PatentDe  


Dokumentenidentifikation DE60213415T2 20.09.2007
EP-Veröffentlichungsnummer 0001404856
Titel VERFAHREN ZUR HERSTELLUNG VON L-AMINOSÄUREN UNTER VERWENDUNG VON STÄMMEN DER FAMILIE ENTEROBACTERIACEAE
Anmelder Degussa GmbH, 40474 Düsseldorf, DE
Erfinder RIEPING, Mechthild, 33619 Bielefeld, DE
DE-Aktenzeichen 60213415
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE, TR
Sprache des Dokument EN
EP-Anmeldetag 14.06.2002
EP-Aktenzeichen 027407204
WO-Anmeldetag 14.06.2002
PCT-Aktenzeichen PCT/EP02/06565
WO-Veröffentlichungsnummer 2003004598
WO-Veröffentlichungsdatum 16.01.2003
EP-Offenlegungsdatum 07.04.2004
EP date of grant 26.07.2006
Veröffentlichungstag im Patentblatt 20.09.2007
IPC-Hauptklasse C12P 13/06(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12P 13/08(2006.01)A, L, I, 20051017, B, H, EP   C12P 13/12(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
Gebiet der Erfindung

Diese Erfindung betrifft ein Verfahren zur Herstellung von L-Aminosäuren ausgewählt aus der Gruppe L-Threonin, L-Valin, L-Methionin, L-Homoserin und L-Lysin, insbesondere L-Threonin, unter Verwendung von Stämmen der Familie Enterobacteriaceae, wobei mindestens das pgm-Gen Enhancement aufweist.

Stand der Technik

L-Aminosäuren, insbesondere L-Threonin, werden in der Humanmedizin und in der pharmazeutischen Industrie, in der Nahrungsmittelindustrie und speziell in der Tierernährung verwendet.

Es ist bekannt, L-Aminosäuren durch Fermentierung von Stämmen der Enterobacteriaceae, insbesondere Escherichia coli (E. coli) und Serratia marcescens, herzustellen. Wegen ihrer großen Bedeutung wird fortlaufend daran gearbeitet, die Herstellungsverfahren zu verbessern. Verbesserungen des Verfahrens können Fermentierungsmaßnahmen, wie z. B. Rühren und Sauerstoffzufuhr, oder die Zusammensetzung des Nährmediums, wie z. B. der Zuckerkonzentration während der Fermentierung, oder die Aufarbeitung zu der Produktform, durch z. B. Ionenaustauschchromatographie, oder die innewohnenden Ausstoßeigenschaften der Mikroorganismen selbst betreffen.

Verfahren der Mutagenese, Selektion oder Mutantenselektion werden verwendet, um die Ausstoßeigenschaften dieser Mikroorganismen zu verbessern. Stämme, die resistent gegenüber Antimetaboliten sind, wie z. B. dem Threoninanalogon &agr;-Amino-&bgr;-hydroxyvaleriansäure (AHV), oder die auxotroph für Metabolite mit Regulierungsbedeutung sind und L-Aminosäure, wie z. B. L-Threonin, produzieren, werden in dieser Weise erhalten.

Verfahren der rekombinanten DNA-Technik sind seit einigen Jahren auch zur Verbesserung des Stammes der Stämme der Familie Enterobacteriaceae verwendet worden, die L-Aminosäuren produzieren, indem individuelle Gene für die Biosynthese von Aminosäuren amplifiziert werden und die Wirkung auf die Produktion untersucht wird. Es ist aus J. R. Landgraf et al., Biochimie (Paris), Band 76, Nr. 10–11, 1994, Seiten 1063–1070 bekannt, dass verstärkte Exprimierung von H-NS eine verringernde Auswirkung auf die Synthese von Isoleucin hat.

US-A-4 347 318 offenbart ein Verfahren zur Produktion von L-Threonin unter Verwendung von E. coli-Transformanten mit einem Plasmid, das genetisches Material umfasst, welches die L-Threoninsynthese betrifft, das von einem E. coli-Mutanten erhalten wurde, der gegenüber AHV resistent ist.

Koizumi et al. (Journal of Industrial Microbiology & Biotechnology, Oktober 2000, Band 25, Seiten 213–217) offenbart lediglich den Stamm E. coli NM522/pnK11/pNT55, der das pgm-Gen in Plasmid pNT55 aufweist, und betrifft die Produktion von fucosylierten Oligosacchariden.

Gegenstand der Erfindung

Der Gegenstand der Erfindung ist die Bereitstellung neuer Maßnahmen zur verbesserten fermentativen Herstellung von L-Aminosäuren ausgewählt aus der Gruppe L-Threonin, L-Valin, L-Methionin, L-Homoserin und L-Lysin, insbesondere L-Threonin, und die Bereitstellung geeigneter Mikroorganismen.

Zusammenfassung der Erfindung

Die Erfindung liefert ein Verfahren zur Herstellung von L-Aminosäuren ausgewählt aus der Gruppe L-Threonin, L-Valin, L-Methionin, L-Homoserin und L-Lysin, insbesondere L-Threonin, unter Verwendung von Mikroorganismen der Familie Enterobacteriaceae, die insbesondere bereits diese L-Aminosäuren produzieren, und in denen die Nukleotidsequenz, die das pgm-Gen codiert, Enhancement aufweist.

Detaillierte Beschreibung der Erfindung

Wenn L-Aminosäuren oder Aminosäuren nachfolgend genannt sind, bedeutet dies eine oder mehrere Aminosäuren einschließlich ihrer Salze ausgewählt aus der Gruppe bestehend aus L-Threonin, L-Valin, L-Methionin, L-Homoserin und L-Lysin. Besonders bevorzugt ist L-Threonin. Der Begriff "Enhancement" beschreibt in diesem Zusammenhang den Anstieg der intrazellulären Aktivität von einem oder mehreren Enzymen oder Proteinen bei einem Mikroorganismus, die durch die entsprechende DNA codiert sind, beispielsweise durch Erhöhung der Anzahl der Kopien des Gens oder der Gene, unter Verwendung eines potenten Promoters oder eines Gens oder Allels, das ein entsprechendes Enzym oder Protein mit einer hohen Aktivität codiert, und gegebenenfalls Kombinieren dieser Maßnahmen.

Mit Überexprimierung wird die Aktivität oder Anreicherung des entsprechenden Proteins allgemein um mindestens 10 %, 25 %, 50 %, 75 %, 100 %, 150 %, 200 %, 300 %, 400 % oder 500 %, bis zu maximal 1000 % oder 2000 % erhöht, bezogen auf diejenige des Proteins vom Wildtyp oder die Aktivität oder Anreicherung des Proteins in dem Ausgangsmikroorganismus.

Das Verfahren zur Herstellung von L-Aminosäuren ausgewählt aus der Gruppe L-Threonin, L-Valin, L-Methionin, L-Homoserin und L-Lysin ist dadurch gekennzeichnet, dass die folgenden Schritte durchgeführt werden:

  • a) Fermentation von Mikroorganismen der Familie Enterobacteriaceae, die die genannte(n) L-Aminosäure(n) produzieren und in denen das pgm-Gen aus Escherichia coli mittels Transformation überexprimiert wird,
  • b) Anreicherung der L-Aminosäure im Medium oder in den Zellen der Mikroorganismen und
  • c) Isolierung der L-Aminosäure, wobei Bestandteile der Fermentationsbrühe und/oder die Biomasse insgesamt oder teilweise (≥ 0 bis 100 %) gegebenenfalls im Produkt verbleiben.

Mikroorganismen der Familie Enterobacteriaceae, die L-Aminosäuren ausgewählt aus der Gruppe L-Threonin, L-Valin, L-Methionin, L-Homoserin und L-Lysin produzieren und wobei das pgm-Gen aus E. Coli und das thrABC-Operon, dessen Gene Aspartatkinase, Homoserin-Dehydrogenase, Homoserinkinase und Threonin-Synthase codieren, mittels Transformation überexprimiert werden, sind auch Gegenstand der Erfindung.

Die Mikroorganismen, die die vorliegende Erfindung bereitstellt, können diese L-Aminosäuren aus G1ucose, Sucrose, Lactose, Fructose, Maltose, Melassen, gegebenenfalls Stärke, gegebenenfalls Cellulose oder aus Glycerin und Ethanol herstellen. Sie sind auch Vertreter der Familie Enterobacteriaceae ausgewählt aus den Gattungen Escherichia, Erwinia, Providencia und Serratia. Die Gattungen Escherichia und Serratia sind bevorzugt. Von der Gattung Escherichia sind die Spezies Escherichia coli und von der Gattung Serratia die Spezies Serratia marcescens besonders zu erwähnen.

Geeignete Stämme, die insbesondere L-Threonin produzieren, von der Gattung Escherichia, insbesondere der Spezies Escherichia coli, sind beispielsweise

Escherichia coli TF427

Escherichia coli H4578

Escherichia coli KY10935

Escherichia coli VNIIgenetika MG442

Escherichia coli VNIIgenetika M1

Escherichia coli VNIIgenetika 472T23

Escherichia coli BKIIM B-3996

Escherichia coli kat 13

Escherichia coli KCCM-10132.

Geeignete L-Threonin produzierende Stämme der Gattung Serratia, insbesondere der Spezies Serratia marcescens, sind beispielsweise

Serratia marcescens HNr21

Serratia marcescens TLr156

Serratia marcescens T2000.

Stämme der Familie Enterobacteriaceae, die L-Threonin produzieren, haben vorzugsweise ein oder mehrere genetische oder phänotypische Merkmale, die ausgewählt sind aus der Gruppe bestehend aus: Resistenz gegen &agr;-Amino-&bgr;-hydroxyvaleriansäure, Resistenz gegen Thialysin, Resistenz gegen Ethionin, Resistenz gegen &agr;-Methylserin, Resistenz gegen Diaminobernsteinsäure, Resistenz gegen &agr;-Aminobuttersäure, Resistenz gegen Borrelidin, Resistenz gegen Rifampicin, Resistenz gegen Valinanaloga, wie beispielsweise Valinhydroxamat, Resistenz gegen Purinanaloga, wie beispielsweise 6-Dimethylaminopurin, einem Bedarf an L-Methionin, gegebenenfalls einem partiellen und kompensierbaren Bedarf an L-Isoleucin, einem Bedarf an meso-Diaminopimelinsäure, Auxotrophie in Bezug auf Threonin enthaltende Dipeptide, Resistenz gegen L-Threonin, Resistenz gegen L-Homoserin, Resistenz gegen L-Lysin, Resistenz gegen L-Methionin, Resistenz gegen L-Glutaminsäure, Resistenz gegen L-Aspartat, Resistenz gegen L-Leucin, Resistenz gegen L-Phenylalanin, Resistenz gegen L-Serin, Resistenz gegen L-Cystein, Resistenz gegen L-Valin, Empfindlichkeit gegenüber Fluorpyruvat, defekte Threonin-Dehydrogenase, gegebenenfalls eine Fähigkeit zur Ausnutzung von Sucrose, Enhancement des Threonin-Operons, Enhancement der Homoserin-Dehydrogenase I-Aspartatkinase I, vorzugsweise der rückkopplungsresistenten Form, Enhancement der Homoserinkinase, Enhancement der Threonin-Synthase, Enhancement der Aspartat-Kinase, gegebenenfalls der rückkopplungsresistenten Form, Enhancement der Aspartatsemialdehyd-Dehydrogenase, Enhancement der Phosphoenolpyruvat-Carboxylase, gegebenenfalls der rückkopplungsresistenten Form, Enhancement der Phosphoenolpyruvat-Synthase, Enhancement der Transhydrogenase, Enhancement des RhtB-Genprodukts, Enhancement der RhtC-Genprodukts, Enhancement des YfiK-Genprodukts, Enhancement einer Pyruvat-Carboxylase und Abschwächung der Essigsäurebildung.

Es ist gefunden worden, dass Mikroorganismen der Familie Enterobacteriaceae L-Aminosäuren ausgewählt aus der Gruppe L-Threonin, L-Valin, L-Methionin, L-Homoserin und L-Lysin, insbesondere L-Threonin, nach Überexprimierung des pgm-Gens in verbesserter Weise produzieren.

Bevorzugt ist allgemein die Verwendung endogener Gene. "Endogene Gene" oder "endogene Nukleotidsequenzen" sind so zu verstehen, dass die Gene oder Nukleotidsequenzen gemeint sind, die in der Population einer Spezies vorhanden sind.

Die Nukleotidsequenzen der Gene von Escherichia coli gehören zum Stand der Technik und finden sich auch in der Genomsequenz von Escherichia coli, die von Blattner et al. (Science 277: 1453–1462 (1997)) veröffentlicht wurde.

Aus dem Stand der Technik sind unter anderem ferner die folgenden Informationen über das pgm-Gen bekannt:

Beschreibung: Phosphoglucomutase

  • EC Nr.: 5.4.2.2
  • Referenz: Lu und Kleckner, Journal of Bacteriology 176(18): 5847–5851 (1994) Brautaset et al.; Biotechnology and Bioengineering 58(2-3): 299–302 (1998)
  • Accession-Nummer: AE000172

Die Nukleinsäuresequenzen finden sich in den Datenbanken des National Center for Biotechnology Information (NCBI) der National Library of Medicine (Bethesda, MD, USA), der Nukleotidsequenzdatenbank der European Molecular Biologies Laboratories (EMBL, Heidelberg, Deutschland, oder Cambridge, UK) oder der DNA-Datenbank von Japan (DDBJ, Mishima, Japan).

Allele des pgm-Gens, die aus der Degeneration des genetischen Codes oder durch "Sense-Mutationen" der neutralen Funktion resultieren, können außerdem auch verwendet werden.

Um Enhancement zu erreichen, können beispielsweise die Exprimierung der Gene oder die katalytischen Eigenschaften der Proteine erhöht werden. Die beiden Maßnahmen können gegebenenfalls kombiniert werden.

Um eine Überexprimierung zu erreichen, kann die Anzahl der Kopien der entsprechenden Gene erhöht werden, oder der Promoter und die Regulierungsregion oder die Ribosomenbindungsstelle stromaufwärts von dem Strukturgen kann mutiert werden. Exprimierungscassetten, die stromaufwärts von dem Strukturgen eingebaut werden, wirken in der gleichen Weise. Es ist durch induzierbare Promotoren zudem möglich, die Exprimierung im Verlauf der fermentativen Produktion von L-Threonin zu erhöhen. Die Exprimierung wird in ähnlicher Weise durch Maßnahmen verbessert, um die Lebensdauer der m-RNA zu verlängern. Die Enzymaktivität weist zudem auch Enhancement auf, indem der Abbau des Enzymproteins verhindert wird. Die Gene oder Genkonstrukte können entweder in Plasmiden mit einer unterschiedlichen Anzahl an Kopien vorhanden sein, oder können in das Chromosom integriert und in diesem amplifiziert werden.

Alternativ kann eine Überexprimierung der in Frage kommenden Gene ferner erreicht werden, indem die Zusammensetzung der Medien und das Kulturverfahren verändert werden.

Anweisungen findet der Experte in diesem Zusammenhang unter anderem in Chang und Cohen (Journal of Bacteriology 134: 1141–1156 (1978)), in Hartley und Gregori (Gene 13: 347–353 (1981)), in Amann und Brosius (Gene 40: 183–190 (1985)), in de Broer et al. (Proceedings of the National Academy of Sciences of the United States of America 80: 21–25 (1983)), in LaVallie et al. (BIO/TECHNOLOGY 11: 187–193 (1993)), in PCT/US97/13359, in Llosa et al. (Plasmid 26: 222–224 (1991)), in Quandt und Klipp (Gene 80: 161–169 (1989)), in Hamilton (Journal of Bacteriology 171: 4617–4622 (1989)), in Jensen und Hammer (Biotechnology and Bioengineering 58: 191–195 (1998)) und in bekannten Lehrbüchern der Gentechnologie und Molekularbiologie.

Plasmidvektoren, die zur Replikation in Enterobacteriaceae in der Lage sind, wie z. B. Klonierungsvektoren, die von pACYC184 (Bartolomé et al.; Gene 102: 75–78 (1991)), pTrc99A (Amann et al.; Gene 69: 301–315 (1988)) oder pSC101-Derivaten (Vocke and Bastia, Proceedings of the National Academy of Sciences USA 80(21): 6557–6561 (1983)) abgeleitet sind, können verwendet werden. Ein Stamm, der mit einem Plasmidvektor transformiert ist, wobei der Plasmidvektor mindestens eine Nukleotidsequenz trägt, die das pgm-Gen codiert, kann in einem erfindungsgemäßen Verfahren verwendet werden.

Es ist auch möglich, Mutationen, die die Exprimierung des speziellen Gens beeinflussen, durch Sequenzaustausch auf verschiedene Stämme zu übertragen (Hamilton et al.; Journal of Bacteriology 171: 4617–4622 (1989)), Konjugation oder Transduktion.

Es kann ferner für die Produktion der L-Aminosäuren, insbesondere L-Threonin, mit Stämmen der Familie Enterobacteriaceae, vorteilhaft sein, zusätzlich zu der Überexprimierung des pgm-Gens ein oder mehrere Enzyme des bekannten Threonin-Biosynthesestoffwechselwegs oder Enzyme des anaplerotischen Metabolismus oder Enzyme für die Produktion von reduziertem Nicotinamid-Adenindinukleotidphosphat zu überexprimieren.

Beispielsweise können ein oder mehrere der Gene ausgewählt aus der Gruppe bestehend aus

  • • dem für Aspartatkinase, Homoserin-Dehydrogenase, Homoserinkinase und Threonin-Synthase codierenden thrABC-Operon (US-A-4 278 765),
  • • dem für die Pyruvat-Carboxylase codierenden pyc-Gen, (DE-A-19 831 609),
  • • dem für die Phosphoenolpyruvat-Synthase codierenden pps-Gen (Molecular and General Genetics 231(2): 332–336 (1992)),
  • • dem für die Phosphoenolpyruvat-Carboxylase codierenden ppc-Gen (Gene 31: 279–283 (1984)),
  • • den für Transhydrogenase codierenden Genen pntA und pntB (European Journal of Biochemistry 158: 647–653 (1986)),
  • • dem Homoserin-Resistenz verleihenden rhtB-Gen (EP-A-0 994 190),
  • • dem für die Malat:Chinon-Oxidoreduktase codierenden mqo-Gen (WO 02/06459),
  • • dem Threonin-Resistenz verleihenden rhtC-Gen (EP-A-1 013 765),
  • • dem das Threonin-Exportprotein codierenden thrE-Gen von Corynebacterium glutamicum (WO-A-01/92545),
  • • dem für die Glutamat-Dehydrogenase codierenden gdhA-Gen (Nucleic Acids Research 11: 5257–5266 (1983); Gene 23: 199–209 (1983)),
  • • dem für den globalen Regulator Dps codierenden dps-Gen (Genes & Development 6(12B): 2646–2654 (1992), Accession-Nummer AE000183),
  • • dem für den Regulator des Leucin-Regulons Lrp und Hochaffinitäts-Transportsysteme von verzweigtkettigen Aminosäuren codierenden lrp-Gen (Journal of Biological Chemistry 266(17): 10768–10774 (1991), Accession-Nr. AE000191),
  • • dem für das DNA bindende Protein HLP-II codierenden hns-Gen (Molecular and General Genetics 212(2): 199–202 (1988), Accession-Nr. AE000222),
  • • dem für die Fructosebisphosphat-Aldolase codierenden fba-Gen (Biochemical Journal 257: 529–534 (1989), Accession-Nr. AE000376),
  • • dem für die glucosespezifische Komponente IIBC des Phosphotransferasesystems PTS codierenden ptsG-Gen (Journal of Biological Chemistry 261(35): 16398–16403 (1986), Accession-Nr. AE000210),
  • • dem für die Phosphohistidinprotein-Hexose-Phosphotransferase des Phosphotransferasesystems PTS codierenden ptsH-Gen des ptsHIcrr-Operons (Journal of Biological Chemistry 262(33): 16241–16253 (1987), Accession-Nr. AE000329),
  • • dem für das Enzym I des Phosphotransferasesystems PTS codierenden ptsI-Gen des ptsHIcrr-Operons (Journal of Biological Chemistry 262(33): 16241–16253 (1987), Accession-Nr. AE000329),
  • • dem für die glucosespezifische IIA-Komponente des Phosphotransferasesystems PTS codierenden crr-Gen des ptsHIcrr-Operons (Journal of Biological Chemistry 262(33): 16241–16253 (1987), Accession-Nr. AE000329),
  • • dem für das Chaperon GroES codierenden mopB-Gen, (Journal of Biological Chemistry 261(26): 12414–12419 (1986), Accession-Nr. AE000487),
  • • dem für die kleine Untereinheit der Alkylhydroperoxid-Reduktase codierenden ahpC-Gen des ahpCF-Operons (Proceedings of the National Academy of Sciences USA 92(17): 7617–7621 (1995), Accession-Nr. AE000166),
  • • dem für die große Untereinheit der Alkylhydroperoxid-Reduktase codierenden ahpF-Gen des ahpCF-Operons (Proceedings of the National Academy of Sciences USA 92(17): 7617–7621 (1995), Accession-Nr. AE000166),
mittels Transformation überexprimiert werden.

Bevorzugt ist allgemein die Verwendung endogener Gene.

Es kann für die Produktion der L-Aminosäuren, insbesondere L-Threonin, zusätzlich zu der Überexprimierung des pgm-Gens vorteilhaft sein, wenn ein oder mehrere der Gene ausgewählt aus der Gruppe bestehend aus

  • • dem für die Threonin-Dehydrogenase codierenden tdh-Gen (Journal of Bacteriology 169: 4716–4721 (1987)),
  • • dem für die Malat-Dehydrogenase codierenden mdh-Gen (E.C. 1.1.1.37) (Archives in Microbiology 149: 36–42 (1987)),
  • • dem Genprodukt des offenen Leserasters (orf) yjfA (Accession-Nummer ARC77180 des National Center for Biotechnology Information (NCBI, Bethesda, MD, USA)),
  • • dem Genprodukt des offenen Leserasters (orf) ytfP (Accession-Nummer AAC77179 des National Center for Biotechnology Information (NCBI, Bethesda, MD, USA)),
  • • dem für das Enzym Phosphoenolpyruvat-Carboxykinase codierenden pckA-Gen (Journal of Bacteriology 172: 7151–7156 (1990)),
  • • dem für die Pyruvat-Oxidase codierenden poxB-Gen (Nucleic Acids Research 14(13): 5449–5460 (1986)),
  • • dem für das Enzym Isocitrat-Lyase codierenden aceA-Gen (Journal of Bacteriology 170: 4528–4536 (1988)),
  • • dem für den Regulator DgsA des Phosphotransferasesystems codierenden dgsA-Gen (Bioscience, Biotechnology and Biochemistry 59: 256–251 (1995)), das auch unter dem Namen mlc-Gen bekannt ist,
  • • dem für den Fructose-Repressor codierende fruR-Gen (Molecular and General Genetics 226: 332–336 (1991)), das auch unter dem Namen cra-Gen bekannt ist, und
  • • dem für den sigma38-Faktor codierenden rpoS-Gen (WO 01/05939), das auch unter dem Namen katF-Gen bekannt ist,
ausgeschaltet ist bzw. sind oder ihre Exprimierung herabgesetzt ist bzw. sind.

Der Begriff "Abschwächung" beschreibt in diesem Zusammenhang die Reduktion oder Ausschaltung der intrazellulären Aktivität von einem oder mehreren Enzymen (Proteinen) bei einem Mikroorganismus, die durch die entsprechende DNA codiert sind, beispielsweise durch Verwendung eines schwachen Promoters oder eines Gens oder Allels, das ein entsprechendes Enzym oder Protein mit einer niedrigen Aktivität codiert oder das entsprechende Enzym (Protein) oder Gen inaktiviert, und gegebenenfalls Kombinieren dieser Maßnahmen.

Durch abschwächende Maßnahmen wird die Aktivität oder Anreicherung des entsprechenden Proteins allgemein auf 0 bis 75 %, 0 bis 50 %, 0 bis 25 %, 0 bis 10 % oder 0 bis 5 % der Aktivität oder Anreicherung des Proteins vom Wildtyp oder der Aktivität oder Anreicherung des Proteins in dem Ausgangsmikroorganismus herabgesetzt.

Es kann ferner für die Produktion der L-Aminosäuren, insbesondere L-Threonin, zusätzlich zu der Überexprimierung des pgm-Gens vorteilhaft sein, wenn unerwünschte Nebenreaktionen eliminiert werden (Nakayama: "Breeding of Amino Acid Producing Microorganisms", in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (Herausgeber), Academic Press, London, UK, 1982).

Die erfindungsgemäß produzierten Mikroorganismen können in dem Chargenverfahren (Chargenkultur), der gefütterten Charge (Fütterungsverfahren) oder dem wiederholt gefütterten Chargenverfahren (repetitivem Fütterungsverfahren) kultiviert werden. Eine Zusammenfassung bekannter Kulturverfahren ist in dem Lehrbuch von Chmiel (Bioprozesstechnik 1. Einführung in die Bioverfahrenstechnik [Bioprocess Technology 1. Introduction to Bioprocess Technology (Gustav Fischer Verlag, Stuttgart, 1991)) oder in dem Lehrbuch von Storhas (Bioreaktoren und periphere Einrichtungen [Bioreactors and Peripheral Equipment] (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)) beschrieben.

Das zu verwendende Kulturmedium muss den Anforderungen der speziellen Stämme in geeigneter Weise genügen. Beschreibungen von Kulturmedien für verschiedene Mikroorganismen sind in dem Handbuch "Manual of Methods for General Bacteriology" der American Society for Bacteriology (Washington D.C., USA, 1981) enthalten.

Zucker und Kohlehydrate, wie z. B. Glucose, Sucrose, Lactose, Fructose, Maltose, Melassen, Stärke und gegebenenfalls Cellulose, Öle und Fette, wie z. B. Sojaöl, Sonnenblumenöl, Erdnussöl und Kokosfett, Fettsäuren, wie z. B. Palmitinsäure, Stearinsäure und Linolsäure, Alkohole, wie z. B. Glycerin und Ethanol, und organische Säuren, wie z. B. Essigsäure, können als Kohlenstoffquelle verwendet werden. Diese Substanzen können individuell oder als Mischung verwendet werden.

Organische stickstoffhaltige Verbindungen, wie Peptone, Hefeextrakt, Fleischextrakt, Malzextrakt, Maiseinweichflüssigkeit, Sojabohnenmehl und Harnstoff, oder anorganische Verbindungen, wie Ammoniumsulfat, Ammoniumchlorid, Ammoniumphosphat, Ammoniumcarbonat und Ammoniumnitrat, können als Stickstoffquelle verwendet werden. Die Stickstoffquellen können individuell oder als Mischung verwendet werden.

Phosphorsäure, Kaliumdihydrogenphosphat oder Dikaliumhydrogenphosphat oder die entsprechenden natriumhaltigen Salze können als Phosphorquelle verwendet werden. Das Kulturmedium muss ferner Salze von Metallen umfassen, wie z. B. Magnesiumsulfat oder Eisensulfat, die zum Wachstum erforderlich sind. Schließlich können zusätzlich zu den oben genannten Substanzen essentielle Wachstumssubstanzen verwendet werden, wie Aminosäuren und Vitamine. Geeignete Vorläufer können dem Medium außerdem zugesetzt werden. Die genannten Ausgangssubstanzen können der Kultur in Form einer einzelnen Charge zugesetzt werden, oder können während der Kultur in geeigneter Weise eingespeist werden.

Basische Verbindungen, wie Natriumhydroxid, Kaliumhydroxid, Ammoniak oder wässriges Ammoniak, oder saure Verbindungen, wie Phosphorsäure oder Schwefelsäure, können in geeigneter Weise verwendet werden, um den pH-Wert der Kultur zu kontrollieren. Antischaummittel, wie z. B. Fettsäurepolyglykolester, können zur Kontrolle der Schaumentwicklung verwendet werden. Geeignete Substanzen mit einer selektiven Wirkung, z. B. Antibiotika, können dem Medium zugefügt werden, um die Stabilität des Plasmids aufrechtzuerhalten. Um aerobe Bedingungen aufrechtzuerhalten, werden in die Kultur Sauerstoff oder sauerstoffhaltige Gasmischungen, wie z. B. Luft, eingebracht. Die Temperatur der Kultur ist üblicherweise 25°C bis 45°C und vorzugsweise 30°C bis 40°C. Das Kultivieren wird fortgesetzt, bis sich ein Maximum an L-Aminosäuren oder L-Threonin gebildet hat. Dieses Ziel ist üblicherweise in 10 Stunden bis 160 Stunden erreicht.

Die Analyse der L-Aminosäuren kann durch Anionenaustauschchromatographie mit nachfolgender Ninhydrin-Derivatisierung durchgeführt werden, wie von Spackman et al. (Analytical Chemistry 30: 1190–1206 (1958) beschrieben wurde, oder kann durch Reverse-Phase-HPLC erfolgen, wie von Lindroth et al. (Analytical Chemistry 51: 1167–1174 (1979)) beschrieben.

Das erfindungsgemäße Verfahren wird zur verbesserten fermentativen Herstellung von L-Aminosäuren ausgewählt aus der Gruppe L-Threonin, L-Valin, L-Methionin, L-Homoserin und L-Lysin, insbesondere L-Threonin, verwendet.

Die vorliegende Erfindung wird nachfolgend mit Hilfe von Ausführungsbeispielen detaillierter erläutert.

Die verwendeten minimalen (M9) und vollständigen Medien (LB) für Escherichia coli sind von J. H. Miller (A Short Course in Bacterial Genetics (1992), Cold Spring Harbor Laboratory Press) beschrieben worden. Die Isolierung von Plasmid-DNA aus Escherichia coli und alle Techniken der Restriktion, Ligierung, Klenow und Behandlung mit alkalischer Phosphatase wurden nach dem Verfahren von Sambrook et al. durchgeführt (Molecular Cloning – A Laboratory Manual (1989) Cold Spring Harbor Laboratory Press). Wenn nicht anders beschrieben, wurde die Transformation von Escherichia coli nach dem Verfahren von Chung et al. (Proceedings of the National Academy of Sciences of the United States of America (1989) 86: 2172–2175) durchgeführt.

Die Inkubationstemperatur für die Herstellung der Stämme und Transformanten betrug 37°C.

Beispiel 1

Konstruktion des Exprimierungsplasmids pTrc99Apgm Das pgm-Gen von E. coli K12 wurde unter Verwendung der Polymerasekettenreaktion (PCR) und synthetischen Oligonukleotiden amplifiziert. Ausgehend von der Nukleotidsequenz des pgm-Gens in E. coli K12 MG1655 (Accession-Nummer AE000172, Blattner et al. (Science 277: 1453–1462 (1997)), wurden PCR-Primer synthesiert (MWG Biotech, Ebersberg, Deutschland):

pgm1: 5' – CGTTGCAGRCAAAGGACAAAGC – 3' (SEQ ID Nr. 1)

pgm2: 5' – GCGACCGCCCTTTTTTTATTAAATGTG – 3' (SEQ ID Nr. 2)

Die chromosomale K12 MG1655 DNA von E. coli, die für die PCR verwendet wurde, wurde gemäß den Anweisungen des Herstellers mit "Qiagen Genomic-tips 100/G" (QIAGEN, Hilden, Deutschland) isoliert. Ein DNA-Fragment von ungefähr 1700 bp Größe kann mit den spezifischen Primern unter Standard-PCR-Bedingungen (Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press) mit Pfu-DNA-Polymerase (Promega Corporation, Madison, USA) amplifiziert werden. Das PCR-Produkt wurde mit dem Vektor pCR-Blunt II-TOPO (Zero Blunt TOPO PCR Cloning Kit, Invitrogen, Groningen, Niederlande) gemäß den Anweisungen des Herstellers ligiert und in den Stamm E. coli TOP10 transformiert. Die Selektion auf Plasmid tragende Zellen wurde mit LB-Agar durchgeführt, dem 50 &mgr;g/l Kanamycin zugesetzt worden waren. Nach Isolierung der Plasmid-DNA wurde der Vektor pCR-Blunt II-TOPO-pgm mit den Restriktionsenzymen SpeI und XbaI gespalten und nach der Trennung in 0,8 % Agarosegel mit Hilfe des QIAquick Gel Extraction Kit (QIAGEN, Hilden, Deutschland) das pgm-Fragment isoliert. Der Vektor pTrc99A (Pharmacia Biotech, Uppsala, Schweden) wurde mit dem Enzym XbaI gespalten und mit dem isolierten pgm-Fragment ligiert. Der Stamm E. coli XL1-Blue MRF' (Stratagene, La Jolla, USA) wurde mit der Ligierungscharge transformiert, und Plasmid tragende Zellen wurden auf LB-Agar selektiert, dem 50 &mgr;g/ml Ampicillin zugesetzt wurden. Erfolgreiches Klonen kann nach Plasmid-DNA-Isolierung durch Kontrollspaltung mit den Enzymen EcoRV und PvuII gezeigt werden. Das Plasmid wird als pTrc99Apgm bezeichnet (1).

Beispiel 2 Herstellung von L-Threonin mit dem Stamm MG442/pTrc99Apgm

Der L-Threonin produzierende Stamm E. Coli MG442 ist in der Patentschrift von US-A-4 278 765 beschrieben und als CMIM B-1628 in der Russian National Collection for Industrial Microorganisms (VKPM, Moskau, Russland) hinterlegt.

Der Stamm MG442 wurde mit dem in Beispiel 1 beschriebenen Expressionsplasmid pTrc99Apgm und mit dem Vektor pTrc99A transformiert, und Plasmid tragende Zellen wurden auf LB-Agar mit 50 &mgr;g/ml Ampicillin selektiert. Auf diese Weise wurden die Stämme MG442/pTrc99Apgm und MG442/pTrc99A gebildet. Selektierte individuelle Kolonien wurden danach weiter auf minimalem Medium mit der folgenden Zusammensetzung multipliziert: 3,5 g/l Na2HPO4·2H2O, 1,5 g/l KH2PO4, 1 g/l NH4Cl, 0,1 g/l MgSO4·7H2O, 2 g/l Glucose, 20 g/l Agar, 50 mg/l Ampicillin. Die Bildung von L-Threonin wurde in Chargenkulturen von 10 ml überprüft, die in 100 ml Erlenmeierkolben enthalten waren. Hierzu wurden 10 ml Vorkulturmedium mit der folgenden Zusammensetzung: 2 g/l Hefeextrakt, 10 g/l (NH4)2SO4, 1 g/l KH2PO4, 0,5 g/l MgSO4·7H2O, 15 g/l CaCO3, 20 g/l Glucose, 50 mg/l Ampicillin inokuliert, und die Charge wurde 16 Stunden bei 37°C und 180 UpM in einem ESR-Inkubator von Kühner AG (Birsfelden, Schweiz) inkubiert. 250 &mgr;l Portionen dieser Vorkultur wurden in 10 ml Produktionsmedium (25 g/l (NH4)2SO4, 2 g/l KH2PO4, 1 g/l MgSO4·7H2O, 0,03 g/l FeSO4·7H2O, 0,018 g/l MnSO4·1H2O, 30 g/l CaCO3, 20 g/l Glucose, 50 mg/l Ampicillin) transinokuliert, und die Charge wurde 48 Stunden bei 37°C inkubiert. Die Bildung von L-Threonin in dem Ausgangsstamm MG442 wurde in der gleichen Weise untersucht, dem Medium wurde jedoch kein Ampicillin zugesetzt. Nach der Inkubation wurde die optische Dichte (OD) der Kultursuspension mit einem LP2W Photometer von Dr. Lange (Düsseldorf, Deutschland) bestimmt, wobei bei einer Wellenlänge von 660 nm gemessen wurde.

Die Konzentration des gebildeten L-Threonins wurde danach in dem steril filtrierten Kulturüberstand mit einem Aminosäurenanalysegerät von Eppendorf-BioTronik (Hamburg, Deutschland) durch Ionenaustauschchromatographie und Detektion mit nach der Säule erfolgender Umsetzung mit Ninhydrin bestimmt.

Das Ergebnis des Experiments ist in Tabelle 1 gezeigt.

Tabelle 1

Kurze Beschreibung der Figur:

1: Karte des Plasmids pTrc99Apgm, welches das pgm-Gen enthält.

Die Längendaten sind als Näherungsdaten zu verstehen. Die verwendeten Abkürzungen und Bezeichnungen haben die folgende Bedeutung:

  • • Amp: Ampicillinresistenzgen
  • • lacI: Gen für das Repressorprotein des trc-Promotors
  • • Ptrc:trc-Promotorregion, IPTG-induzierbar
  • • pgm: Codierbereich des pgm-Gens
  • • 5S: 5S rRNA-Region
  • • rrnBT: rRNA-Terminatorregion

Die Abkürzungen für die Restriktionsenzyme haben die folgende Bedeutung

  • • EcoRV: Restriktions-Endonuclease aus Escherichia coli B946
  • • PvuII: Restriktions-Endonuclease aus Proteus vulgaris
  • • SpeI: Restriktions-Endonuclease aus Sphaerotilus species ATCC 13923
  • • XbaI: Restriktions-Endonuclease aus Xanthomonas campestris

SEQUENZPROTOKOLL


Anspruch[de]
Verfahren zur Herstellung von L-Aminosäuren, ausgewählt aus der Gruppe L-Threonin, L-Valin, L-Methionin, L-Homoserin und L-Lysin, bei dem man die folgenden Schritte durchführt:

a) Fermentation von Mikroorganismen der Familie Enterobacteriaceae, die die genannte(n) L-Aminosäure(n) produzieren und in denen das pgm-Gen aus Escherichia coli mittels Transformation überexprimiert wird,

b) Anreicherung der L-Aminosäure im Medium oder in den Zellen der Mikroorganismen und

c) Isolierung der L-Aminosäure, wobei Bestandteile der Fermentationsbrühe und/oder die Biomasse insgesamt oder teilweise (≤ 0 bis 100%) gegebenenfalls im Produkt verbleiben.
Verfahren gemäß Anspruch 1, wobei man Mikroorganismen der Familie Enterobacteriaceae fermentiert, in denen zudem gleichzeitig eines oder mehrere der Gene, ausgewählt aus der Gruppe:

2.1 das für Aspartatkinase, Homoserin-Dehydrogenase, Homoserinkinase und Threonin-Synthase codierende thrABC-Operon,

2.2 das für die Pyruvat-Carboxylase codierende pyc-Gen,

2.3 das für die Phosphoenolpyruvat-Synthase codierende pps-Gen,

2.4 das für die Phosphoenolpyruvat-Carboxylase codierende ppc-Gen,

2.5 die für Transhydrogenase codierenden Gene pntA und pntB,

2.6 das Homoserin-Resistenz verleihende rhtB-Gen,

2.7 das für die Malat:Chinon-Oxidoreduktase codierende mqo-Gen,

2.8 das Threonin-Resistenz verleihende rhtC-Gen,

2.9 das für das Threonin-Export-Protein codierende thrE-Gen,

2.10 das für die Glutamat-Dehydrogenase codierende gdhA-Gen,

2.11 das für den globalen Regulator Dps codierende dps-Gen,

2.12 das für den Regulator des Leucin-Regulons Lrp codierende lrp-Gen,

2.13 das für das DNA bindende Protein HLP-II codierende hns-Gen,

2.14 das für die Fructosebisphosphat-Aldolase codierende fba-Gen,

2.15 das für die glucosespezifische Komponente IIBC codierende ptsG-Gen,

2.16 das für die Phosphohistidinprotein-Hexose-Phosphotransferase codierende ptsH-Gen,

2.17 das für Enzym I des Phosphotransferasesystems codierende ptsI-Gen,

2.18 das für die glucosespezifische Komponente IIA codierende crr-Gen,

2.19 das für das Chaperon GroES codierende mopB-Gen,

2.20 das für die kleine Untereinheit der Alkylhydroperoxid-Reduktase codierende ahpC-Gen,

2.21 das für die große Untereinheit der Alkylhydroperoxid-Reduktase codierende ahpF-Gen,

mittels Transformation überexprimiert wird bzw. werden.
Verfahren gemäß Anspruch 1, wobei man Mikroorganismen der Familie Enterobacteriaceae fermentiert, in denen zudem gleichzeitig eines oder mehrere der Gene, ausgewählt aus der Gruppe:

3.1 das für die Threonin-Dehydrogenase codierende tdh-Gen,

3.2 das für die Malat-Dehydrogenase codierende mdh-Gen,

3.3 das Genprodukt des offenen Leserasters (orf) yjfA,

3.4 das Genprodukt des offenen Leserasters (orf) ytfP,

3.5 das für die Phosphoenolpyruvat-Carboxykinase codierende pckA-Gen,

3.6 das für die Pyruvat-Oxidase codierende poxB-Gen,

3.7 das für die Isocitrat-Lyase codierende aceA-Gen,

3.8 das für den Regulator DgsA des Phosphotransferasesystems codierende dgsA-Gen,

3.9 das für den Fructose-Repressor codierende fruR-Gen,

3.10 das für den sigma38-Faktor codierende rpoS-Gen,

ausgeschaltet ist bzw. sind.
Mikroorganismen der Familie Enterobacteriaceae, die L-Aminosäuren, ausgewählt aus der Gruppe L-Threonin, L-Valin, L-Methionin, L-Homoserin und L-Lysin, produzieren, und wobei das pgm-Gen aus E. coli sowie das thrABC-Operon, dessen Gene für Aspartatkinase, Homoserin-Dehydrogenase, Homoserinkinase und Threonin-Synthase codieren, mittels Transformation überexprimiert werden. Mikroorganismen gemäß Anspruch 4, wobei die Mikroorganismen aus der Gattung Escherichia stammen. Mikroorganismen gemäß Anspruch 5, wobei die Mikroorganismen aus der Spezies E. coli stammen.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com