PatentDe  


Dokumentenidentifikation DE69836499T2 11.10.2007
EP-Veröffentlichungsnummer 0001037603
Titel VIRUS MIT MEMBRANMUTATIONEN FÜR EIN WITSSPEKTRUM UND DEREN VERWENDUNG ALS VAKZINSUBSTRAT
Anmelder Research Development Foundation, Carson City, Nev., US
Erfinder BROWN, T., Dennis, Raleigh, NC 27695, US;
HERNANDEZ, Racquel, Raleigh, NC 27695, US
Vertreter Meissner, Bolte & Partner GbR, 80538 München
DE-Aktenzeichen 69836499
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 18.09.1998
EP-Aktenzeichen 989471503
WO-Anmeldetag 18.09.1998
PCT-Aktenzeichen PCT/US98/19556
WO-Veröffentlichungsnummer 1999013818
WO-Veröffentlichungsdatum 25.03.1999
EP-Offenlegungsdatum 27.09.2000
EP date of grant 22.11.2006
Veröffentlichungstag im Patentblatt 11.10.2007
IPC-Hauptklasse C12P 21/06(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C07K 14/18(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
HINTERGRUND DER ERFINDUNG Gebiet der Erfindung

Die vorliegende Erfindung bezieht sich allgemein auf Virologie und Krankheitseindämmung. Insbesondere bezieht sich die vorliegende Erfindung auf mutierte Arthropodenvektor-Viren und ihre Verwendung als Vakzine.

Beschreibung des Standes der Technik

Arthropodenvektor-Viren (Arboviren) sind virale Substanzen, die in der Natur durch blutsaugende Insekten übertragen werden. Viele dieser Viren besitzen Membrandoppelschichten mit darin eingebauten Membranproteinen, die die Schutzhülle des Viruspartikels darstellen (Togaviren) (Schlesinger, S. und M.J. Schlesinger, 1990).

Zusammenfassend stehen die Arthropodenvektor-Viren als Quelle insekten-übertragener Krankheiten und Todesfälle bei Mensch und Tier weltweit gleich nach der Malaria an zweiter Stelle (Berge A.O., 1975). Zu diesen viralen Substanzen gehören die Eastern, Western und Venezuela Equine Encephalitis, das Dengue-Fieber, die japanische Encephalitis, das San Angelo-Fieber und das Gelbfieber. Weiterhin sind durch diese Substanzen ausgelöste Krankheiten als Folge der Einschleppung des Stechmückenvektors Aedes albopictus (Sprenger und Wuithiranyagool, 1985) in Nordamerika wieder auf dem Vormarsch (NIAID, Report of the Task Force on Microbiology and Infectious Diseases 1992, NIH-Veröffentlichung Nr. 92-3320).

Arboviren müssen sich von Natur aus sowohl im Gewebe wirbelloser Insekten als auch im Gewebe des Wirtssäugers replizieren können (Brown, D.T. und L. Condreay, 1986; Bowers et al., 1995). Unterschiede in der genetischen und biochemischen Umgebung dieser beiden Wirtszellsysteme stellen die Basis für die Entstehung von Viren, die sich nur in einem, nicht aber dem anderen Wirt replizieren können, dar (Wirtsbereichmutanten).

Derzeit sind das Dengue-Fiber, die Eastern Equine Encephalitis und andere insektenübertragene Viren in den Vereinigten Staaten wieder auf dem Vormarsch. Die US-Army und andere Regierungsbehörden arbeiten seit den 60er Jahren mit wenig Erfolg an der Herstellung von Vakzinen gegen diese Viren. Daher besteht im Stand der Technik der Bedarf an einem Vakzin gegen die meisten Arthopodenvektor-Viren und andere membranumhüllte Viren. Die vorliegende Erfindung erfüllt diesen im Stand der Technik seit langem bestehenden Bedarf und Wunsch.

ZUSAMMENFASSUNG DER ERFINDUNG

Ein Ziel der vorliegenden Erfindung ist die Bereitstellung eines genetisch manipulierten, membranumhüllten Virus, wobei das Virus ein Transmembranprotein mit einer Deletion einer oder mehrerer Aminosäure(n) codiert, so dass das Transmembranprotein die Virusmembran überspannen kann, wenn sich das manipulierte Virus in Insektenzellen repliziert, die Virusmembran aber nicht überspannen kann, wenn sich das Virus in Säugerzellen repliziert. Eine Ausführungsform dieser Aufgabe der Erfindung stellt ein Arthropodenvektor-Virus als genetisch manipuliertes, membranumhülltes Virus bereit. Weiterhin kann das Arthropodenvektor-Virus in bevorzugten Ausführungsformen aus der Gruppe der Togaviren, Flaviviren und Bunyaviren sowie allen anderen umhüllten Viren, die sich auf natürliche Weise in Säuger- und Insektenzellen replizieren können oder bei denen durch genetische Manipulation des Virus oder der Zelle erreicht wird, dass sie sich in Säuger- und Insektenzellen replizieren, ausgewählt sein.

In einer anderen Ausführungsform der vorliegenden Erfindung wird ein Verfahren zur Herstellung eines Virusvakzins aus einem genetisch manipulierten, membrangebundenen Virus zur Vakzinierung von Säugern bereitgestellt, das folgende Schritte umfasst: Manipulation einer Aminosäuredeletion in einem viralen Transmembranprotein zur Erzeugung eines manipulierten Virus, wobei das Transmembranprotein die Membranhülle überspannen kann, wenn sich das manipulierte Virus in Insektenzellen repliziert, die Membranhülle aber nicht überspannen kann, wenn sich das Virus in Säugerzellen repliziert, und sich das Virus weiterhin in Insektenzellen replizieren kann; Einschleusen des mutierten Virus in Insektenzellen und Replizierenlassen des mutierten Virus in den Insektenzellen zur Erzeugung eines Virusvakzins.

Schließlich ist eine Aufgabe der vorliegenden Erfindung auch die Bereitstellung eines Verfahrens zur Herstellung eines Virusvakzins aus einem genetisch manipulierten, membrangebundenen Virus gegen Krankheiten, die durch eine Wildstechmückenpopulation auf Säuger übertragen werden, das folgende Schritte umfasst: Manipulation einer Aminosäuredeletion in einem viralen Transmembranprotein zur Erzeugung eines manipulierten Virus, wobei das Transmembranprotein die Membranhülle überspannen kann, wenn sich das manipulierte Virus in Stechmückenzellen repliziert, die Membranhülle aber nicht überspannen kann, wenn sich das Virus in Säugerzellen repliziert, und sich das Virus weiterhin in Wildstechmückenzellen replizieren kann; Einschleusen des mutierten Virus in die Wildstechmückenzellen und Replizierenlassen des mutierten Virus in Zellen der Wildstechmückenpopulation zur Erzeugung einer Stechmückenpopulation, die den Vakzinstamm des Virus behält und den (pathogenen) Wildtypvirus ausschließt, so dass der Stechmückenstich das Vakzin auf den gestochenen Säuger überträgt.

Andere und weitere Aspekte, Merkmale und Vorteile der vorliegenden Erfindung gehen aus der nachfolgenden Beschreibung einer der erfindungsgemäß bevorzugten Ausführungsformen hervor. Diese Ausführungsformen dienen der Offenbarung.

KURZE BESCHREIBUNG DER ZEICHNUNGEN

Die beigefügten Zeichnungen sollen die oben genannten Merkmale, Vorteile und Aufgaben der Erfindung verdeutlichen und im Detail verständlich machen. Diese Zeichnungen sind Teil der Spezifikation. Es ist jedoch zu beachten, dass die beigefügten Zeichnungen bevorzugte Ausführungsformen der Erfindung darstellen und den Umfang der Erfindung nicht beschränken sollen.

1 stellt die Ergebnisse radioaktiv markierter Sindbis-Virenproteine dar, die aus transfizierten, in Gewebe gezüchteten Zellen gewonnen wurden. Mock-transfizierte (1) oder mit Mutanten-&Dgr;391-RNA (2) transfizierte BHK-21-Zellen und mit &Dgr;391-RNA (3) transfizierte Aedes albopictus-Zellen wurden wie in Beispiel 3 beschrieben mit radioaktiven Aminosäuren markiert. 24 Stunden nach der Transfektion wurden die Proteine wie in Beispiel 4 beschrieben mit virus-spezifischem Antiserum ausgefällt. Die Figur zeigt, dass sowohl BHK-21-Zellen als auch Aedes albopictus-Zellen, die mit RNA der Deletionsmutante transfiziert worden waren, die drei Virusstrukturproteine E1, E2 und C erzeugen, die in den mock-transfizierten Zellen nicht nachgewiesen werden.

Die 2a und 2b sind elektronenmikroskopische Aufnahmen von BHK-21-Zellen (2a) und Aedes albopictus-Zellen (2b), die mit RNA der Sindbis-Virusdeletionsmutante &Dgr;391 transfiziert worden sind. Die Zellen wurden wie in Beispiel 2 beschrieben transfiziert. Die BHK-21-Zellen (a) erzeugen Ansammlungen von Viruskernstrukturen im Zellzytoplasma (A), auch wenn diese Zellen kein reifes Virus erzeugen (Tabelle 1). Die Aedes albopictus-Zellen (b) erzeugen ebenfalls Ansammlungen von Viruskernen; diese Kerne liegen zwar ähnlich denen in BHK-21-Zellen frei im Zellzytoplasma vor (A), sind jedoch auch mit Zellmembranen assoziiert (B). Letzteres findet bei BHK-21-Zellen nicht statt, was darauf deutet, dass die Glycoproteine E1 und E2 zwar vorliegen, sich aber nicht an sie binden.

3 stellt die Konfiguration von Sindbis-Virusglycoproteinen nach dem Einbau in das ER dar. Das Protein ist ein Multipass-Protein mit sechs membran-überspannenden Domänen (Nummer 1 bis 6): 1. Signalsequenz für den anfänglichen Einbau, 2. erste E2-Transmembrandomäne (TMD), 3. zweite E2-TMD, 4. erste 6k-TMD, 5. zweite 6k-TMD, 6. E1-TMD. S = Spaltungsstelle für Signalpeptidase.

4 stellt die deletierten Aminosäuren in der E2-Transmembrandomäne dar. Die deletierte Sequenz ist unter der jeweiligen Aminosäure dargestellt (Deletion 1 bis 16). Die bei Nukleotid 9787 beginnenden Histidin- und Prolinsequenzen befinden sich zwar auf der Lumenseite des Proteins, werden aber zur Entwicklung der mutagenen Primer eingesetzt.

DETAILLIERTE BESCHREIBUNG DER ERFINDUNG

Der Begriff "membrangebundenes Virus", wie er hierin verwendet wird, bezieht sich auf ein Virus, das eine Lipidmembrandoppelschicht als Teil seiner äußeren Schutzhülle enthält.

Der Begriff "Virushülle", wie er hierin verwendet wird, bezieht sich auf die Lipidmembrankomponente des membranhaltigen Virus und deren Proteine.

Die Begriffe "Arthropodenvektor-Virus" oder "Arbovirus", wie sie hierin verwendet werden, beziehen sich auf virale Substanzen, die sich replizieren und Virennachkommen in Zellen von Arthropoden (Insekten) oder Säugern erzeugen. Dazu gehören Togaviren, Flavivieren und Bunyaviren.

Der Begriff "Togavirus", wie er hierin verwendet wird, bezieht sich auf eine allgemeine Klassifizierung membranhaltiger Viren wie z.B. Alphaviren.

Der Begriff "Membrandoppelschicht", wie er hierin verwendet wird, bezieht sich auf eine Struktur aus gegenüber liegenden amphiphatischen Phospholipiden. Der Querschnitt der Doppelschicht ist wie folgt organisiert: polare Kopfgruppen, nicht-polare Kohlenstoffketten, nicht-polare Kohlenstoffketten, polare Kopfgruppen.

Der Begriff "Glycoprotein-Transmembranregion", wie er hierin verwendet wird, bezieht sich auf die Aminosäuresequenz der Region eines in die Membran eingebauten Proteins, das die Membrandoppelschicht überspannt.

Der Begriff "Virusvakzin", wie er hierin verwendet wird, bezieht sich auf einen Virusstamm oder einen Virusmutantenstamm, der die antigenen Eigenschaften des Virus aufweist, jedoch nicht krankheitserzeugend ist.

Der Begriff "Immunüberwachung", wie er hierin verwendet wird, bezieht sich auf einen Prozess, bei dem die Lymphozyten im Blut Zellen und Gewebe eines Säugers bezüglich des Vorliegenens fremder (viraler) Proteine überwachen und der die Herstellung von Lymphozyten, die das fremde Proteine erzeugende Zellen gezielt vernichten können, stimuliert. Dieser Prozess führt außerdem zur Herstellung zirkulierender Antikörper gegen das fremde Protein.

Der Begriff "infektiöse Viruspartikel", wie er hierin verwendet wird, bezieht sich auf Viren, die ungeachtet ihrer Fähigkeit zur Erzeugung von Virennachkommen in eine Zelle eindringen und Virusprotein erzeugen können.

Der Begriff "nicht-infektiöse Viruspartikel", wie er hierin verwendet wird, bezieht sich auf Viren, die eine Zelle nicht infizieren bzw. nicht in sie eindringen können.

Der Begriff "Wirbeltierzellen", wie er hierin verwendet wird, bezieht sich auf Säugerzellen.

Der Begriff "Zellen Wirbelloser", wie er hierin verwendet wird, bezieht sich auf Insektenzellen.

Die vorliegende Erfindung bezieht sich auf ein genetisch manipuliertes, membranumhülltes Virus, wobei das Virus ein Transmembranprotein mit einer Deletion einer oder mehrerer Aminosäure(n) in dem Transmembranprotein codiert, so dass das Transmembranprotein die Virusmembran überspannen kann, wenn sich das manipulierte Virus in Insektenzellen repliziert, die Virusmembran aber nicht überspannen kann, wenn sich das Virus in Säugerzellen repliziert. Eine Ausführungsform dieser Aufgabe der Erfindung stellt ein Arthropodenvektor-Virus bereit, das aus der Gruppe der Togaviren, Flaviviren und Bunyaviren sowie allen anderen umhüllten Viren, die sich auf natürliche Weise in Säuger- und Insektenzellen replizieren können oder bei denen durch genetische Manipulation des Virus oder der Zelle erreicht wird, dass sie sich in Säuger- und Insektenzellen replizieren, ausgewählt ist.

Die vorliegende Erfindung bezieht sich darüber hinaus auf ein Verfahren zur Herstellung eines Virusvakzins aus einem genetisch manipulierten, membrangebundenen Virus zur Vakzinierung von Säugern, das folgende Schritte umfasst: Manipulation einer Aminosäuredeletion in einem viralen Transmembranprotein zur Erzeugung eines manipulierten Virus, wobei das Transmembranprotein die Membranhülle überspannen kann, wenn sich das manipulierte Virus in Insektenzellen repliziert, die Membranhülle aber nicht überspannen kann, wenn sich das Virus in Säugerzellen repliziert, und sich das Virus weiterhin in Insektenzellen replizieren kann; Einschleusen des mutierten Virus in Insektenzellen, was zur Entstehung des mutierten Virus, der als Vakzin dienen kann, führt.

Weiterhin stellt die vorliegende Erfindung ein Verfahren zur Herstellung eines Virusvakzins gegen Krankheiten, die durch eine Wildstechmückenpopulation übertragen werden, bereit, das folgende Schritte umfasst: genetische Manipulation einer Aminosäuredeletion in einem viralen Transmembranprotein zur Erzeugung eines manipulierten Virus, wobei das Transmembranprotein die Membranhülle überspannen kann, wenn sich das manipulierte Virus in Stechmückenzellen repliziert, die Membranhülle aber nicht überspannen kann, wenn sich das Virus in Säugerzellen repliziert, und sich das Virus weiterhin in Stechmückenzellen replizieren kann; Einschleusen des mutierten Virus in die Wildstechmückenpopulation und Replizierenlassen des mutierten Virus in den Zellen der Wildstechmückenpopulation zur Erzeugung einer Stechmückenpopulation, die den Vakzinstamm des Virus behält und den (pathogenen) Wildtypvirus ausschließt, so dass der Steckmückenstich das Vakzin auf den gestochenen Säuger überträgt.

Erfindungsgemäß können herkömmliche molekularbiologische, mikrobiologische und rekombinante DNA-Techniken aus dem Stand der Technik eingesetzt werden. Solche Techniken sind in der Literatur detailliert erläutert (siehe z.B. Maniatis, Fritsch und Sambrook "Molecular Cloning: A Laboratory Manual", 1982; "DNA Cloning: A Practical Approach", Band I und II (Hrsg. D.N. Glover, 1985); "Oligonucleotide Synthesis" (Hrsg. M.J. Gait, 1984); "Nucleic Acid Hybridization" (Hrsg B.D. Hames und S.J. Higgins, 1985); "Transcription and Translation" (Hrsg. B.D. Hames und S.J. Higgins, 1984); "Animal Cell Culture" (Hrsg. R.I. Freshney, 1986); "Immobilized Cells and Enzymes" (IRL Press, 1986); B. Perbal "A Practical Guide to Molecular Cloning" (1984).

Daher sind die nachfolgenden Begriffe, sofern sie hierin verwendet werden, wie unten aufgeführt definiert.

Ein "Vektor" ist ein Replikon wie z.B. ein Plasmid, Phage oder Cosmid, an das ein anderes DNA-Segment angefügt werden kann, um die Replikation des angefügten Segmentes auszulösen. Ein Vektor gilt als "pharmakologisch akzeptabel", wenn seine Verabreichung vom Empfängertier vertragen wird. Eine solche Substanz gilt z.B. als in "therapeutisch wirksamer Menge" verabreicht, wenn die verabreichte Menge physiologisch signifikant ist. Eine Substanz ist physiologisch signifikant, wenn ihr Vorliegen zu einer Veränderung der Physiologie des Empfängersäugers führt. Bei der Behandlung einer Virusinfektion würde beispielsweise eine Verbindung, die das Ausmaß der Infektion oder die durch sie verursachte physiologische Schädigung mindert, als therapeutisch wirksam gelten.

"DNA-Molekül" bezieht sich auf die Polymerform der Desoxyribonukleotide (Adenin, Guanin, Thymin oder Cytosin) in Form eines Einzelstranges oder einer Doppelstranghelix. Dieser Begriff bezieht sich nur auf die primäre und sekundäre Struktur des Moleküls und beschränkt es nicht auf spezielle tertiäre Formen. Daher schließt dieser Begriff auch doppelsträngige DNA ein, die sich unter anderem in linearen DNA-Molekülen (z.B. Restriktionsfragmenten), Viren, Plasmiden und Chromosomen findet. Bei der Diskussion der Struktur wird wie normalerweise üblich nur die Sequenz in 5'-3'-Richtung entlang des nicht transkribierten DNA-Stranges (z.B. des Stranges mit einer zu der mRNA homologen Sequenz) angegeben.

Eine DNA-"Codiersequenz" ist eine doppelsträngige DNA-Sequenz, die bei Kontrolle durch die jeweiligen regulatorischen Sequenzen in vivo in ein Polypeptid transkribiert und translatiert wird. Die Grenzen der Codiersequenz werden durch ein Startcodon am 5'-(Amino)ende und ein Translationsstopcodon am 3'-(Carboxyl)ende bestimmt. Eine Codiersequenz kann z.B., jedoch nicht ausschließlich prokaryontische Sequenzen, cDNA eukaryontischer mRNA, Genom-DNA-Sequenzen eukaryontischer (z.B. Säugetier-)DNA und sogar synthetische DNA-Sequenzen umfassen. Am 3'-Ende der Codiersequenz befinden sich für gewöhnlich ein Polyadenylierungssignal und eine Transkriptionsbeendigungssequenz.

Transkriptions- und Translationskontrollsequenzen sind DNA-regulatorische Sequenzen wie Promotoren, Enhancer, Polyadenylierungssignale, Terminatoren und dergleichen, die für die Expression einer Codiersequenz in einer Wirtszelle sorgen.

Eine "Promotorsequenz" ist eine DNA-Regulationsregion, die RNA-Polymerase in einer Zelle binden und die Transkription einer nachgeschalteten (3'-Richtung) Codiersequenz initiieren kann. Zum Zwecke der Definition der vorliegenden Erfindung ist die Promotorsequenz an ihrem 3'-Ende an den Transkriptionsinitiierungsort gebunden und erstreckt sich stromaufwärts (5'-Richtung), so dass sie die Mindestanzahl an Basen und Elementen einschließt, die für die Initiierung der Transkription auf einem vor dem Hintergrundrauschen nachweisbaren Niveau notwendig sind. In der Promotorsequenz finden sich ein Transkriptionsinitiierungsort (zweckmäßigerweise definiert durch Kartierung mit Nuklease S1) sowie für die Bindung von RNA-Polymerase verantwortliche Proteinbindungsdomänen (Consensus-Sequenzen). Eukaryontische Protomoren enthalten häufig, aber nicht immer "TATA"-Boxen und "CAT"-Boxen. Für den Vektorantrieb können verschiedene Promotoren eingesetzt werden.

Der Begriff "Oligonukleotid" oder "Sonde", wie er hierin verwendet wird, bezieht sich auf ein Molekül aus Ribonukleotiden oder Desoxyribonukleotiden. Die genaue Größe des Oligonukleotids oder der Sonde hängt von vielen Faktoren ab, die wiederum von der letztendlichen Funktion und dem Verwendungszweck des Oligonukleotids abhängen. Die Länge der Sonde ist nicht ausschlaggebend, sie umfasst jedoch üblich mindestens etwa 12 Basen, noch üblicher mindestens etwa 16 Basen. Die Sonde ist im Wesentlichen komplementär zu einem Teil des Bakteriengenoms, muss aber zu dem Genom nicht vollständig komplementär sein. Die Sonden können mittels geeigneter Synthesetechniken synthetisch hergestellt werden und enthalten höchstwahrscheinlich eine nachweisbare Markierung. Für gewöhnlich werden die synthetischen Sequenzen in häufig verwendeten, öffentlich erhältlichen Klonierungsvektoren und geeigneten Wirten expandiert, um große Mengen der Sonde zu erhalten. Die expandierten Vektoren können selbst zur Verwendung als Sonden markiert werden oder es können kürzere Fragmente mit komplementären Strängen ausgeschnitten und markiert werden. Verfahren zur Herstellung und Nutzung von Nukleotidsonden für diagnostische Tests sind in der oben genannten Literatur und dem US-Patent Nr. 4,358,535 von Falkow et al. beschrieben.

Der Begriff "Primer", wie er hierin verwendet wird, bezieht sich auf ein in einem gereinigten Restriktionsdigest natürlich vorkommendes oder synthetisch erzeugtes Oligonukleotid, das unter Bedingungen, bei denen die Synthese eines zu einem Nukleinsäurestrang komplementären Primer-Extensionsproduktes induziert wird, d.h. in Gegenwart von Nukleotiden und eines Induktionsmittels wie z.B. DNA-Polymerase sowie bei geeigneter Temperatur und geeignetem pH-Wert, als Syntheseinitiierungsstelle dienen kann. Der Primer kann ein- oder doppelsträngig sein und muss ausreichend lang sein, um die Synthese des gewünschten Extensionsproduktes in Gegenwart des Induktionsmittels zu starten. Die genaue Länge des Primers hängt von vielen Faktoren wie Temperatur, Primer-Quelle und dem eingesetzten Verfahren ab. Für diagnostische Anwendungszwecke enthält der Oligonukleotid-Primer beispielsweise je nach Komplexität der Zielsequenz typischerweise 15 bis 25 oder mehr Nukleotide, es können aber auch weniger sein.

Die hierin verwendeten Primer sind so ausgewählt, dass sie "im Wesentlichen" komplementär zu unterschiedlichen Strängen einer bestimmten DNA-Zielsequenz sind. Das heißt, die Primer müssen ausreichend komplementär sein, um mit den jeweiligen Strängen zu hybridisieren. Daher darf die Primer-Sequenz nicht die genaue Sequenz der Vorlage widerspiegeln. Am 5'-Ende des Primers kann sich beispielsweise ein nicht-komplementäres Nukleotidfragment befinden; der Rest der Primer-Sequenz ist komplementär zu dem Strang. Alternativ können in dem Primer nicht-komplementäre Basen oder längere Sequenzen eingestreut sein, vorausgesetzt die Primer-Sequenz ist zu der Sequenz ausreichend komplementär oder hybridisiert mit ihr, so dass die Vorlage für die Synthese des Extensionsproduktes entsteht.

Die Begriffe "Restriktionsendonukleasen" und "Restriktionsenzyme", wie sie hierin verwendet werden, beziehen sich auf Bakterienenzyme, die doppelsträngige DNA an oder in der Nähe einer speziellen Nukleotidsequenz zerschneiden.

Eine Zelle wurde durch exogene oder heterologe DNA "transfiziert", wenn eine solche DNA in die Zelle eingeschleust wurde. Die Transfektions-DNA kann in das Zellgenom eingebaut (kovalent gebunden) werden. Ein "Klon" ist eine von einer Einzelzelle oder einem gemeinsamen Vorgänger durch Mitose abgeleitete Zellpopulation. Eine "Zelllinie" ist ein Klon einer Primärzelle, der in vitro über viele Generationen stabil wachsen kann.

Eine "heterologe" Region des DNA-Konstrukts ist ein identifizierbares DNA-Segment in einem größeren DNA-Molekül, das sich in der Natur nicht in Kombination mit dem größeren Molekül findet. Daher ist ein Säugergen, das von der heterologen Region codiert wird, für gewöhnlich von DNA flankiert, die die Säugergenom-DNA in dem Genom des Quellorganismus nicht flankiert. In einem anderen Beispiel ist die Codiersequenz ein Konstrukt, wobei sich die Codiersequenz selbst in der Natur nicht findet (z.B. cDNA, bei der die Genomcodiersequenz Introns enthält, oder synthetische Sequenzen mit anderen Codons als in dem nativen Gen).

Es wird erwogen, dass sich pharmazeutische Zusammensetzungen unter Verwendung der erfindungsgemäßen neuartigen mutierten Viren herstellen lassen. In einem solchen Fall umfasst die pharmazeutische Zusammensetzung das erfindungsgemäße neuartige Virus sowie einen pharmazeutisch akzeptablen Träger. Der Fachmann kann die geeigneten Dosierungen und Verabreichungswege dieser Vixusvakzinverbindung leicht ohne übermäßiges Experimentieren bestimmen. Bei therapeutischer Anwendung in vivo wird das erfindungsgemäße Vakzin dem Patienten oder einem Tier in therapeutisch wirksamen Mengen verabreicht, d.h. in Mengen, die das behandelte Individuum gegen die Krankheit, die das jeweilige Virus überträgt, immunisieren. Die Verabreichung erfolgt normalerweise parenteral, vorzugsweise intravenös, doch es können ggf. auch andere Verabreichungswege genutzt werden. Die verabreichte Menge des Vakzins liegt typischerweise im Bereich von etwa 103 bis etwa 106 pfu/kg Körpergewicht des Patienten. Das Dosierungsschema wird fortgesetzt, um die Wirksamkeit zu optimieren und gleichzeitig negative Behandlungseffekte auszugleichen (siehe Remington's Pharmaceutical Science, 17. Ausgabe, 1990, Mark Publishing Co., Easton, Penn. und Goodman and Gilman's: The Pharmacological Basis of Therapeutics, 8. Ausgabe, 1990, Pergamon Press, auf die hierin Bezug genommen wird). Für die parenterale Verabreichung ist das Vakzin typischerweise in Form injizierbarer Dosiseinheiten (Lösung, Suspension, Emulsion) zusammen mit einem pharmazeutisch akzeptablen parenteralen Arzneimittelträger formuliert. Solche Arzneimittelträger sind vorzugsweise nicht toxisch und nicht therapeutisch. Beispiele für solche Arzneimittelträger sind Wasser, Kochsalzlösung, Ringer-Lösung, Dextroselösung und 5% Humanserumalbumin.

Die erfindungsgemäßen Vakzine basieren auf Deletionsmutationen in den Transmembrandomänen von Proteinen membranumhüllter Viren. Die Strategie zur Erzeugung dieser Mutationen basiert auf den folgenden Informationen: Anders als Säugerzellmembranen enthalten die Membranen von Insektenzellen kein Cholesterin (Clayton, 1964; Mutsuhashi et al., 1983). Das Vorliegen von Cholesterin in Membranen macht die Membran im Allgemeinen dicker, wobei die Dicke mit zunehmender Cholesterinmenge zunimmt (Bretscher, 1993). Viele membranumhüllte Viren besitzen Membranglycoproteine auf ihrer Oberfläche, die für die Identifizierung und Infektion von Zielzellen verantwortlich sind (Schlesinger, S. und M.J. Schlesinger, 1990). Diese Membranglycoproteine besitzen hydrophobe, membran-überspannende Domänen, die die Proteine in der Membrandoppelschicht verankern (Rice et al., 1982).

Die membran-überspannenden Domänen dieser Transmembranproteine müssen lang genug sein, um von einer Seite der Doppelschicht zur anderen zu reichen und die Proteine so in der Membran zu halten bzw. zu verankern. Experimente haben gezeigt, dass sich die Proteine bei Verkürzung der Domänen durch Deletion von Aminosäuren in der Domäne nicht richtig mit der Membran assoziieren und herausfallen (Adams und Rose, 1985).

Da Insekten kein Cholesterin in ihren Membranen aufweisen, besitzt die in Insekten erzeugte Virusmembran einen dünneren Querschnitt als die in Säugern erzeugte Virusmembran. Da die Membranen von Insekten dünner sind, müssen die membranüberspannenden Domänen von Proteinen, die in Insektenmembranen eingebaut werden, nicht so lang sein wie die, die in Säugermembranen eingebaut werden. Daher können in manipulierten Viren Deletionen erzeugt werden, die Aminosäuren aus der Transmembrandomäne des viralen Glycoproteins entfernen. Dies führt zu einem Glycoprotein, das normal in die Membran einer Virusreplikation in einer Insektenzelle eingebaut werden kann, nicht aber in die Membran eines Virus, das sich in einem Säuger repliziert. Daher wird das mutierte Virus in der sich replizierenden Insektenzelle und dem Wildtyp-Stammvirus im Insektenwirt erzeugt. Andererseits kann das mutierte Virus den Virusproteine erzeugenden Wirt bei Säugern infizieren; da jedoch das Glycoprotein des mutierten Virus die Säugermembran nicht überspannen und nicht in ihr verankert werden kann, können keine Virennachkommen in Säugerzellen erzeugt werden. Ein weiterer Vorteil des erfindungsgemäßen Ansatzes ist, dass die Mutanten als Deletionsmutanten manipuliert werden, so dass es unmöglich zu einer Rückmutation zum Wildtyp-Phänotyp – einem bei Virusvakzinen häufig auftretenden Problem – kommen kann.

Die von der vorliegenden Erfindung erwogenen Vakzine funktionieren bei allen membranumhüllten Viren, die in den Zellen von Wirbeltieren und Wirbellosen wachsen. De facto kann die vorliegende Erfindung bei membranumhüllten Viren, die so manipuliert wurden, dass sie in einer Insektenzelle wachsen, oder membranumhüllten Viren, die in genetisch modifizierten Insektenzellen wachsen, zur Anwendung kommen.

Die nachfolgenden Beispiele dienen der Veranschaulichung verschiedener Ausführungsformen der Erfindung und sollen die vorliegende Erfindung in keiner Weise beschränken.

BEISPIEL 1 Ortsspezifische Mutagenese von Toto 1101

Unter Verwendung des Klons voller Länge des zuvor beschriebenen Alphavirus Sindbis (Liu et al., 1996; Rice et al., 1987) wurde eine Deletion konstruiert, die drei ein Lysin an der Position 391 in der Aminosäuresequenz des viralen Glycoproteins E2 codierende Basen entfernt. Dieses Lysin ist Teil der mutmaßlichen membran-überspannenden Domäne dieses Proteins (Rice et al., 1982).

Mittels ortsspezifischer Mutagenese wurde eine Deletionsmutante (Lys391) in Toto 1101 erzeugt, einem Plasmid, das die Sindbis-cDNA voller Länge und einen SP6-Promotor, der zur Transkription infektiöser RNA von dem Klon in vitro verwendet werden kann, enthält (Rice et al., 1987; Liu und Brown, 1993a). Mit Hilfe des zuvor beschriebenen Megaprimer-Verfahrens (Liu und Brown, 1993a) der PCR-Mutagenese (Sarkar und Sommer, 1990) wurden drei Nukleotide in dem cDNA-Klon von Toto 1101 – die Nukleotide (nts) 9801, 9802 und 9803 – entfernt, was zu Entfernung des Codons AAA (K391) führte.

Ein 30 Basen umfassendes Oligonukleotid der Sequenz 5'CTCACGGCGCGCACAGGCACATAACACTGC3' (SEQ-ID Nr. 1) wurde als Mutagenese-Primer verwendet. Dieser Primer erzeugte zusammen mit dem "Vorwärtsprimer" 5'CCATCAAGCAGTGCGTCG3' (SEQ-ID Nr. 2; 18-mer) einen 518 Basen umfassenden "Megaprimer" (Nukleotide 9295-9813). Diese zweite PCR-Reaktion bestand aus 0,5 &mgr;g Megaprimer, 100 &mgr;g Toto 1101-Vorlage und 0,5 &mgr;g "Umkehrprimer" 5'GGCAGTGTGCACCTTAATCGCCTGC3' (SEQ-ID Nr. 3). Bei allen PCR-Reaktionen fanden 30 Zyklen statt (1 Minute bei 95 Grad, 1 Minute bei 64 Grad, 1 Minute bei 72 Grad und 8-minütige endgültige Inkubation bei 72 Grad). Das entstandene PCR-Produkt (1149 nts) wurde mittels BCLI und SPL gespalten und an dem entsprechenden Ort in Toto 1101 eingefügt, so dass die Deletionsmutante K391 entstand. Nach Bestätigung der Deletion durch Didesoxynukleotidsequenzierung der gesamten subklonierten Region mittels SequenaseTM (US Biochemical, Cleveland, OH) wurde infektiöse RNA in vitro mittels SP6-Polymerase transkribiert und in BHK-21-Zellen eingeschleust (transfiziert).

BEISPIEL 2 In vitro-Transkription und RNA-Transfektion

Plasmid-DNA mit einer cDNA-Kopie voller Länge des Sindbis-Virus K391 oder der Wildtyp-RNA wurde mit XhoI linearisiert und wie zuvor beschrieben in vitro mit SP6-RNA-Polymerase transkribiert (Rice et al., 1987). 1 &mgr;g mit XhoI linearisierte K391-cDNA oder Wildtyp-Sindbis-Virus-cDNA wurde in einem Puffer bestehend aus 80 mM Hepes (pH 7,5), 12 mM MgCl, 10 mM DTT und 2 mM Spermidin sowie 100 &mgr;g BSA mit jeweils 3 mM ATP, UTP bzw. CTP, 1,5 mM GTP und 4,5 mM m7-GpppG, 20 Einheiten SP6-RNA-Polymerase und 20 Einheiten RNase-Inhibitor in einem 20 &mgr;l Reaktionsvolumen transkribiert. Nach 2-stündiger Inkubation bei 37 °C wurde die RNA-Produktion durch Laufenlassen von 2 &mgr;l des RNA-Produktes auf einem 1% Agarosegel untersucht.

Zellen von Hamsterbabynieren (BHK-221) und Stechmücken (Aedes albopictus) wurden mit von der Mutante oder dem Wildtypklon stammender RNA transfiziert. Die Transfektion der Stechmückenzellen erfolgte mit 5×106 Zellen, die in einem Elektroporationspuffer bestehend aus 20 mM Hepes (pH 7,05), 137 mM NaCl, 0,7 mM Na2HPO4 und 6 mM Dextran erneut suspendiert worden waren. Als optimale Elektroporationsparameter für diese Zellen erwiesen sich 2 Kv, 25 &mgr;F, I-Widerstand. Die transfizierten Zellen wurden bei 37 °C inkubiert, bis eine zytopathische Wirkung beobachtet wurde (etwa 24 Stunden).

Nach 24-stündiger Inkubation wurden die Medien der infizierten Zelllinien und der nicht RNA-transfizierten Kontrollen gesammelt. Die Medien der einzelnen Zelllinien wurden auf Stechmücken- und BHK-21-Zellmonoschichten mittels Plaquetest auf das Vorliegen eines infektiösen Virus getestet (Renz und Brown, 1976) (Tabelle 1).

Wie in Tabelle 1 dargestellt, erzeugt die Mutante K391 nur bei Replikation in der Insektenzelle infektiöse Viruspartikel. Dieses Virus wiederum erzeugte Plaque nur in Stechmückenzellen. Mit K391 transfizierte BHK-Zellen erzeugten bei Tests mit BHK- oder Aedes albopictus-Zellen kein nachweisbares Virus. Wurden BHK-Kulturen mit dem aus den transfizierten Stechmückenzellen erzeugten Virus infiziert, wurde kein nachweisbares Virus erzeugt. Den Wildtypvirus codierende RNA erzeugte ein infektiöses Virus, das wiederum Plaque in beiden Zelllinien erzeugte (Tabelle 1).

BEISPIEL 3 Metabolische radioaktive Markierung viraler Proteine

Subkonfluente Monoschichten von BHK-21-Zellen in 25 cm2-Kolben wurden wie zuvor beschrieben mit Wildtyp- oder K391-Mutanten-RNA transfiziert. Die Monoschichten wurden über 30 Minuten in methionin- und cysteinfreiem Medium (MEM-E) mit 1% FCS, 2 mM Glutamin und 5% TPB (Nährstoffmangelmedium) unter Nährstoffmangel gehalten. 16 Stunden nach der Transfektion wurden die Zellen mit dem 50 &mgr;Ci/ml [35S] Met/Cys-Proteinmarkierungsgemisch enthaltenden Nährstoffmangelmedium über 20 Minuten pulsmarkiert. Das Markieren wurde durch Waschen der Monoschichten mit 75 &mgr;g/ml Cycloheximid enthaltendem PBS beendet. Die Monoschichten wurden 45 Minuten lang in einem Medium gehalten, das das 10-Fache der normalen Methionin- und Cysteinkonzentration sowie 75 &mgr;g/ml Cycloheximid enthielt.

BEISPIEL 4 Immunfällung und Polyacrylamid-Gelelektrophorese

Es erfolgte wie zuvor beschrieben eine Immunfällung radioaktiv markierter Virenproteine mit Antiseren (Knipfer und Brown, 1989). Mit [35S] Met/Cys markierte Zellen wurden zweimal in kaltem PBS gewaschen und in Lysepuffer (0,5% NP-40, 0,02 M Tris-HCl (pH 7,4), 0,05 M NaCl, 0,2 mM PMSF, 0,2 mM TPCK und 0,02 mM TLCK) lysiert. Die Zellkerne wurden mittels Zentrifugieren pelletiert und entsorgt. Der Überstand wurde mit eine Stunde lang in Lysepuffer suspendierten Protein A/Sepharose-Kügelchen (Sigma) (100 &mgr;l) vorab absorbiert und die Kügelchen pelletiert. Der vorab absorbierte Überstand wurde mit an Kaninchen-Anti-SVHR-Serum oder E2-Schwanz-monospezifisches polyklonales Serum gekoppelten Protein A/Sepharose-Kügelchen (200 &mgr;l) behandelt und über Nacht bei 4 °C gerührt. Die immungefällten Kügelchen-Antikörper-Protein-Komplexe wurden dreimal mit Lysepuffer gewaschen und anschließend in SDS-PAGE-Probenpuffer mit 12% Glycerin, 4% SDS, 50 mM Tris (pH 6,8), 5% Mercaptoethanol und 0,02% Bromphenolblau löslich gemacht. Die Proben wurden drei Minuten lang bei 95 °C erwärmt und die Kügelchen mittels Zentrifugieren aus der Probe entfernt. Wie zuvor beschrieben erfolgte eine Gelelektrophorese auf 10,8% SDS-PAGE bzw. 16% Tricingel (Liu und Brown, 1993a,b). Wie beschrieben wurde eine Fluoreszenzaufnahme durchgeführt (Bonner und Laskey, 1974) und die getrockneten Gele wurden mit einem Kodak XAR-S-Film belichtet (siehe 1).

BEISPIEL 5 Elektronenmikroskopie in Transmission

Mit K391 aus transfizierten Stechmückenzellen infizierte oder mit K391-RNA transfizierte BHK-21-Zellmonoschichten wurden durch Trypsinbehandlung zu gewünschten Zeitpunkten aus den Kolben gezogen und die Zellen durch Zentrifugieren mit niedriger Drehzahl pelletiert. Die Zellpellets wurden zweimal in PBS gewaschen und in 4% Glutaraldehyd bei 4 °C über Nacht fixiert. Anschließend wurden die Zellen dreimal mit 0,2 M Cacodylatpuffer (pH 7,2) gewaschen, mit 2% Osmiumtetroxid eine Stunde lang bei Raumtemperatur nachfixiert und dreimal in Cacodylatpuffer gewaschen. Die Zellen wurden en bloc eine Stunde lang bei Raumtemperatur mit 0,5% Uranylacetat gefärbt. Nach drei Waschdurchläufen wurden die Zellpellets in 1 % Agarosegel eingebettet und in einer abgestuften Ethanol/Aceton-Serie dehydratisiert. Das endgültige Einbetten erfolgte über zwei Tage in Mollenhauers (1964) Epon-Aralditepoxid-Gemisch Nr. 1 bei 70 °C. Mit einem Sorvall MT5000-Mikrotom wurden ultradünne Schnitte erzeugt und auf Kupfergittern (150 Mesh) gesammelt. Die Schnitte wurden mit 1% Uranylacetat und/oder Bleicitrat gefärbt und in einem Jeol 100CX-Elektronenmiskroskop in Transmission photographiert (siehe 2).

Zwar erzeugen die mit dem K391-Virus infizierten oder der K391-RNA transfizierten BHK-Zellen kein durch den Plaquetest nachweisbares Virus, doch es wurde mittels PAGE gezeigt, dass sie alle Virusstrukturproteine erzeugen (1). Weiterhin wurde mittels Elektronenmikroskopie gezeigt, dass sie die intrazellulären (nicht-infektiösen) Viruskerne zusammenfügen (2).

BEISPIEL 6 Verwendungszwecke der Sindbis-Deletionsmutante K391 und ähnlicher, in anderen Togavixen erzeugter Mutationen

K391 erzeugt, wenn man es sich in Stechmückenzellen replizieren lässt, Sindbis-Viruspartikel. Diese exponierten Regionen der Proteine (Ecto-Domänen) haben eine Wildtypsequenz. Diese Wildtypproteine erlauben dem Virus zwar das Eindringen in Säugerzellen und die Herstellung von Virusproteinen (siehe 1), doch ein neues Virus wird, wie mittels Elektronenmikroskopie in 2 dargestellt, nicht zusammengefügt.

K391 ist ein Vakzinstamm. Er wird in sehr hoher Konzentration in kultivierten Insektenzellen erzeugt. Wird das Virus jedoch in einen Säugerwirt injiziert, zirkuliert das Virus und infiziert Zellen in dem Säugerwirt. Diese infizierten Zellen erzeugen und präsentieren zwar Virusproteine für die Immunüberwachung, doch die Infektion ist aufgrund der Trunkierung in der Membrandomäne auf die ursprünglich mit dem Impfmaterial infizierten Zellen beschränkt. Da der Vakzinstamm das Ergebnis einer Deletionsmutation ist, ist eine Rückmutation zu dem pathogenen Wildtyp-Phänotyp nicht möglich.

Weiterhin kann eine manipulierte Deletionsmutante in die Wildtypstechmückenpopulation eingeschleust werden. Es wurde gezeigt, dass diese Viren vom weiblichen Elternteil mittels transviraler Übertragung auf die Nachkommen verbreitet werden (Leakey, 1984). Stechen diese Stechmücken ein Wirbeltier, übertragen sie eine immunisierende Dosis (106 infektiöse Partikel) des Vakzinstammes (z.B. K391). Karpf und Brown (1997) zeigten, dass die Infektion von Insektenzellen durch einen Alphavirus verhindert, dass die Zellen über einen unbegrenzten Zeitraum (mehr als zwei Jahre in der Zellkultur, in der das Leben einer Stechmücke 28 Tage beträgt) von einem anderen, sogar nur entfernt verwandten Alphavirus infiziert werden. Daher blockiert das Vorliegen des Vakzinstammes (z.B. Sindbis K391) die Verbreitung anderer verwandter und pathogener Viren durch diese Insekten.

BEISPIEL 7 Weitere Deletionsmutationen

Es wurden weitere Deletionsmutationen in der membran-überspannenden Domäne des Sindbis-Virusglycoproteins E2 hergestellt. Das Protokoll zur Herstellung dieser Deletionsmutationen ist nachfolgend beschrieben. Das Verfahren wird zwar für die das Sindbis-Virus enthaltende Modellmembran beschrieben, doch das Verfahren lässt sich auch gut auf andere Virusmembranglycoproteine anwenden.

Die Hüllglycoproteine des Sindbis-Virus wurden als Multipass-Protein mit sechs membran-überspannenden Domänen in die Membranen des endoplasmatischen Retikulums eingebaut. Es gibt daher sechs potentielle Ziele für die Herstellung von Deletionsmutationen, die den korrekten Einbau einer Transmembrandomäne verhindern (siehe 3). Einige dieser Ziele sind für dieses Verfahren weniger zufriedenstellend als andere. TMD Nr. 1 (2) ist die Signalsequenz, die von dem Signalerkennungspartikel erkannt wird und die Proteinsynthese an die Membranen des ER dirigiert. Eine Trunkierung dieser Domäne würde wahrscheinlich die Zielfindung in Säuger- und Insektenzellen stören. TMD Nr. 3 enthält die Proteinsequenz von E2, die das Capsidprotein erkennt und sich daran bindet. Es wurde gezeigt, dass diese Wechselwirkung von Natur aus sehr spezifisch ist und dafür die Sequenz in der Transmembrandomäne erforderlich ist (Liu et al., 1996; Lopez et al., 1994). TMD Nr. 3 hat daher wie TMD Nr. 1 eine funktionelle und eine strukturelle Komponente. Eine signifikante Deletion in dieser Domäne würde wahrscheinlich ein Austreten in beiden Zellsystemen eliminieren. Damit bleiben vier Transmembrandomänen übrig, die Ziele für die Erzeugung von Deletionen, die den Einbau in die Membran beeinflussen, sind (3, TMD 2, 4, 5, 6).

Das 6k-Protein ist keine Komponente des reifen Virus und seine Funktion beim Viruszusammenbau ist nicht klar. In dem Polyprotein sind der richtige Einbau und die richtige Ausrichtung der 6k in der ER-Membran für den korrekten Einbau von E1 ausschlaggebend. Die Transmembrandomänen von 6k (TMD 4 und 5) sind hervorragende Ziele für eine Deletionsmutation, da ein nicht erfolgter Einbau einer dieser Domänen dazu führen kann, dass das Polyprotein in falscher Konfiguration in die Membran eingebaut wird oder E1 nicht eingebaut wird. TMD 2 und 6 sind die membranüberspannenden Domänen von E2 und E1 und sind beides offensichtliche Ziele für eine Deletionsmutation. Multiple membran-überspannende Domänen in diesem Polyprotein deuten darauf hin, dass die Deletionen in weiteren membran-überspannenden Domänen die Reifung auf ein vernachlässigbares Maß reduzieren können, wenn Deletionsmutationen in einer einzelnen Transmembrandomäne die Virusproduktion in Säugerzellen nicht vollständig blockieren.

BEISPIEL 8 Entwicklung mutagener Primer für den hydrophoben E2-Membrananker (TMD Nr. 2)

Es existiert ein Protokoll für die Testung der Anforderungen an die Transmembrandomäne von E2 (3, TMD 2). Dieses Protokoll lässt sich für andere membran-überspannende Sindbis-Domänen oder membran-überspannende Domänen anderer Virusglycoproteine leicht replizieren. Der hydrophobe Sindbis-PE2-Membrananker besteht aus 26 Aminosäuren. Wie bei anderen membranüberspannendenden Domänen üblich, ist unter den Alphaviren nur eine geringe Aminosäurehomologie konserviert, auch wenn die Länge dieser hydrophoben Region stark konserviert ist (Strauss und Strauss, 1994). Die fehlende Sequenzkonservierung in dieser Domäne deutet darauf hin, dass die hydrophoben Eigenschaften der Domäne und nicht ihre Sequenz für den Einbau ausschlaggebend sind.

Die Transmembrandomäne von E2 beginnt bei Aminosäure 365 der PE2-Sequenz. Diese hydrophobe Region besteht aus der Sequenz VYTILAVASATVAMMIGVTVAVLCAC (SEQ-ID Nr. 4). Adams und Rose (1985) zeigten, dass für die richtige Verankerung in Säugerzellen mindestens 14 Aminosäuren in der Transmembrandomäne des VSV-G-Proteins erforderlich waren. Daher wurden mutagene Primer entwickelt, die eine Reihe ineinander geschachtelter Deletionen in der E2-Transmembrandomäne erzeugen. Beginnend mit einer Deletion von 16 Aminosäuren (womit 10 Aminosäuren in der hydrophoben Region übrig bleiben) wurde eine Reihe von Deletionen konstruiert, die bis zu 16 Aminosäuren oder auch nur eine Aminosäure von dem Membrananker deletieren (4).

Die Deletionen wurden mittels PCR-Megaprimer-Mutagenese zur Erzeugung deletierter Fragmente mit einzigartigen Bc1I- und Sp1I-Orten konstruiert. Alle entstandenen Konstrukte wurden zur Erzeugung der Mutantenplasmide in das wt-Sindbis-cDNA-Konstrukt Toto Y420 installiert. Nach der Linearisierung mit XhoI und Transkription mit SP6-Polymerase wurden die Transkripte mittels Elektroporation (wie zuvor beschrieben) in BHK- oder Aedes albopictus-Zellen transfiziert. Die Herstellung eines infektiösen Virus aus diesen Transfektionen wurde auf BHK- und C710-Stechmückenzellen getitert, um den Wirtsbereich dieser Konstrukte zu bestimmen. Tabelle 2 stellt die deletierten Sequenzen und die Primer-Sequenzen für ihre Konstruktion dar.

Bei den Konstrukten wird zur Erzeugung der gesamten Bc1I- bis Sp1I-Region jeweils dasselbe Primer-Paar eingesetzt. Der Vorwärtsprimer E1Bc121 besteht aus der Sequenz der Nukleotide 9306-9327 und liest sich von 5' nach 3' GCGTCGCCTATAAGAGCGACC (SEQ-ID Nr. 5). Der Umkehrprimer Splext besteht aus der Sequenz der Nukleotide 10420-10444, bei der es sich um die komplementäre Sequenz handelt, die sich von 5' nach 3' CAGTGTGCACCTTAATCGCCTGC (SEQ-ID Nr. 6) liest.

Das durch Transfektion von Insektenzellen erzeugte Virus wird auf seine Fähigkeit zur Erzeugung von Plaque in BHK- und C710-Stechmückenzellen und die E2-Mutante &Dgr;K391 getestet. Diejenigen Mutanten, die keine Plaque in BHK-Zellen erzeugen, werden mittels Immunofluoreszenztest infizierter Monoschichten auf ihre Fähigkeit zur Infektion von BHK-Zellen im Vergleich zum Wildtypvirus getestet. Dieser letztere Test wird mit dem Gesamtprotein in gereinigten Präparaten des Mutanten- und Wildtypvirus verglichen, um die relative Infektiosität der einzelnen Mutantenpopulationen zu sichern. Das Ziel ist die möglichst umfassende Trunkierung der Transmembrandomäne bei gleichzeitiger Gewinnung angemessener Virusmengen in Monoschichten von C710-Stechmückenzellen, die BHK-Zellen zwar infizieren, aber kein reifes Virus darin erzeugen können. Sollte es dazu kommen, dass die Trunkierung einer einzelnen Transmembrandomäne das Viruswachstum in BHK-Zellen zwar reduziert, aber nicht eliminiert, wird eine zweite Domäne und so weiter (bis zu vier Domänen) trunkiert.

TABELLE 2

Des von der vorliegenden Erfindung beschriebene Protokoll funktioniert bei allen Viren, die sich in Insekten und Säugern replizieren und eingebaute Membranproteine als Teil ihrer Struktur aufweisen, nämlich Togavieren, Flaviviren und Bunyaviren sowie allen anderen umhüllten Viren, die sich auf natürliche Weise in Säuger- und Insektenzellen replizieren können oder bei denen durch genetische Manipulation des Virus oder der Zelle erreicht wird, dass sie sich in Säuger- und Insektenzellen replizieren.

Durch Entfernung von Aminosäuren von der membran-überspannenden Domäne eines Proteins in der Virushülle werden Vakzine gegen alle membranhaltigen Viren erzeugt. Dies erfolgt wie beschrieben durch Entfernung von Basen aus dem cDNA-Klon des Virus. Die von dem veränderten Klon transkribierte RNA wird in Insektenzellen transfiziert. Das erzeugte Virus wird durch wiederholtes Wachstum in Insektenzellen amplifiziert, bis man große Mengen des Mutantenvirus erhält. Dieser Virus wird auf seine Fähigkeit zur Infektion von Säugerzellen und Erzeugung von Nachkommen darin getestet. Diejenigen Viren, die keine Nachkommen in Säugerzellen erzeugen, werden auf ihre Fähigkeit zur Erzeugung von Immunität in Labortieren getestet. Viren, die keine Immunität erzeugen, sind Kandidaten für die Herstellung von Vakzinen für Mensch und Tier (wie im Stand der Technik bekannt). Dieses Protokoll wird bei allen Arboviren und anderen umhüllten Viren eingesetzt.

Die folgenden Literaturstellen wurden hierin zitiert:

  • Adams G.A. und Rose J.K. (1985) Structural requirements of a membrane-spanning domain for protein anchoring and cell surface transport. Cell 41(3):1007-15
  • Berge, T.O. (Hrsg.) (1975): International Catalogue of Arboviruses, 2. Ausgabe, DHEW-Veröffentlichungsnummer (CDC) 75-8301 (US Government Office, Washington, D.C.)
  • sBonner, W.M. und R.A. Laskey (1974) A film detection method for tritium-labeled proteins and nucleic acids in polyacrylamide gels. Eur. J. Biochem. 46:83-88
  • Bowers, D.F., B.A. Abell und D.T. Brown (1995) Replication and Tissue Tropism of the Alphavirus Sindbis in the Mosquito Aedes Albopictus. Virology 212:1-12
  • Bretscher MS (1993) Cholesterol and the Golgi apparatus. Science 261(5126):1280-1
  • Brown, D.T. und L. Condreay (1986) Replication of alphaviruses in mosquito cells. In: The Togaviridae and Flaviviridae. S. Schlesinger (Hrsg.), S. 473-501
  • Clayton , R.B. (1964) The utilization of sterols by insects. J. Lipid Res. 5:3-19
  • Karpf et al. (1997), J. Virol. 71:7119-7123
  • Knipfer, M.E. und D.T. Brown (1989) Intracellular transport and processing of Sindbis virus glycoproteins. Virology 170:117-122
  • Leake, C.J. (1984) Transovarial transmission of arboviruses by mosquitos. In: Vectors in Virus Biology (Mayo und Harrap, Hrsg.). S. 63-92. Academic Press
  • Liu, N. and D.T. Brown (1993a) Transient translocation of the cytoplasmic (endo) domain of a type-I membrane glycoprotein into cellular membranes. J. Cell Biol. 120:877-883
  • Liu, N. und D.T. Brown (1993b) Phosphorylation dephosphorylation events play critical roles in Sindbis virus maturation. J. Vixol. 196:703-711
  • Liu, N., H. Lee, R. Hernandez und D.T. Brown (1996) Mutations in the Endo Domain of Sindbis Glycoprotein E2 Block Phosphorylation, Reorientation of the Endo Domain and Nucleocapsid Binding. Virology 222:236-246
  • Mitsuhashi et al. (1983) Sterol free eucaryotic cells from continuous cell lines of insects. Cell Biol. Int. Rep. 7:1057-1062
  • Mollenhauer, H.H. (1964) Plastic embedding mixture for use in electron microscopy. Stain Techn. 39:111-114
  • NIAID Report of the Task Force on Microbiology and Infectious Diseases (1992). NIH-Veröffentlichungsnummer 92-3320
  • Renz, D. und D.T. Brown (1976) Characteristics of Sindbis virus temperature-sensitive mutants in cultured BHK-21 and Aedes albopictus (mosquito) cells. J. Virol. 19:775-781
  • Rice C.M. et al. (1982) Isolation and characterization of the hydrophobic COOH-terminal domains of Sindbis virus glycoproteins. J. Mol. Biol. 154:355-378
  • Rice, C.M., R. Levis, J.H. Strauss und H.V. Huang (1987) Production of infectious RNA transcripts from Sindbis virus cDNA clones: mapping of lethal mutations, rescue of a temperature-sensitive marker, and in vitro mutagenesis to generate defined mutants. J. Virol. 61:3809-3819
  • Sarkar, G. und S.S. Sommer (1990) The "megaprimer" method of site-directed mutagenesis. BioTechniques 8:404-407
  • Schlesinger, S. und M.J. Schlesinger (1990) Replication of Togaviridae and Flaviviridae (D.M. Knipe und B.N. Fields, Hrsg.) In: Virology, Band I, S. 697-711. Raven Press, Ltd., New York
  • Sprenger, D. und T. Wuithiranyagool (1985) The discovery and distribution of Aedes albopictus in Harris County, Texas. J. Am. Mosquito Control Assoc. 2:217-219
SEQUENZLISTE


Anspruch[de]
Genetisch manipuliertes, membranumhülltes Virus, dadurch gekennzeichnet, dass das Virus für ein Transmembranprotein mit einer Deletion von einer oder mehr Aminosäure(n) codiert und dass die Deletion ein Transmembranprotein bereitstellt, das zum Überspannen der Membran fähig ist, wenn sich genanntes Virus in Insektenzellen repliziert, das aber zum Überspannen der Membran unfähig ist, wenn sich genanntes Virus in Säugerzellen repliziert. Genetisch manipuliertes, membranumhülltes Virus nach Anspruch 1, dadurch gekennzeichnet, dass das membranumhüllte Virus aus der Gruppe von Togaviren, Flaviviren und Bunyaviren ausgewählt ist. Genetisch manipuliertes, membranumhülltes Virus nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass die Insektenzellen Stechmückenzellen darstellen. Genetisch manipuliertes, membranumhülltes Virus nach einem der vorangehenden Ansprüche, dadurch gekennzeichnet, dass die Insektenzellen Zellen von Aedes albopictus darstellen. Genetisch manipuliertes, membranumhülltes Virus nach einem der vorangehenden Ansprüche, dadurch gekennzeichnet, dass das membranumhüllte Virus ein Sindbis-Virus darstellt. Genetisch manipuliertes, membranumhülltes Virus nach Anspruch 5, dadurch gekennzeichnet, dass das Transmembranprotein das virale Glycoprotein E2 darstellt. Genetisch manipuliertes, membranumhülltes Virus nach Anspruch 6, dadurch gekennzeichnet, dass das Virus das K391-Virus darstellt. Genetisch manipuliertes, membranumhülltes Virus nach einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass das Transmembranprotein aus der Gruppe von Glycoprotein E1, Glycoprotein E2 und G-Protein ausgewählt ist. Verfahren zur Herstellung eines Virusvakzins, umfassend die Schritte von:

Erhalt eines genetisch manipulierten, membranumhüllten Virus nach einem der Ansprüche 1 bis 8; und Replizierenlassen des membranumhüllten Virus in genannten Insektenzellen zur Produktion eines Virusvakzins.
Verwendung eines genetisch manipulierten, membranumhüllten Virus nach einem der Ansprüche 1 bis 8 bei der Herstellung eines Arzneimittels für die Vakzinierung von Säugern. Verwendung nach Anspruch 11, dadurch gekennzeichnet, dass der Säuger ein Mensch ist.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com