersham) auf Hyperfilm ECL (Amersham) detektiert.

Proliferationsassay:

LNCaP Zellen und primäre humane Prostataepithelzellen wurden in 96 Well Platten mit einer Dichte 5 × 103 Zellen/Well ausgesät. Nach 24 Stunden bei 37°C mit 5 % CO2 wurden die Zellen entweder mit verschiedenen Konzentrationen &bgr;-Ionon (50 nM bis 250 &mgr;M), DHT (10 nM), oder einer Mischung aus &bgr;-Ionon (250 &mgr;M und 100 &mgr;M) und DHT (10 nM) behandelt. Die Proliferationsraten wurden mit dem CyQUANT Zellproliferations Reagenz (Molecular Probes) wie vom Hersteller beschrieben durchgeführt.

Agoptose Assay:

LNCaP Zellen und primäre humane Prostataepithelzellen wurden mit 10 &mgr;M, 100 &mgr;M und 250 &mgr;M &bgr;-Ionon für 3 Tage behandelt und mikroskopisch untersucht. Die Induktion der Apoptose wurde dann molekularbiologisch über die entstehende DNA Fragmentierung mit einem "Apoptotic DNA Ladder Kit" (Roche) nachgewiesen.

RT-PCR Nachweise:

RNA von LNCaP Zellen und primären humanen Prostataepithelzellen wurde mit Trizol Reagenz (Invitrogen) isoliert, mit DNaseI verdaut und wiederum mit Trizol Reagenz gereinigt vor der Isolation der polyA+ mRNA durch Binden an oligo-dT-beschichtete paramagnetische Partikel (Dynal). cDNA wurde mit MMLV reverser Transkriptase (Invitrogen) und oligo(dT12-18) Primern synthetisiert. Die nachfoldenden Amplifikationen wurden mit 1ng cDNA und spezifischen Primerpaaren für PSGR, PSA, Androgenrezeptor, Cytokeratin8, und Cytokeratin18 über 35 Zyklen (94°C, 1 min/58°C, 1 min/72°C 45 s) durchgeführt.

Beispiel 1

Der zur Familie der Geruchsrezeptoren gehörende G-Protein gekoppelte Rezeptor PSGR kommt in den Epithelzellen der Prostata vor und wird bei der Entstehung von Prostatakrebs im Prostataepithel überexprimiert. Da dieser Rezeptor damit ein potentielles Zielprotein für die Behandlung von Prostatakarzinomen ist, wurde gezielt nach Liganden für diesen speziellen Geruchsrezeptor (OR51E2 oder PSGR) gesucht. Die Aktivierung des Rezeptors durch spezifische Liganden stellt eine Möglichkeit zur Entwicklung einer möglichst gezielten Chemotherapie von Prostatakarzinomen dar. Da der G-Protein gekoppelte Rezeptor PSGR zur Familie der Geruchsrezeptoren gehört, die normalerweise in der Riechschleimhaut Duftmoleküle detektieren, wurde in Mischungen von in der Parfümerie häufig verwendeten, chemisch sehr unterschiedlichen Duftsubstanzen (Alkohole, Aldehyde. Ketone, Amine, aliphatische und aromatische Kohlenwasserstoffe, Heterocyclen usw.) nach potentiellen Liganden für PSGR gesucht worden. Hierzu wurde der Rezeptor kloniert, heterolog in HEK293 Zellen exprimiert und mit Calcium-Imaging Experimenten auf Aktivierbarkeit durch die erwähnten Duftsubstanzen hin untersucht. Aus der Mischung Henkel 100-Mix (enthaltend die fogenden 100 Verbindungen: Geranonitril, Acetophenon, Eucalyptol, Thymol, Anethol, Menthol, Kampfer, Muscone, Citronellol, Süssorangenöl, Cymol (p-Cymen), Eugenol, Geraniol, Hedione, Helional, Lyral, D-Carvon, L-Carvon, Citral a, Benzylacetat, Sassafrasöl, 15-Pentadecanolide, Methylsalicylat, Linalool, Phenylethylalkohol, &agr;-Hexylzimtaldehyd, &agr;-Amylzimtaldehyd, Isobornylacetat, Dihydromyrcenol, Benzylsalicylat, Galaxolid, Terpentinöl, Fixolide NP, Cumarin, Styrylacetat, Piperonal, &bgr;-Ionon, PTBCA 25 cis, Traseolid, Aldehyd C12, Benzylbenzoat, Cyclamenaldehyd, DMBCA, iso-Nonylacetat, Benzophenon, Bourgeonal, Benzylalkohol, OTBCA, Zimtalkohol, Allylheptanoat, Oxyphenylon, Zimtaldehyd, Agrunitril, Brahmanol, Citrathal, Dimetol, Epitone, iso-Nonylalkohol, Phenylethylacetat, Phenirat, Octanal, Ethylfruitat, Hexylacetat, Neobergamat, Anisaldehyd, Citrusal, Cedrylacetate, Ethylvanillin, Evernyl, Ligustral, Dimedon, Sandalore, Vanillin, Aldehyde 11-11 (n-/iso-Undecanal), Aldehyde 13-13 (n-/iso-Tridecanal), Ambroxan (Dodecahydro-3a,6,6,9a-etramethyl-[3aR-(3a.alpha,5a.beta,9a.-alpha,9b.beta]naphto[2,1-b]FIRAN), Anthoxan (4-Isopropyl-5,5-dimethyl-1,3-dioxan), Boisambrene forte (Ethoxymethly-cyclododecylether), Cyclohexylsalicylat, Cyclovertal (3,6(4,6)-Dimethyl-3-cyclohexen-1-carbaldehyd), Floramat (Ethyl-2-tert-butylcyclohexylcarbonat), Herbavert (3,3,5-Trimethylcyclohexylethylether), Irotyl (2-Ethylethylcapronat), Jasmacyclat (2-Cyclohexylpropanal), Melusat (3,5,5-Trimethylethylcapronat), Peranat (2-Methyl,2-methylphenylehter-Pentansäure), Romilat (3-Methly-3-butenyl-2,2-dimethylpropionat), Sandelice, Trivalon, Troenan (5-Methyl-5-propyl-2-(1-methylbutyl)-1,3-dioxan), Verdoxan (2,2,5,5-Tetramethyl-4-isorpopyl-1,3-dioxan), Propidyl, Heptanal, Oktanol, Amylbutyrat, Prenylacetat, Ethylamylketon, Methylhexylketon und Acedyl) konnte als Ligand für PSGR &bgr;-Ionon identifiziert werden (1A).

Um nach möglichen endogenen Liganden zu suchen wurde eine Mischung strukturell ganz verschiedener Steroide auf potentielle Aktivierung des PSGR hin untersucht Die hierfür eingesetzte Mischung enthält folgende Verbindungen: 4,6-Androstadien-17&bgr;-ol-3-on, 4, 6-Androstadien-3-on, 5&agr;-Androstan-3&bgr;,16&bgr;-diol, 5&agr;-Androsten-3&bgr;,17&bgr;-diol, 5&agr;-Androstan-3,7-dion, 5&bgr;-Androsten-3&agr;-ol-11,17-dion, 5&bgr;-Androstan-3&agr;-ol-17-on, 1,4,6-Androstatrien-3,17-dion, 1,4,6-Androstatrien-17&bgr;-ol-3-on, 1,(5&agr;)-Androstan-4-aza-3-on-17&bgr;-(N-tert-butyl-carboxamid), 1,(5&agr;)-Androsten-17&bgr;-ol-3-on, 4-Androsten-3&bgr;,17&bgr;-diol, 4-Androsten-6&bgr;,17&bgr;-diol-3-on, 4-Androsten-11&agr;, 17&bgr;-diol-3-on, 4-Androsten-16&agr;,17&bgr;-diol-3-on, 4-Androsten-11&bgr;-ol-3,17-dion, 5-Androsten-3&bgr;,17&bgr;-diol, 5-Androsten-3&bgr;-ol-17-on, 5-Androsten-3&bgr;,7&agr;-diol-17-on, 16, (5&agr;)-Androsten-3&agr;-ol, 16,(5&agr;)-Androsten-3-on, 3,3'-bis(3,5-Cholestadien), 5&agr;-Cholansäure-3&bgr;-ol, 5&bgr;-Cholansäure, 5&bgr;-Cholansäure-3&agr;,6&agr;-diol, 5&bgr;-Cholansäure-3&agr;,6&bgr;-diol, 5&bgr;-Cholansäure-3&agr;,7&agr;-diol, 5&bgr;-Cholansäure-3&agr;,12&agr;-diol, 5&bgr;-Cholansäure-3&agr;-ol, 5&bgr;-Cholansäure-3&agr;,6&agr;,7&agr;-triol, 5&bgr;-Cholansäure-3&agr;,7&agr;,12&agr;-triol, 5,22-Cholestadien-24&bgr;-methyl-3&bgr;-ol, 5&agr;-Cholestan, 5&bgr;-Cholestan, 5&bgr;-Cholestan-3&agr;-ol, 5,7,22-Cholestatrien-24&bgr;-methyl-3&bgr;-ol, 5-Cholesten-3&bgr;, 25-diol, 5-Cholesten-24&bgr;-ethyl-3&bgr;-ol ~54 %, 5-Cholesten-3&bgr;-ol, 5-Cholesten-3&bgr;-ol-7-on, Diethylstilbestrol, d-1,3,5(10),5,8-Estrapentaen-3-ol-17-on, 1,3,5(10),7-Estratetraen-3-ol-17-on, 1,3,5(10)-Estratrien-3,17&agr;-diol, 1,3,5(10)-Estratrien-3,17&bgr;-diol, 1,3,5(10)-Estratrien-3,17&bgr;-diol-6-on, 1,3,5(10)-Estratrien-17&agr;-ethinyl-3,17&bgr;-diol, 1,3,5(10)-Estratrien-3-ol-17-on, 1,3,5(10)-Estratrien-2,3,17&bgr;-triol 2-Methylether, 1,3,5(10)-Estratrien-3,4,17&bgr;-triol, 1,3,5(10)-Estratrien-3,16&agr;,17&bgr;-triol, 4-Estren-17&agr;-ethinyl-18-homo-17&bgr;-ol-3-on(+/–), 4-Estren-17&agr;-ethinyl-17&agr;-ol-3-on, 4-Estren-17&bgr;-ol-3-on, 23-Nor-5&bgr;-cholansäure-3&agr;,12&agr;-diol, 1,4-Pregnadien-9&agr;-chloro-16&bgr;-methyl-11&bgr;,17&agr;,21-triol-3,20-dion, 1,4-Pregnadien-17,21-diol-3,11,20-trion, 1,4-Pregnadien-9&agr;-fluoro-16&agr;-methyl-11&bgr;,17,21-triol-3,20-dion, 1,4-Pregnadien-9&agr;-fluoro-16&bgr;-methyl-11&bgr;,17,21-triol-3,20-dion, 1,4-Pregnadien-(R,S)-11&bgr;,16&agr;,17,21-tetrol-3,20-dion cyclisches 16,17 Aacetal mit Butyraldehyd, 4,6-Pregnadien-6-chloro-1&agr;, 2&agr;-methylene-17-ol-3,20-dion Acetat, 5&agr;-Pregnan-3&agr;,21-diol-11,20-dion, 5&agr;-Pregnan-3&bgr;, 17-diol-20-on, 5&agr;-Pregnan-3, 20-dion, 5&agr;-Pregnan-3&agr;-ol-11, 20-dion, 5&agr;-Pregnan-3&agr;-ol-20-on, 5&bgr;-Pregnan-3&agr;-ol-20-on, 5&bgr;-Pregnan-3&bgr;-ol-20-on, 5&bgr;-Pregnen-3&agr;,17,20&agr;,21-tetrol-11-on, 4-Pregnen-11&bgr;,17-diol-3,20-dion, 4-Pregnen-11&bgr;,21-diol-3,20-dion, 4-Pregnen-17,21-diol-3,20-dion, 4-Pregnen-17,20&bgr;-diol-3-on, 4-Pregnen-11&bgr;,21-diol-3,18,20-trion, 4-Pregnen-17,21-diol-3,11,20-triol, 4-Pregnen-3,20-dion, 4-Pregnen-17-ol-3,20-dion, 4-Pregnen-21-ol-3,20-dion, 4-Pregnen-11&bgr;,17,21-triol-3,20-dion, 5-Pregnen-3&bgr;,17-diol-20-on, 5-Pregnen-3&bgr;-ol-20-on, Spirolacton, 5&agr;,20&agr;,22&agr;,25D-Spirostan-3&bgr;-ol, 5&agr;,20&agr;,22&agr;,25D-Spirostan-3&bgr;-ol-12-on, 5&bgr;,20&agr;,22&bgr;,25L-Spirostan-3&bgr;-ol und 5,20&agr;,22&agr;,25D-Spirosten-3&bgr;-ol.

6-Dehydrotestosteron, ADT und 1,4,6-Androstatrien-17&bgr;-ol-3-on, die alle ein dem &bgr;-Ionon vergleichbares Strukturmotiv enthalten, konnten aus der Steroidmischung als den Rezeptor aktivierende Substanzen identifiziert werden (1B). Weiterhin wurde Exemestane (6-Methylenandrosta-1,4-diene-3,17-dion) als geeigneter PSGR-Ligand gefunden.

Beispiel 2:

Die gefundenen Liganden wurden daraufhin überprüft, ob sie den Rezeptor auch in dem normalen zellulären Hintergrund aktivieren können und ob auch in Prostatazellen die Ligandenbindung am PSGR zum Einstrom von Calcium und zur Initiation von biochemischen Signalkaskaden führt. Dazu wurde zunächst eine aus Prostataepithel generierte Zelllinie untersucht, in welcher die für den PSGR Rezeptor kodierende RNA bereits nachgewiesen werden konnte (Xu L.L., et al., Cancer Res. 60(23): 6568–72 (2000)). Die gefundenen Ergebnisse sind in 2 dargestellt.

Beispiel 3:

Die durch Ligandenbindung am PSGR in LNCaP Zellen aktivierten Signaltransduktionswege wurden durch pharmakologische Untersuchungen in Calcium-Imaging Experimenten untersucht. Die Ergebnisse sind in 3 gezeigt.

Beispiel 4:

Da der Prostata spezifische Geruchsrezeptor PSGR bei der Entstehung von Prostatakrebs im Prostataepithel überexprimiert wird, ist er ein potentielles Ziel für die Behandlung von Prostatakarzinomen. Es ist deshalb im folgenden untersucht wurden, welche Auswirkungen die Aktivierung des PSGR durch die identifizierten Liganden auf Zellzyklus und Apoptose von Prostatakarzinom-Zelllinien und primären Prostatazellen haben, und welcher Mechanismus dieser Wirkung zugrunde liegt. Die Applikation von &bgr;-Ionon auf die erwähnten Zellen führt dabei zu einer Aktivierung (Phosphorylierung) von zur Familie der MAP-Kinasen gehörenden Proteinen (p38 und SAPK/Jnk) (4). Vermutlich durch die Aktivierung dieser Enzyme wird dann die Proliferationsrate der Zellen verringert und der sogenannte programmierte Zelltod (Apoptose) induziert.

Beispiel 5:

Es ist dann untersucht worden, ob die PSGR vermittelte Aktivierung der MAPK Auswirkungen auf Zellzyklus und Apoptose von Prostatakarzinomzellinien und primären Prostatazellen (PCE – Prostate Cancer Epithelial) hat. Die Aktivierung dieser Enzyme kann in anderen Zellen zur Inhibition der Proliferationsrate der Zellen und zur Induktion der Apoptose führen. Zur Untersuchung primärer Zellkulturen von entartetem Prostataepithel, in welchem PSGR exprimiert sein sollte, wurden in Prostataoperationen entnommene Biopsate in Kultur genommen und mit &bgr;-Ionon stimuliert. Die proliferationshemmende Wirkung des Liganden wurde ausserdem nach durch Testosteron induzierter vermehrter Zellproliferation untersucht. Die Ergebnisse werden in 5 gezeigt.

Beispiel 6:

Um zu überprüfen, ob es sich bei den in Kultur genommenen Zellen aus den Prostatabiopsaten um Epithelzellen handelt, die den PSGR Rezeptor exprimieren, und ob die proliferationshemmenden Effekte von &bgr;-Ionon auch tatsächlich von der Aktivierung des PSGR Rezeptors abhängig sind, wurden die angelegten primären Zellkulturen genauer untersucht. Die Ergebnisse werden in 6 gezeigt.

Es folgt ein Sequenzprotokoll nach WIPO St. 25. Dieses kann von der amtlichen Veröffentlichungsplattform des DPMA heruntergeladen werden.


Anspruch[de]
Verwendung eines Liganden, der an den Geruchsrezeptor 51E2 (PSGR) bindet, zur Behandlung von Krebs oder Tumoren ausgewählt aus Krebs/Tumoren der Haut, der Prostata (Prostatakarzinom) der Lunge, des Darms, der Hoden und der Leber. Verwendung nach Anspruch 1, wobei der Geruchsrezeptorligand ausgewählt ist aus der Gruppe der Riech- oder Aromastoffe und Steroide. Verwendung nach Anspruch 2, wobei der Geruchsrezeptorligand ein Steroid ist, und insbesondere ein Gonan-, Androstan-, Estran- oder Pregnanderivat der nachfolgenden Formeln (I) bis (IV) ist:
Verwendung nach Anspruch 3, wobei das Gonan-, Androstan-, Estran- oder Pregnanderivat

(i) wenigstens eine, vorzugsweise wenigstens zwei C-C-Doppelbindungen aufweist, wobei sich diese C-C-Doppelbindungen bevorzugt in den Positionen 4 und 6 befinden, und/oder

(ii) wenigstens eine, vorzugsweise zwei funktionelle Gruppen unabhängig voneinander ausgewählt aus OH, =O, NH2 und Derivate derselben (insbesondere Ester, Acetale Ketale, Amide oder Imide) trägt, bevorzugt unabhängig. voneinander eine OH und =O in den Positionen 3 und 17 trägt.
Verwendung nach Anspruch 5 oder 6, wobei der Geruchsrezeptorligand ausgewählt ist aus 6-Dehydrotestosteron, 1,4,6-Androstatrien (ADT), 1,4,6-Androstatien-17&bgr;-ol-3-on, Exemestan (6-Methylenandrosta-1,4-dien-3,17-dion), 4,6-Androstadien-17&agr;-methyl-17&bgr;-ol-3-on, 4,6-Androstadien-17&bgr;-ol-3-on Acetat, 4,6-Androstadien-3,17-dion, 4,6-Androstadien-17&bgr;-ol-3-on Benzoat, 4,6-Androstadien-17&bgr;-ol-3-on Carboxymethyloxim, 4-Androsten-3,6,17-trion, 4,6-Estradien-3,17-dion, 4,6-Estradien-17&bgr;-ol-3-on, 4,6-Estradien-17&bgr;-ol-3-on Acetat, 4,6-Pregnadien-3,20-dion, 4,6-Pregnadien-6-methyl-17-ol-3,20-dion Acetat, und 1,4,6-Pregnatrien-3,20-dion, und insbesondere 6-Dehydrotestosteron, 1,4,6-Androstatrien, 1,4,6-Androstatrien-17&bgr;-ol-3-on oder Exemestan ist. Verwendung nach Anspruch 2, wobei der Geruchsrezeptorligand ein Riech- oder Aromastoff ist und vorzugsweise ein Terpen oder Terpenderivat ist und vorzugsweise der Riech- oder Aromastoff zur Behandlung von Krebs/Tumoren der Haut und der Prostata geeignet ist. Verwendung nach Anspruch 6, wobei das Terpen oder Terpenderivat ein Ionon oder Iononderivat, insbesondere ein &bgr;-Ionon oder ein Derivat desselben ist. Verwendung eines steroidischen Geruchsrezeptorliganden, der ein wie in Anspruch 3–5 definiertes Gonan, Estran- oder Pregnanderivat ist, zur Behandlung von Krebs und Tumoren, die den Geruchsrezeptor 51E2 exprimieren und vorzugsweise ausgewählt aus Krebs/Tumoren der Brust, der Ovars (Eierstöcke), der Leber und des Pankreas. Verwendung eines wie in Anspruch 6 oder 7 definierter Riech- oder Aromastoffes zur Behandlung von Krebs und Tumoren, die ausgewählt sind aus Krebs/Tumoren der Brust, der Ovars (Eierstöcke) und des Pankreas. Verwendung nach irgendeinem der Ansprüche 1 bis 9 zur Verlangsamung oder vollständigen Inhibierung des Wachstums und/oder der Proliferation des Tumors.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com