PatentDe  


Dokumentenidentifikation DE60126482T2 29.11.2007
EP-Veröffentlichungsnummer 0001272609
Titel EINKETTIGE ANTIKÖRPER GEGEN EINE P53 MUTANTE
Anmelder Ramot at Tel Aviv University Ltd., Tel Aviv, IL
Erfinder SOLOMON, Beka, 46399 Herzlia Pituach, IL;
COHEN, Gerald, 43365 Raanana, IL;
GOVORKO, Dimitri, 46445 Herzlia, IL
Vertreter derzeit kein Vertreter bestellt
DE-Aktenzeichen 60126482
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE, TR
Sprache des Dokument EN
EP-Anmeldetag 09.03.2001
EP-Aktenzeichen 019141423
WO-Anmeldetag 09.03.2001
PCT-Aktenzeichen PCT/IL01/00225
WO-Veröffentlichungsnummer 2001068801
WO-Veröffentlichungsdatum 20.09.2001
EP-Offenlegungsdatum 08.01.2003
EP date of grant 07.02.2007
Veröffentlichungstag im Patentblatt 29.11.2007
IPC-Hauptklasse C07H 21/04(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 15/00(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/09(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/63(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/70(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/74(2006.01)A, L, I, 20051017, B, H, EP   C12N 5/00(2006.01)A, L, I, 20051017, B, H, EP   C12N 5/02(2006.01)A, L, I, 20051017, B, H, EP   C12P 21/06(2006.01)A, L, I, 20051017, B, H, EP   C12P 21/08(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
GEBIET DER ERFINDUNG

Diese Erfindung bezieht sich auf einkettige Antikörpermoleküle gegen das p53-Genprodukt.

HINTERGRUND DER ERFINDUNG

Auf die folgenden Referenzen wird in der Beschreibung Bezug genommen und sie können relevant für das Verständnis der Erfindung sein:

  • 1. Gamble, J. and Milner, J. (1988). Evidence that immunological variants of p53 represent alternative protein conformations. Virology. 162, 452–458.
  • 2. Harlow. E.. Crawford, L.V., Pim, D.C. and Williamson. N.H. (1981). Monoclonal antibodies specific for simian virus 40 tumor antigens. J. Virol., 39, 861–869.
  • 3. Yewdell. J. W., Gannon. J.V. and Lane, D.P. (1986). Monoclonal antibody analysis of p53 expression in normal and transformed cells. J. Virol. 59, 444–452.
  • 4. Milner, J., Cook. A. and Sheldon, M. (1987). A new anti-p53 monoclonal antibody, previously reported to be directed against the large T antigen of simian virus-40. Oncogene. 1. 453–455.
  • 5. Gannon. J.V., Greaves. R., Iggo, R. and Lane. D.P. (1990). Activating mutations in p53 produce common conformation effects. A monoclonal antibody specific for the mutant form. EMBO J. 9, 1595–1602.
  • 6. Marasco. W.A. (1995) Intracellular antibodies (intrabodies) as research reagents and therapeutic molecules for gene therapy. Immunotechnology, 1, 1–19.
  • 7. Stephen. C.W. and Lane. D.P. (1992). Mutant conformation of p53 precise epitope mapping using a filamentous phage epitope library. J. Mol. Biol. 225, 577–583.
  • 8. Jannot. C.B. and Hynes, N.E. (1997). Biochem. Biophys. Res. Commun., 230, 242–246.
  • 9. Cohen. P.A., Mani, J-C. and Lane, D.P. (1998). Characterization of a new intrabody directed against the N-terminal region of human p53. Oncogene, 17, 2445–2456.

Das p53-Gen kodiert für ein Protein, das eine Größe von 53 kD aufweist (daher stammt auch der Name). Das p53-Protein befindet sich im Nexus von vernetzten Pfaden, welche die Zellproliferation, das Überleben und die Differenzierung der Zellen steuern. Es kann zahlreiche externe und interne Reize, wie DNA-Schäden, Hypoxie, oxidative Belastung, deregulierte Expression von Onkogenen und Ribonukleotid-Depletion erkennen und integrieren. Als Antwort auf diese Reize kann es Zellzyklusarretierung, Apoptose, Seneszenz, Differenzierung oder Antiangiogenese auslösen. Es scheint, dass das p53-Protein an der Regulierung von entscheidenden wachstumssteuernden Checkpoints beteiligt ist. Es ist in der Lage, eine Tumorsuppressionsfunktion auszuüben, indem es Zellen, die sich in ungünstiger Umgebung befinden oder beschädigte DNA tragen, daran hindert, in einen Zellzyklus einzutreten.

Mutationen innerhalb des p53-Gens wurden in mehr als 50% aller Krebserkrankungen beim Menschen gefunden. Dadurch ist es zu das am häufigsten mutierte, einzelne Gen bei Krebserkrankungen des Menschen, das bis jetzt bekannt ist. Bei den meisten der bei Krebserkrankungen entdeckten Mutationen im p53-Gen handelt es sich um Missense-Mutationen. Sie verursachen nicht nur die Aufhebung der Tumorsuppressorfunktion von Wildtyp p53, sondern spielen oft auch eine aktive Rolle bei der Funktion von mutiertem p53, Tumore zu transformieren. Die Inaktivierung von p53 ist eines der häufigsten Ereignisse bei der Entstehung von Krebs.

Wie oben erwähnt, kann das p53-Protein, das sowohl einen Regulator für die Zellproliferation als auch einen Suppressor der Tumorentwicklung darstellt, die Entwicklung von bösartigen Tumoren verhindern, indem es die Teilung von Zellen mit nachhaltigen DNA-Schäden blockiert oder indem es Apoptose auslöst. Es wurde angenommen, dass die Wirkung von mutiertem p53 auf die Tumorprogression auf eine dominante, negative Wechselwirkung der Wildtyp-Proteine und der mutierten Proteine zurückzuführen ist. Deshalb sind Wildtyp- und mutierte p53-Proteine jeweils in der Lage, der Suppressor- und Promotorwirkung auf die Tumorentwicklung entgegenzuwirken.

Die Fähigkeit von p53, sowohl als Suppressor als auch als Promotor der Tumorentwicklung zu wirken, geht zurück auf die Fähigkeit des Proteins verschiedene Konformationen anzunehmen. Mitogene Stimulierung von primären T-Zellen induziert eine Änderung in der Immunreaktivität von p53 und das kann auf eine Änderung in der Tertiärstruktur des p53-Proteins zurückzuführen sein. Um zu bestimmen, ob die mutierte Konformation von Wildtyp p53 physiologische Relevanz hat, wurde versucht, diese mit einer biochemischen Aktivität zu assoziieren. Konformationsspezifische monoklonale Antikörper, von denen bereits gezeigt wurde, dass sie zwischen Wildtyp und mutierten p53-Proteinen unterscheiden können, wurden verwendet, um solche strukturellen Änderungen in Wildtyp p53 nach sequenzspezifischer Bindung an DNA (1) zu belegen. Diese Studien legten nahe, dass Wildtyp p53 physiologisch unterschiedliche Konformationen annehmen kann, die seine Bindungsaktivität an DNA bestimmen. Mutationen, die p53 onkogen machen, führen eher dazu, dass p53 in einem der wenigen konformativen Zustände, die es physiologisch einnimmt, festgesetzt wird, als dass seine tertiäre Struktur zerstört würde.

Zwei wichtige Zellfaktoren scheinen für diese Konversion notwendig: (1) Bindung eines „aktivierenden" Polypeptids, das die Neutralisierung der C-terminalen, negativen, regulatorische Domäne bewirkt und (2) ein stark reduziertes Milieu, wodurch p53 in einem aktivierten Zustand gehalten werden kann. Unter Berücksichtigung der deutlichen Assoziation zwischen der DNA-Bindungsaktivität und den Tumorsuppressorfunktionen von p53, implizieren diese Ergebnisse, dass in vielen Tumorzellen hohe Niveaus an mutiertem p53 vorhanden sind, die potentiell aktiviert werden können, um signifikante Wildtyp-Funktionen wiederherzustellen.

Eine Vielzahl monoklonaler Antikörper gegen zahlreiche Epitope von p53 wurde hergestellt.

Verschiedene anti-p53 monoklonale Antikörper aus der Maus wurden verwendet, um die Immunoreaktivitäten des nativen p53-Ala35 und des mutierten p53-Val35, die unter verschiedenen Bedingungen translatiert wurden, zu charakterisieren. Zwei monoklonale Antikörper, PAb421 und PAb248 waren in der Lage, separate Epitope, die sich als stabil gegenüber Denaturierung erwiesen, auf dem p53-Polypeptid zu erkennen (2, 3). Diese Antikörper immunopräzipitierten bei 30°C und 37°C translatierte p53-Ala35 und p53-Val35 und waren ebenso in der Lage, p53 von einer Vielzahl an murinen Zelllinien zu immunopäzipitieren (4).

Es wurde gefunden, dass drei zusätzliche monoklonale Antikörper, PAb246, PAb1620 und PAb240 konformative Änderungen im p53 Protein detektieren (5). Moleküle in der mutierten Konformation werden von Wildtyp-Molekülen unter anderem durch das Erscheinen eines neuen, normalerweise schwer zugänglichen Epitops unterschieden, das von Pab240 erkannt wird. Dieses Epitop war örtlich an die Reste 213 bis 217 des p53-Proteins gebunden und weist die Sequenz RHSW auf, der F bei p53 im Menschen und in der Maus vorausgeht (7). Mehr als 90% der in p53 gefundenen Mutationen führen zu einer konformativen Änderung im p53 Protein, was wiederum die Freilegung dieses Epitops zur Folge hat, das ansonsten im hydrophoben Kern des Moleküls verborgen ist. Auf dieses Epitop wird im folgenden als das bekannte mutierte Epitop von p53 Bezug genommen.

Neueste Fortschritte beim Antikörper Engineering haben es ermöglicht, dass die Gene, die für Antikörper kodieren so manipuliert werden, dass antigenbindende Moleküle in Säugetierzellen auf kontrollierte Weise exprimiert werden können (6). Die Anwendung von Gentechnologien auf Antikörper Engineering hat die Synthese von scFv-Antikörpern (single-chain fragment variable Antikörper), welche die variablen Domänen der leichten und der schweren Kette von einem kovalent durch einen zuvor konzipierten Peptidlinker gebundenen Antikörpermolekül in einer einzelnen Polypeptidkette kombinieren, ermöglicht. Das resultierende scFv-Gen kann in bakteriellen Expressionssystemen wie E. coli exprimiert werden. Im „Gen-Display-Packet" gebündelte, einkettige, auf der Oberfläche von filamentösen Phagen der M13 Familie präsentierte Antikörper ermöglichten die Erstellung von Antikörperbibliotheken sowohl aus verschiedenen lebenden Quellen als auch aus Produkten der Diversifikation eines einzelnen scFv-Moleküls zu erstellen. Antikörper mit der erwünschten Spezifität können aus solchen Bibliotheken unter Verwendung von Selektionstechniken (Biopanning) isoliert werden, bei denen das Antigen auf einem festen Träger immobilisiert wird.

Die Fähigkeit, scFv-Antikörper zu generieren, in Kombination mit ihrer stabilen Expression in präzisen, intrazellulären Stellen in Säugetierzellen hat die Herstellung einer starken neuen Familie von Antikörpermolekülen für grundlegende Recherche oder Gentherapie möglich gemacht. Diese intrazellulären Antikörper (Intrabodies) können verwendet werden, um zelluläre Physiologie und Stoffwechsel mit Hilfe einer Vielzahl von Mechanismen, einschließlich Blockieren, Stabilisieren oder Imitieren von Protein-Protein Wechselwirkungen durch Ändern der Enzymfunktion oder durch Ablenken von Proteinen von ihren üblichen, intrazellulären Kompartimenten zu modulieren. Intrabodies können durch Modifizierung der Gene, die für sie kodieren, auf relevante zelluläre Kompartimente gerichtet sein, um N- oder C-terminale Polypeptidextensionen zu spezifizieren und so intrazelluläre Transportsignale zu liefern. Dieser Ansatz wurde für eine Anzahl von verschiedenen Antigenen, einschließlich zahlreicher HIV-Proteine, beschrieben.

Mehrere scFv-Antikörper gegen p53 wurden bereits beschrieben. Der scFv-421 Antikörper erkennt ein C-terminales Epitop des Proteins (8). Es wurde gefunden, dass dieses bei in vitro Expression in das Zytoplasma oder den Kern von COS-1-Zellen nicht funktional ist und zu schnellem Abbau neigt. Eine wichtige Determinante korrekter Antikörperfaltung ist die Bildung von Disulfidbindungen zwischen den Ketten in den variablen Regionen; möglicherweise kann das reduzierende Milieu des Zytosols zu einer Abnahme der Stabilität des scFv führen (9). Dennoch wurden manche scFv-Antikörper in das Zytoplasma exprimiert und zeigten biologische Wirkung, wobei sie darauf hinwiesen, dass andere Merkmale, wie die primäre Sequenz des Antikörpers und/oder seine spezifische Lage in der Zelle für ihre korrekte Funktionsweise von Bedeutung sein können.

Es wurde gefunden, dass der scFv DO-1 Antikörper ein N-terminales Epitop von humanem p53 erkennt (9). Der DO-1 scFv wurde gegen das Zytoplasma und den Kern von Säugetierzellen gerichtet. Interessanterweise führte die Insertion der CK-Domäne in scFv für die Herstellung eines scFvCK-Fusionproteins zu einem dramatischen Anstieg bei dem Niveau der intrazellulären Expression. In anderen Studien, in denen CK-Fusionen an scFv durchgeführt wurden, waren die Wirkung auf Stabilität und Expression weniger ausgeprägt. Es ist deutlich, dass jedes scFv ein besonderer und individueller Fall ist (9).

ZUSAMMENFASSUNG DER ERFINDUNG

Es ist ein Gegenstand der vorliegenden Erfindung, einen einkettigen Antikörper, der ein auf mutiertem, aber nicht auf Wildtyp p53 exponiertes Epitop erkennt, vorzusehen.

Somit sieht ein erster Aspekt der vorliegenden Erfindung ein DNA-Molekül vor, das für einen einkettigen Antikörper (scFv) kodiert, der das bekannte mutierte Epitop in mutiertem p53 aber nicht in Wildtyp p53 erkennt.

In einer bevorzugten Ausführungsform handelt es sich bei dem scFv um ME1.

In einer besonders bevorzugten Ausführungsform umfasst das DNA-Molekül der Erfindung SEQ. ID. NO:1.

In der vorliegenden Beschreibung wird das normalerweise schwer zugängliche, mutierte p53 Epitopmotiv wie oben beschrieben (FRHSW), das von dem Pab240 Antikörper (7) erkannt wird, als „bekanntes mutiertes Epitop" von mutiertem p53 beschrieben.

Das Epitop unterscheidet sich von den p53-Epitopen, die von den zuvor offenbarten, oben erwähnten scFv-Antikörpern erkannt werden.

Um die Aufgabe der Erfindung zu lösen, wurden die Gensegmente, die für variable Teile der schweren und leichten Ketten der Antikörper kodieren, durch PCR aus der Milz der hyperimmunisierten Maus amplifiziert und eine Bibliothek an Antikörpergenen wurde erhalten. Nach der Assemblierung der von der Antikörpergenbibliothek isolierten Gene in der scFv-DNA, ihrer Expression als Phagenantikörper und nachdem sie einem Panningverfahren unterzogen wurden, besaß der einkettige, isolierte scFv ME1 eine signifikante Affinität (10–7 M) gegenüber mutiertem p53 und wurde erfolgreich als löslicher Antikörper exprimiert, unabhängig von der Phagenfusion.

Solche Bibliotheken enthalten üblicherweise eine große Anzahl an unterschiedlichen Genen, die für Antikörper kodieren, die für das gewählte Antigen spezifisch sind und nicht ein einzelnes Paar (VH und VL) Antikörpergene, die für einen einzelnen Antikörper kodieren, wie das in Hybridomazellen der Fall ist. Dies ist von besonderer Bedeutung für die Amplifikation von Maus-Antikörpergenen, da das Sequenzieren ihres Repertoirs noch nicht vollständig abgeschlossen ist und es somit noch nicht möglich ist, ein Primerset zu erstellen, das alle existierenden Antikörper-Genvarianten abdeckt. Des Weiteren ist es aus verschiedenen Gründen schwierig, manche einkettigen Antikörpergene in bakteriellen Zellen zu exprimieren. Zu diesen Gründen zählen Toxizität dieser Gene für den Wirt, ihre geringe konformative Stabilität und schneller proteolytischer Abbau. Deshalb scheint es, dass die Auswahl aus der Kollektion von Varianten der V11- und V1-Domänen, die in dem immunisierten Wirt vorhanden ist, im Vergleich zu der Auswahl aus einer Hybridomazelllinie ein stark verbesserter Ausgangspunkt für die Konstruktion von scFv ist.

Ein oder mehr als ein Nukleotid des erfindungsgemäßen DNA-Moleküls kann modifiziert werden, ohne dass die Fähigkeit des von dem modifizierten DNA-Molekül kodierten Antikörpers spezifisch das bekannte mutierte Epitop in mutiertem p53, aber nicht in Wildtyp p53, zu erkennen, beeinträchtigt würde. Solche Modifikationen sind dem Fachmann wohlbekannt und schließen (1) Substitutionen, z.B. basierend auf der Degeneration des genetischen Codes und (2) Insertionen oder Deletionen von Nukleinbasentriplets ein, die zu Insertionen in oder zu Deletionen aus der Aminosäuresequenz des scFv an nicht wesentlichen Stellen führen. Die Modifikationen können durch zahlreiche Techniken, wie gerichtete Mutagenese, ausgeführt werden.

Codons, die von einem bestimmten prokaryotischen oder eukaryotischen Wirt bevorzugt werden (Murray, E. et al. Nuc Acids Res., 17:477–508, (1989)) können zum Beispiel ausgewählt werden, um die Geschwindigkeit der Expression von Variantenprodukten zu erhöhen oder um rekombinante RNA-Transkripte herzustellen, die erwünschte Eigenschaften aufweisen, wie zum Beispiel längere Halbwertszeit als Transkripte, die aus natürlich vorkommenden Sequenzen hergestellt wurden. In einer weiteren bevorzugten Ausführungsform dieses Aspekts der Erfindung umfasst das DNA-Molekül SEQ. ID. NO:3, die für eukaryotische Expression modifiziert wurde.

Die DNA-Sequenz der vorliegenden Erfindung kann modifiziert werden, um eine für ein scFv-Produkt kodierende Sequenz für eine Vielzahl von Anwendung zu ändern, einschließlich, aber nicht darauf beschränkt, Änderungen, die zu Modifizierungen durch Klonieren, Prozessierung und/oder Expression des Produkts führen. Zum Beispiel können Änderungen unter Verwendung von Techniken eingeführt werden, die im Stand der Technik wohl bekannt sind, z.B. gerichtete Mutagenese, um neue Restriktionsstellen zu inserieren, Glykosylierungsmuster zu ändern, Codonpräferenzen zu wechseln, etc.

Die Erfindung bezieht sich auch auf einen Vektor wie einen Plasmid oder viralen Vektor, in den das DNA-Molekül der Erfindung vorwärts oder rückwärts gerichtet inseriert wurde. In einem bevorzugten Aspekt dieser Ausführungsform umfasst das Konstrukt des Weiteren Regulationssequenzen, zum Beispiel einschließlich eines Promotors, der operabel an die Sequenz gebunden ist. Eine große Anzahl an geeigneten Vektoren und Promotoren sind dem Fachmann bekannt und sind im Handel erhältlich. Ein bevorzugter Vektor ist der Expressionsvektor pIRES-EGFP-ME1.

Die vorliegende Erfindung bezieht sich auch auf Wirtszellen, die gentechnisch mit erfindungsgemäßen Vektoren modifiziert wurden und auf die Herstellung des erfindungsgemäßen Produkts durch rekombinante Techniken. Wirtszellen werden gentechnisch mit den erfindungsgemäßen Vektoren modifiziert (d.h. transduziert, transformiert oder transfiziert), wobei es sich bei diesen Vektoren zum Beispiel um einen Klonierungs- oder einen Expressionsvektor handeln kann. Der Vektor kann zum Beispiel in Form eines Plasmids, eines viralen Partikels, eines Phagen, etc. vorliegen. Die modifizierten Wirtszellen können in herkömmlichen Nährmedien kultiviert werden, die so modifiziert wurden, dass sie zur Aktivierung von Promotoren, zur Auswahl von Transformanten oder zur Amplifikation der Expression der Nukleinsäuresequenzen der Varianten geeignet sind. Die Kultivierungsbedingungen wie Temperatur, pH und dergleichen entsprechen den zuvor bei den für die Expression ausgewählten Wirtszellen verwendeten und sind für den Fachmann klar ersichtlich. Eine bevorzugte Wirtszelle ist eine Säugetierwirtszelle, die den pIRES-EGFP-ME1 Vektor enthält.

In einem zweiten Aspekt sieht die vorliegenden Erfindung ein scFv-Molekül vor, welches das bekannte mutierte Epitop in mutiertem p53, aber nicht in Wildtyp p53 erkennt.

In einer bevorzugten Ausführungsform handelt es sich bei dem scFv um ME1.

In einer besonders bevorzugten Ausführungsform umfasst der scFv die Aminosäuresequenz SEQ. ID. NO. 2. In einer weiteren bevorzugten Ausführungsform umfasst der scFv SEQ. ID. NO: 4.

Eine oder mehr als eine Aminosäure des erfindungsgemäßen scFv kann modifiziert werden, ohne dass die Fähigkeit des Antikörpers, spezifisch das bekannte mutierte Epitop in mutiertem p53, aber nicht in Wildtyp p53, zu erkennen, beeinträchtigt würde. Solche Modifikation sind dem Fachmann wohl bekannt und schließen (1) Substitutionen, z.B. das Substituieren hydrophiler oder hydrophober Aminsäuren mit anderen hydrophilen oder hydrophoben Aminosäuren, jeweils durch gerichtete Mutagenese, (2) Insertionen oder Deletionen von Aminosäuren an nicht wesentlichen Stellen und (3) chemische Modifikationen ein.

Somit schließt die Erfindung auch ein Polypeptid ein, das eine Polypeptidsequenz mit einer mindestens 95%igen Sequenzidentität und noch bevorzugter mit einer mindestens 99%igen Sequenzidentität zu SEQ. ID. NO.2 aufweist, wobei diese Polypeptidsequenz spezifisch das bekannte mutierte Epitop in mutiertem p53, aber nicht in Wildtyp p53 erkennt.

Die Modifikationen an dem DNA-Molekül oder dem scFv-Molekül können zum Ziel haben, dass dem scFv-Polypeptid zahlreiche Charakteristika verliehen werden, wie (1) erhöhte Spezifität für das mutierte p53-Molekül im Vergleich zu dem Wildtyp p53-Molekül, (2) höhere Affinität für das mutierte p53-Antigen, (3) erhöhte Stabilität und Resistenz gegenüber Proteolyse, (4) verbesserte in vitro und in vivo Expression und Löslichkeit des scFv-Antikörpers, und (5) bevorzugtes Targeting des scFv-Antikörpers gegen subzelluläre Stellen durch Inkorporation in den scFv-Antikörper von zum Beispiel ER und Kern-Zielpeptidsequenz, um so bevorzugte Ausführungsformen der Erfindung für pharmakologische und pharmazeutische Anwendungen herzustellen. Ein Beispiel für eine modifizierbare Domäne des scFv ist die CDR-Domäne. Diese Änderungen können nicht nur durch die Einführung von Nukleotidaustäuschen in das für das Polypeptid kodierende, klonierte scFv-Antikörpergen unter Verwendung von allgemein bekannten Verfahren der chemischen und enzymatischen Mutagenese erreicht werden, wie zum Beispiel oligonukleotidgerichtete Mutagenese und PCR-basierte Mutagenese (siehe Current Protocols in Molecular Biology, John Wiley and Sons,lnc., 1997. Band 1, Teil 8), sondern auch durch chemische Änderungen in der Aminosäuresequenz des scFv, wie Glykosylierung und die Erzeugung polyvalenter scFv-Antikörper (siehe Smythe J.A. et al., (1994) Protein Engineering 7:145–147).

Der erfindungsgemäße scFv-Antikörper hat deutliche Vorteile gegenüber den existierenden, monoklonalen Antikörpern. Deshalb können die oben beschriebenen Modifikationen problemlos mit dem scFv-Antikörper durchgeführt werden, nicht jedoch mit dem monoklonalen Antikörper. Die kleinere Größe von scFv ist auch ein Vorteil in intrazellulären Anwendungen.

In einem dritten Aspekt sieht die Erfindung eine pharmazeutische Zusammensetzung vor, die entweder ein DNA-Molekül, einen Vektor oder ein Antikörpermolekül gemäß der Erfindung und ein pharmazeutisch annehmbares Vehikel umfasst. Die Erfindung sieht die Verwendung von entweder einem DNA-Molekül, einem Vektor oder einem Antikörpermolekül gemäß der Erfindung bei der Herstellung einer solchen pharmazeutischen Zusammensetzung vor.

In einem vierten Aspekt sieht die Erfindung ein Verfahren zur Behandlung eines Patienten vor, der an einer Krankheit leidet, deren Ätiologie mit einer Mutation im p53 Gen zusammenhängt, wobei das Verfahren umfasst, dass dem Patienten eine pharmazeutische Zusammensetzung gemäß der Erfindung verabreicht wird.

Der erfindungsgemäße scFv kann bei der Behandlung einer Krankheit, deren Ätiologie von einer Mutation in dem p53 Gen bedingt ist, und im besonderen bei der Behandlung von Krebs von Nutzern sein.

Ein neuartiger und vielversprechender Ansatz in der Gentherapie von Tumoren liegt in der intrazellulären Expression von Antikörpern, die in der Lage sind, bestimmte onkogene Produkte zu inaktivieren oder deren Abbau auszulösen. Da mutiertes p53 deutliche onkogene Eigenschaften aufweist und im Zytosol einer großen Anzahl von Tumoren erscheint, kann ein intrazellulär exprimierter einkettiger Antikörper (Intrabody), der gegen dieses Protein gerichtet ist, als "Breitstpektrum"-Wirkstoff für die Tumortherapie dienen. Um den ME1 scFv an die Bedingungen der Expression im Zytosol von Säugetieren anzupassen, wurden mehrere Modifikationen in die scFv-DNA eingeführt, wie weiter unten noch detaillierter beschrieben wird.

Der scFv ME1 der Erfindung kann als leistungsstarker Hilfsstoff dienen, der in Lage ist, die Spezifität und Effektivität der beiden wichtigsten existenten Gentherapien für Krebserkrankungen zu verbessern.

Eine dieser Strategien nützt eine Überexpression des Wildtyps p53-Protein in Krebszellen. Trotz der vielversprechenden Ergebnisse, die in mehreren klinischen Studien bei der Verwendung dieser Technik erzielt werden konnten, wurde vor kurzem herausgefunden, dass Krebszellen, die eine mutierte Form von p53 tragen, weitgehend gegenüber dieser Behandlung resistent sind. Die Expression des scFV ME1-Moleküls als Intrabody, gebunden an die F-Box-Domäne, die für das Targeting der Zellproteine gegen die Abbaukaskade verantwortlich ist, kann möglicherweise dazu führen, dass das Niveau von mutiertem p53 in der Zelle signifikant reduziert wird, wodurch die Bandbreite an möglicherweise für die ursprüngliche Therapie empfänglichen Tumoren erhöht wird.

Eine weitere Antikrebstherapie im Entwicklungsstadium verwendet einen einkettigen Antikörper, der auf ein p53 Proteinepitop gerichtet ist, das sowohl in Wildtyp p53 als auch in mutierten p53-Molekülen vorhanden ist. Es bildet einen Teil des synthetischen Transkriptionsfaktors, der auch den bakteriellen Tetracyclinrepressor als eine DNA-bindende Domäne enthält. Die Strategie beruht auf der Tatsache, dass die mutierte Form des p53-Antikörpers als eine Art Bindemittel dient, wodurch eine Transaktivierungsfunktion durch p53 und die DNA-bindende Aktivität aus dem Tetracyclinrezeptor kombiniert werden. Der daraus resultierende Komplex kann die Transkription des unter die Steuerung des Promotor gestellten Proteintoxin, das Tetracyclinoperator-Sequenzen enthält, aktivieren. Der größte Nachteil dieser Strategie liegt in der unterschiedslosen Natur des verwendeten Antikörpers, was zu einer Aktivierung der Toxinexpression in einer Zelle führt, die eine beliebige Form des p53-Proteins enthält. Folglich kann nur die lokale Anwendung dieser Behandlung als sicher angesehen werden. Die Substitution des ursprünglichen Antikörpers durch den scFv ME1, der für die mutierte Form von p53 spezifisch ist, kann die therapeutische Wirkung ausschließlich auf Krebszellen beschränken, wodurch wiederum eine systemische Anwendung dieser Therapie ermöglicht wird.

Zusätzlich zu der klinischen Bedeutung kann der scFv ME1 Antikörper als wertvolles Mittel für Recherche und Diagnose dienen, wodurch das spezifische Markieren von mutierten p53 Molekülen im Inneren der Zelle ermöglicht wird. Die Mutation des p53 Gens führt zur Stabilisierung des Proteins und einem nachfolgenden Anstieg von intrazellulärem Protein, der ausreichend hoch ist, um durch Immunohistochemie detektiert zu werden. Die hohe Spezifität des scFv der Erfindung gegenüber einem Peptid-Epitop, das nur in mutierten Varianten von p53 erscheint, der Mangel an Fc-Teilen, die spezifisch an das Antigen binden und die hohe Permeabilität dieser kleinen Antikörper in Zellen machen den erfindungsgemäßen Antikörper zu einer geeigneten Sonde für die immunodiagnostische, klinische Detektion von p53 in Gewebe, und zwar unter Verwendung von herkömmlichen immunohistochemischen Techniken. Ein immunodiagnostisches Kit, das den scFv der Erfindung umfasst, konnte deshalb hergestellt werden. Solche Kits, die andere Antikörper zur Detektion andere Antigene verwenden, sind im Stand der Technik wohl bekannt.

DETAILLIERTE BESCHREIBUNG DER ZEICHNUNGEN

Um die Erfindung verständlicher zu machen und zu zeigen, wie sie in der Praxis umgesetzt werden kann, wird nun eine bevorzugte Ausführungsform als nicht einschränkendes Beispiel mit Bezug auf die begleitenden Zeichnungen beschrieben, worin:

1A ein Diagramm ist, welches die Bindung von (1) dem monoklonalen Antikörper PAb 240; (2) dem löslichen ME1 scFv; (3) Phagen-Display von ME1 scFv; und (4) Phasen-scFv ohne Bezug an eine mit mutiertem p53 beschichtete ELISA-Platte darstellt;

1b ein Diagramm ist, welches die Bindung von (1) dem auf Phagen präsentierten ME1 scFv und (2) dem monoklonalen Antikörper PAb 240 an mit mutiertem p53 beschichtete ELISA-Platten in Anwesenheit (graue Balken) oder Abwesenheit (gepunkteter Balken) des mutierten p53 Protein und in Anwesenheit von 100 &mgr;g/ml (schwarzer Balken) des Epitop-Peptids FHRSW darstellt.

2a die Nukleotid- (SEQ. ID. NO:1) und Aminosäuresequenzen (SEQ. ID. NO:2) des ME1 einkettigen Antikörpers zeigt, der spezifisch für das bekannte mutierte Epitop des mutierten p53 Protein ist.

Unterstrichen: Teile der Aminosäuresequenz die von Primern und Linker-DNA stammen; Kursiv: CDR1; Unterstrichene, kursive Bereiche: CDR2; Unterstrichene, kursive Bereiche in Fettschrift: CDR3, D in Fettschrift: erste Aminosäure der leichten Kette.

2b die Nukleotid- (SEQ. ID. NO:3) und Aminosäuresequenzen (SEQ. ID. NO:4) des ME1 einkettigen Antikörpers aus 2a zeigt, der für eukaryotische Expression modifiziert ist. Die Symbole entsprechen denen aus 2a;

3 die Detektion von ME1 scFv durch Western Blot mit einem für den scFV E-Tag spezifischen Antikörper zeigt. Von links nach rechts: periplasmatischer Extrakt der ME1 scFv exprimierenden E. coli HB2151 Zellen; periplasmatischer Extrakt der Kontroll-scFv exprimierenden E.coli XL-1 Zellen; Gesamtzellextrakt der MI1 scFv exprimierenden E.coli HB2151 Zellen Gesamtzellextrakt der Steuer-scFv exprimieren E.coli XL-1 Zellen zeigt;

4: Die Vektorkarte des pIRES-EGFP-ME1 Expressionsvektors zeigt; und

5: EGFP-Fluoreszenz in 293-Zellen, die mit a) dem pIRES-EGFP-ME1 scFv Konstrukt und b) nur dem pIRESEGFP Vektor transfiziert wurden, zeigt. Die Insertion der ME1 scFv-DNA in den Vektor führte zu einer Verschiebung einer Translationsinitüerung des EGFP zu dem abgeschwächten IRES, was wiederum zu einer reduzierten Geschwindigkeit der EGFP-Synthese und einem reduzierten Ausmaß der EGFP-Fluoreszenz im Vergleich zu Zellen, die nur mit dem Vektor allein transfiziert wurden, führte.

DETAILLIERTE BESCHREIBUNG EINER BEVORZUGTEN AUSFÜHRUNGSFORM A. MATERIAL UND METHODEN 1. Kovalente Kopplung des Epitop-Peptids an Mikrotiterplatten

Ursprünglich wurde das KFRHSW-Heptapeptid als ein Rohpräparat nach der Peptidsynthese am Weizmann Institut erhalten. Das N-terminale Lysin (K) wurde zu der nativen Hexapeptidsequenz hinzugefügt um eine kovalente Kopplung durch eine &egr;-Aminogruppe des Lysin zu den aktiven Gruppen des festen Trägers hinzuzufügen.

Die Reinigung des Peptids wurde auf dem Gilson-301 HPLC Chromatographer (Gilson, Frankreich) unter Verwendung der 5 &mgr;m Lichrosorb RP-18 Säule (Dr. Herbert Knauer KG, Deutschland) durchgeführt. 1 ml von 1 mg/ml Lösung des rohen Peptidpräparats wurde auf die zuvor mit 0,1%iger Trifluoressigsäure in Wasser (Lösung A) equilibrierten Säule aufgebracht. Die Elution wurde mit einem linearen Gradienten von 0 bis 100% von Lösung B (80%iges Acetonitril in Lösung A) für einen Zeitraum von 70 Minuten bei einer Flussrate von 1 ml/min durchgeführt. Das Eluat wurde im UV-Licht-Detektor bei 230 nm überwacht. Die erhaltenen Spitzenfraktionen wurden gepoolt und in einem SpeedVac getrocknet. Die Fraktionen, welche die Anwesenheit des Heptapeptids (wie durch Aminosäureanalyse am Weizmann Institut bestimmt) deutlich machten, wurden für die folgenden Arbeitsschritte ausgewählt.

Kovalente Bindung des Heptapeptids an Mikrotiterplatten. 96-well Mikrotiterplatten (Nunc. Dänemark) wurden mit dem epoxy-aktivierten, polymeren Träger Eupergit C (Rohm, Deutschland) gemäß den Anweisungen des Herstellers beschichtet. 200 &mgr;l von 0,2 M 1,4-Adipinsäuredihydrazid (Sigma, USA) in 0,2 M Carbonatpuffer, pH 9,0, wurden pro Well zu den mit Eupergit C beschichteten Platten hinzugefügt. Nach 16-stündiger Inkubation bei Raumtemperatur wurden die Platten geleert, mit 250 &mgr;l der blockierenden Lösung (0,2 M Mercaptoethanol in PBS) pro Well gefüllt und über Nacht bei 4°C gelagert. Im nächsten Schritt wurde die blockierende Lösung entfernt und Platten wurden durch Hinzufügen von 200 &mgr;l 25%iger Glutaraldehydlösung in Wasser pro Well (Merck, Deutschland) und 2-stündiger Inkubation bei Raumtemperatur aktiviert. Nach der Entfernung der Glutaraldehydlösung wurden die aktivierten Platten pro Well mit 100 &mgr;l des gereinigten Peptids, das in PBS gelöst war, gefüllt und für einen Zeitraum von 2 Stunden bei Raumtemperatur inkubiert. Der Inhalt der Wells wurde daraufhin mit 200 &mgr;l der blockierenden Lösung, die 1 % fettfreie Trockenmilch enthielt, ersetzt und über Nacht bei 4°C inkubiert. Nach der Inkubation wurden die Platten gründlich gewaschen, getrocknet, unter Vakuum in den Plastiktüten versiegelt und bei -20°C gelagert.

Das mutierte p53 Protein und das BSA-Heptapeptid-Konjugat wurden durch Inkubation des Proteins gelöst in 1 M Kpi (Kaliumphosphatpuffer, pH 8,0) kovalent an die mit Eupergit C beschichteten Mikrotiterplatten gebunden, woraufhin sie in der blockierenden Lösung bei 4°C über Nacht inkubiert wurden.

ELISA-Test. Alle ELISA-Tests in diesem Projekt wurden in 96-Well Mikrotiterplatten (Costar) durchgeführt. Rand-Wells wurden von den Analysen ausgeschlossen. 100 &mgr;l primärer Antikörper wurden bei dem Test routinemäßig auf jedes Well aufgebracht. Primäre Antikörper wurden zweifach verdünnt, entweder mit PBS, das 10% fettfreie Trockenmilch enthielt, oder mit BSA. Die Inkubationsbedingungen waren die folgenden: 1 Stunde bei 37°C für den flüssigen Kulturüberstand von monoklonalem Antikörper PAb240, 2 Stunden bei 37° C oder über Nacht bei 4°C für den Überstand von Phagenantikörpern oder den lösliche Antikörper enthaltenden, periplasmatischen Extrakt.

Um den kompetitiven ELISA-Test durchzuführen, wurden die gelösten primären Antikörper mit dem Antigen eine Stunde lang bei 37°C unter intermittierendem Schütteln vorinkubiert. Die Horseradish-Peroxidase (HRP)-konjugierten Hase-Anti-Maus-IgG-Antikörper (Sigma, USA) in einer Verdünnung von 1:2500 oder die HRP-konjugierten Ziege-Anti-M13-Phagenantikörper in der Verdünnung von 1:5000 (Pharmacia, Schweden) wurden als sekundäre Antikörper verwendet. Die Inkubationsbedingungen für einen sekundären Antikörper waren: 1 Stunde bei 37°C. Zwischen den Inkubationen wurden die Platten viermal in 0,05% Tween 20 enthaltendem PBS gewaschen, gefolgt von 4 Waschvorgängen in PBS. Um eine ELISA Reaktion zu entwickeln, wurden bei dem Test 30 &mgr;g o-Pheneylendiamin-Dihydrochlorid (Sigma, USA) in 15 ml 0,05 M Zitratpuffer, pH 5,0, kombiniert mit 4 &mgr;l 30%igem H2O2, gelöst und in 100 &mgr;l Aliquoten auf jeden Well aufgebracht. Nachdem sich eine gelbe Farbe eingestellt hatte, wurde die Reaktion durch Einführen von 50 &mgr;l von 4 N HCl in jeden Well gestoppt. Die Platten wurden in dem EasyReader 400 FW ELISA Leser (SLT, Österreich) bei 492 nm mit Referenz bei 405 nm gescannt.

II. Klonierung, Konstruktion und Phagen-Display von scFv aus der Milz von hyperimmunisierter Maus

Immunisierungsprotokoll: fünf weibliche BALB/c Mäuse wurden mit dem mutierten p53 Epitop-Peptip zu BSA konjugiert und mit dem Konjugat verstärkt. Um den Vorgang der Immunisierung zu verfolgen, ließ man die Mäuse ausbluten und polyklonale Sera wurden gemäß Harlow E. Lane D. (1988) Antibodies: Laboratory Manual; Cold Spring Harbor Laboratory Press, NY USA, hergestellt. Titer der für das konjugierte und nicht konjugierte Heptapeptid spezifischen Antikörper wurden in ELISA-Assays gemessen, wie in Abschnitt 1 beschrieben.

Splenozytenisolierung: um Splenozyten zu erhalten, wurde eine Maus mit dem höchsten spezifischen Antikörpertiter geopfert, ihre Milz wurde aseptisch entfernt und in kleine Stücke geschnitten. 25 ml steriles DMEM mit hoher Glukose (4,5 g/l) (Biological Industries (Israel)), versetzt mit 10%igem, durch Hitze inaktiviertem (56°C, 30 Minuten) Pferdeserum (Biological Industries, Israel), 4 mM L-Glutamin (Biological Industries, Israel), 100 E/ml Penicillin- und Streptomycinlösung (Biological Industries, Israel) wurden zu der geschnitten Milz hinzugefügt und durch eine sterile Pipette mit großer Öffnung aufpipettiert. Die Milzzellensuspension wurde in ein steriles 50 ml Zentrifugenröhrchen transferiert und die Zellen wurden bei 800 x g in einer Sorvall GLC-4 Zentrifuge 5 Minuten lang pelletiert. Der Überstand wurde entfernt und das Zellpellet wurde bei –70°C gelagert.

mRNA-Isolierung: mRNA-Isolierung aus den Splenozyten wurde mit Hilfe des QuickPrep m-RNA-Reinigungskits (Pharmacia, Schweden) gemäß den Anweisungen des Herstellers durchgeführt.

III. Konstruktion des einkettigen Antikörpers (ScFv)

Ein scFv-Genfragment wurde mit Hilfe des Recombinant Phage Antibody System Kit (Mouse ScFv Modul) von Pharmacia (Schweden) gemäß den Anweisungen des Herstellers konstruiert.

First-strand cDNA-Synthese: Die RNA-Probe (OD260 – 0,02) wurde 10 Minuten lang in einer Tischzentrifuge bei –4°C zentrifugiert. Das Präzipitat wurde zweimal mit kaltem (–20°C), 95%igem Ethanol gewaschen, getrocknet und in 20 &mgr;l mit DEPC behandeltem Wasser gewaschen. Zwei Aliquoten (jeweils 5 &mgr;l) der mRNA-Lösung wurden in 0,5 ml Mikrozentrifugeneröhrchen platziert und für 10 Minuten auf 65°C erhitzt. Für jede Aliquote wurde die Reaktionsmixtur in 0,5 ml Röhrchen (ein Röhrchen für die leichte Kette des Antikörpers und ein anderes für die schwere Kette des Antikörpers) hergestellt. 16 &mgr;l mit DEPC behandeltes Wasser, 11 &mgr;l geprimte First-strand Mischung (rekombinante Reverse Transkriptase des Moloney Murine Leukemia Virus), zufällige Hexadesoxyribonukleotide, RNAguard, RNase-/DNase-freie BSA, dATP, dCTP,dGTP und dTTP in wässrigem Puffer) und 1 &mgr;l 200 mM DTT Lösung. Aliquoten der mRNA wurden kurz nach Erhitzen auf Eis gekühlt, zu der Reaktionsmischung hinzugefügt und 1 Stunde lang bei 37°C inkubiert.

Primäre PCR-Amplifikation: die folgenden Mischungen wurden in 0,5 ml Röhrchen hergestellt. für die PCR der leichten Kette – 2 &mgr;l der Light Primer Mischung (Mischung aus 10 variablen Primern der leichten Kette in Wasser) und 64 &mgr;l steriles, destilliertes Wasser; für die PCR der schweren Kette – 2 &mgr;l Primer 1 der schweren Kette (stromaufwärtiger Primer in Wasser), 2 &mgr;l Primer 2 der schweren Kette (stromabwärtiger Primer in Wasser) und 62 &mgr;l steriles, destilliertes Wasser. Zu jedem Röhrchen wurden 33 &mgr;l der First-Strand Reaktionsmischung hinzugefügt und mit 0,1 ml Mineralöl überschichtet. Die Röhrchen wurden in einem Thermocycler platziert und 5 Minuten lang auf 95°C erhitzt. 1 &mgr;l AmpliTaq DNA-Polymerase von 5000 E/ml (Perkin-Elmer Cetus, USA) wurde jedem Röhrchen hinzugefügt. Die PCR-Reaktion wurde mit einem Programm wie folgt durchgeführt: 30 Zyklen – 94°C für 1 Minute; 55°C für 2 Minuten; 72°C für 2 Minuten.

Reinigung von primären PCR-Produkten: die Reinigung von PCR-Produkten wurde durch Gelelektrophorese in 1,5% Agarosegel (50 &mgr;l jeder PCR Mischung pro Well) durchgeführt. Molekulargewicht Marker waren 100 Base-Pair Ladder Mischung (Pharmacia, Schweden) und der Haell Verdau von f174 RF (Eastman-Kodak, USA). Die DNA-Banden von 340 und 325 Basenpaaren (jeweils entsprechend der schweren und der leichten Kette) wurden heraus geschnitten und die DNA wurde mit Sephaglas Bandprep Kit (Pharmacia, Schweden) gereinigt. Die DNA wurde in 20 &mgr;l Tris-HCl (pH 8,3), 0,1 M EDTA-Puffer (TE-Puffer) aufgelöst und bei –20°C gelagert.

Gel-Quantifizierung des gereinigten Produkts und inneren Fragments: Aliquoten (2 &mgr;l) jeder DNA-Probe und 2 &mgr;l einer Linker-Primer-Mischung (gleichmolare Mischung von 3' schweren und 5' leichten Linker-Primern in Wasser) wurden in 1,5% Agarose elektrophoresiert. BstEIII-Verdau und HindIII-Verdau von Lambda-DNA wurden als Standards verwendet. Relative Mengen von Produkten der schweren und leichten Kette und die Linker-Primer-DNA wurden visuell nach Färben mit Ethidiumbromidlösung geschätzt.

Assemblierung und Fill-in-Reaktionen: die folgenden Reaktionsmischungen wurden in 0,5 ml Röhrchen hergestellt: 0,5 &mgr;l Produkt der schweren Kette, 2 &mgr;l Produkt der leichten Kette, 1 &mgr;l der Linker-Primer-Mischung 2,5 &mgr;l 10XPCR-Puffer, 1,25 &mgr;l dNTP-Mischung (jeweils 20 mM pro dNTP). 2,5 &mgr;l von 25 mM MgCl2, 1 &mgr;l AmpliTaq DNA-Polymerase und 9,25 &mgr;l steriles, destilliertes Wasser. Die Mischungen wurden mit 25 &mgr;l Mineralöl überschichtet. Die Röhrchen wurden in einem Thermocycler platziert und ein Programm wurde durchgeführt: 20 Zyklen – 94°C für 1 Minute, 63°C für 4 Minuten.

Zweite PCR-Amplifikation und Reinigung: Eine 75 &mgr;l Mischung enthaltend 1,5 &mgr;l AmpliTaq DNA-Polymerase, 7,5 &mgr;l 10xPCR-Puffer, 1,5 &mgr;l dNTP-Mischung, 6 &mgr;l RS Primer-Mischung (Mischung aus 5'-Primer der schweren Kette mit Sfil-Stelle und 3' Primer der leichten Kette mit Notl-Stelle in Waser) und 58,5 &mgr;l steriles destilliertes Wasser wurde hergestellt. 25 &mgr;l der Mischung wurde der Assemblierungsreaktion hinzugefügt, mit 25 &mgr;l Mineralöl überschichtet und dem obigen Programm unterzogen. Nach der PCR wurden 5 &mgr;l Aliquoten der Mischungen durch Elektrophorese in 1,5% Agarose mit einem BstEII-Verdau von Lambda-DNA als Standard analysiert. Die DNA-Bande von 750 Basenpaaren wurde herausgeschnitten und das DNA-Produkt wurde mit Sephaglas Bandprep Kit gereinigt. Die gereinigte DNA-Probe wurde in 20 &mgr;l TE-Puffer gelöst und bei –20°C gelagert.

PCR-Amplifikation des assemblierten Produkts: die folgende Reaktionsmischung wurde in drei 0,5 ml Röhrchen hergestellt: 2 &mgr;l des assemblierten einkettigen DNA-Produkts aus dem vorhergehenden Verfahren, 4 &mgr;l der RS Primer-Mischung, 5 &mgr;L 10xPCR-Puffer, 2,5 &mgr;l dNTP-Mischung, 5 &mgr;l MgCl2-Lösung (die Molarität der Lösung wurde in verschiedenen Röhrchen variiert) und 30,5 &mgr;l steriles, destilliertes Wasser (17). Die Molarität des MgCl2 wurde wie folgt variiert: 25 mM, 45 mM und 85 mM. Jede Mischung wurde mit 50 &mgr;l Mineralöl überschichtet und die Röhrchen wurden 5 Minuten lang bei 95°C in einem Thermocycler platziert. 1 &mgr;l AmpliTaq DNA-Polymerase von 5000 E/ml wurde jedem Röhrchen hinzugefügt. Die PCR-Reaktion wurde unter Verwendung des folgenden Programms durchgeführt: 30 Zyklen – 94°C für 1 Minute; 55°C für 2 Minuten; 72°C für 2 Minuten. Das amplifizierte, 750 Basenpaare umfassende Band wurde durch Elektrophorese in 1,5% Agarosegel separiert und das DNA-Produkt von dem Gel unter Verwendung von Sephaglas Bandprep Kit isoliert. Die gereinigte DNA-Probe wurde in 20 &mgr;l TE-Puffer gelöst und bei –20°C gelagert.

Restriktionsverdau: 4 &mgr;l der gereinigten scFv-DNA-Probe aus dem vorhergehenden Schritt wurden mit den 5 &mgr;l 10 Sfil-Puffer und den 5 &mgr;l des Sfil-Restriktionsenzym (Pharmacia, Schweden) kombiniert. Das Gesamtvolumen wurde mit sterilem, destilliertem Wasser auf 50 &mgr;l gebracht und die Mischung, überschichtet mit 50 &mgr;l Mineralöl, wurde über Nacht bei 50°C inkubiert. Eine Notl-Restriktionsverdau-Mischung wurde durch Mischen von 2,5 &mgr;l 5M NaCl, 5 &mgr;l 10 x Notl-Puffer, 7,5 &mgr;l Notl-Restriktionsenzym und 35 &mgr;l sterilem, destilliertem Wasser hergestellt. Insgesamt 50 &mgr;l der Mischung wurden unter die Mineralölschicht des Sfil-Verdaus pipettiert und über Nacht bei 37°C inkubiert. Nach dem Restriktionsverdau wurde die Probe für 15 Minuten auf 65°C erhitzt. Eine MicroSpin-Säule, beladen mit dem Sephacryl S-400 HR Harz (Pharmacia, Schweden) wurde mit dem verdünnten Ligationspuffer equilibriert (40 &mgr;l des Ligationspuffer und 160 &mgr;l steriles, destilliertes Wasser). Das gesamte verdaute PCR-Produkt (mit Ausnahme des Mineralöls) wurde auf die MicroSpin Säule aufgebracht und bei 800 x g für 20 Sekunden in 1,5 ml Mikrozentrifugeröhrchen zentrifugiert. Das die gereinigte scFv-DNA enthaltende Eluat wurde gesammelt.

Ligation des scFv-Gen in den pCANTAB 5E Expressionsvektor. 25 &mgr;l des scFv-Genprodukts wurden mit 2 &mgr;l der 50 ng/&mgr;l Lösung der vorverdauten DNA des pCANTAB 5E Expressionvektors (Pharmacia, Schweden), 7 &mgr;l Ligationspuffer und 3 &mgr;l T4 DNA-Ligase (Gibco URL, USA) kombiniert. Die Mischung wurde über Nacht bei 16°C in einem 1,5 ml Mikrozentrifugenröhrchen inkubiert.

Transformation: 200 &mgr;l zu Elektroporation fähigen E.coli TG1 Zellen (hergestellt wie in Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press, NY, USA beschrieben) wurden durch 15 &mgr;l der ligierten Phagemidantikörper scFv-DNA unter Verwendung eines Bio Rad Gene Pulser mit den folgenden Einstellung transformiert: 25 &mgr;F, 2,5 kV bei 200 Ohm. Das DNA-Präparat wurde durch Tropfendialyse vor der Elektroporation entsalzen. Transformierte Zellen wurden mit 800 &mgr;l frischem SOC-Medium verdünnt und für 1 Stunde bei 30°C unter Schütteln mit 150 Upm inkubiert. Nach der Inkubation wurden Zellen auf SOB-Agarplatten enthaltend 100 &mgr;l Ampicillin aufplattiert und über Nacht bei 30°C gezüchtet.

Gewinnung der Phagemidbibliothek von den Platten: die Platten wurden mit 5 ml 2xYT-Medium (Sambrook, et al, wie oben angegeben) beschickt und die Kolonien wurden durch Lösen mit einem sterilen Glasspate) resuspendiert, auf sterile 50 ml Polypropylenröhrchen transferiert und mit 2xYT Medium enthaltend 100 &mgr;g/ml Ampicillin und 2 M Glucose verdünnt, bis ein A600 von 0,2–0,4 erreicht war. Die verdünnten Zellen wurden bei 37°C gezüchtet, unter Schütteln mit 200 Upm bis ein Asoo von 0,7 erreicht wurde. Die Phagengewinnung wurde durch Infektion der Zellsuspension mit 2,5 x 109 pfu pro ml M13KO7 Phage (Pharmacia, Schweden) und Inkubation für einen Zeitraum von 30 Minuten bei 37°C unter Schütteln mit 100 Upm, gefolgt von einer 30 minütigen Inkubation unter Schütteln bei 200 Upm durchgeführt. Die Zellen wurden durch Zentrifugieren in einer klinischen Zentrifuge (Sorvall GLC-4) bei Höchstgeschwindigkeit für 10 Minuten pelletiert. Der Überstand wurde entsorgt, wohingegen das Pellet in 1 ml 2xYT-Medium enthaltend 100 &mgr;g/ml Ampicillin und 50 &mgr;g/ml Kanamycin resuspendiert und in sterile 17 x 100 mm Kulturröhrchen (Falcon) gefüllt mit 4 ml des Mediums verwendet bei der Pelletresuspension transferiert wurde. Nach der Inkubation über Nacht bei 30°C unter Schütteln bei 200 Upm wurden die Zellen bei Höchstgeschwindigkeit in einer klinischen Zentrifuge (Sorvall GLC-4) für 15 Minuten pelettiert und der die rekombinanten Antikörperphagen enthaltende Überstand wurde gesammelt, durch einen 45 &mgr;m (Millipore) Filter gefiltert und in den sterilen 17 x 100 mm Kulturröhrchen (Falcon) bei 4°C gelagert.

Panning zur Selektion antigenpositiver, rekombinanter Phagenantikörper. Vier Panning-Runden wurden in 96-Well Mikrotiterplatten durchgeführt (Costar, USA), die wie in Teil I beschrieben mit 10 &mgr;g/ml des BSA-Heptapeptidkonjugats beschichtet waren. Der Phagenüberstand wurde zweifach mit PBS enthaltend 1 % fettfreier Trockenmilch verdünnt und in Aliquoten von 200 &mgr;l in jeden Well der Mikrotiterplatten aufgetragen. Nach Inkubation über Nacht bei 4°C wurden die Platten 10 Mal mit PBS enthaltend 0,2% Tween 20 und 10 Mal mit PBS gewaschen. Um den gebundenen rekombinanten Phagen zu eluieren wurden 200 &mgr;l Log-Phasen TG1 E.coli Zellsuspension in jeden Well hinzugefügt und unter intermittentem, behutsamem Schütteln für 30 Minuten bei 37°C inkubiert. Nach der Inkubation wurden Inhalte jedes Wells gesammelt und gemeinsam gepoolt. Mehrere 200 &mgr;l Aliquoten wurden aus dem kombinierten Pool entnommen, auf SOBAG-Platten (9) aufplattiert und über Nacht bei 30°C inkubiert. Die Mikrotiterplatten, die mit 1 &mgr;g/ml und 0,1 &mgr;g/ml des Konjugats beschichtet waren, wurden jeweils für die fünfte und sechste Panning-Runde verwendet. Die mit 10 &mgr;g/ml BSA beschichteten Platten wurden als negative Kontrolle verwendet. Im zweiten Teil des Panningverfahrens wurden zwei Panning-Runden auf den mit 1 &mgr;g/ml des mutierten p53 Protein beschichteten Mikrotierplatten durchgeführt. Ein Bacteriophage Plaque Counting Assay wurde wie in Sambrook et al. (wie oben angegeben) durchgeführt.

Gewinnung von angereicherten Phagenklonen auf Mikrotiterplatten: 100 x &mgr;l 2YT-Medium enthaltend 100 &mgr;g/ml Ampicillin und 2% Glukose auf jeden Well in einer sterilen 96-Well Mikrotiterplatte. Individuelle Kolonien wurden unter Verwendung steriler Zahnstocher in separate Wells transferiert und über Nacht bei 30°C unter behutsamen Schütteln (weniger als 100 Upm) inkubiert. 20 &mgr;l gesättigte Kultur aus jedem Well wurden in einen entsprechenden Well in der zweiten Mikrotiterplatte transferiert. Jeder Well dieser Platte wurde zuvor mit 180 &mgr;l 2xYT Medium enthaltend 100 &mgr;g/ml Ampicillin, 2% Glucose und 108 pfu M13KO7 Phage gefüllt. Die zweite Mikrotiterplatte wurde für 2 Stunden bei 37°C unter Schütteln bei 100 Upm inkubiert. Die Inhalte jedes Wells wurden in individuelle 1,5 ml Mikrozentrifugenröhrchen transferiert und bei 1000 x g für 10 Minuten pelletiert. Überstände wurden entsorgt und Pellets wurden in 200 &mgr;l 2xYT Medium enthaltend 100 &mgr;g/ml Ampicillin und 50 &mgr;l Kanamycin resuspendiert. Die Röhrchen wurden über Nacht bei 30°C unter Schütteln bei 100 Upm inkubiert. Nach der Inkubation wurden die Zellen wie oben beschrieben pelletiert, Überstände wurden geerntet und in die sterilen Mikrozentrifugenröhrchen transferiert und bei 4°C gelagert.

PEG-Präzipation des Phagenantikörper-Überstands: 1 ml Aliquoten des Phagenantikörper-Überstands wurden jeweils mit 200 &mgr;l PEG-NaCl Lösung gemischt, eine Stunde lang auf Eis inkubiert und in einer Eppendorf Mikrozentrifuge 30 Minuten lang bei 4°C zentrifugiert. Die Überstände wurden vorsichtig abgesaugt und entsorgt. Die Pellets wurden mit 10 &mgr;l sterilem TE-Puffer resuspendiert und bei 4°C gelagert.

Infektion von E.coli HB2151 Zellen – E.coli HB2151 Zellen wurden bis zum Erreichen der logarithmischer Phase in 5 ml 2xYT Medium gezüchtet. 200 &mgr;l Log-Phasen Zellen wurden mit 2 &mgr;l der präzipitierten Phagenantikörper infiziert und unter behutsamen Schütteln für 30 Minuten bei 37°C inkubiert. 20 &mgr;l Aliquoten der infizierten Kultur wurden auf SOBAG-N Platten aufplattiert und über Nacht bei 30°C gezüchtet.

Herstellung löslicher Antikörper. Mehrere frische Kolonien wurden aus SOBAG-N Platten ausgewählt. Jede Kolonie wurde auf 5 ml SB-AG Medium transferiert und über Nacht bei 30°C unter Schütteln bei 200 Upm inkubiert. Die Übernachtkultur wurde mit SB-AG Medium auf 50 ml verdünnt und 1 Stunde lang bei 30°C unter Schütteln mit 200 Upm verdünnt. Die Zellen wurden durch Zentrifugieren bei 1500 x g für 15 Minuten bei Raumtemperatur in einer Sorvall GLC-4 Zentrifuge pelettiert, in 50 ml SB-Al Medium resuspendiert und über Nacht unter Schütteln mit 200 Upm in 500 ml Kolben inkubiert. Jede Übernachtkultur wurde in zwei gleiche Aliquoten aufgeteilt und bei 1500 x g für 30 Minuten bei Raumtemperatur zentrifugiert. Die Überstände wurden gesammelt, durch einen 0,45 um Filter gefiltert und bei 4°C gelagert.

Um den periplasmatischen Extrakt herzustellen, wurden eines der Zellkulturpellets in 0,5 ml PBS enthaltend 1 mM EDTA resuspendiert und auf Eis für 30 Minuten inkubiert. Die Inhalte wurden in 1,5 ml Mikrozentrifugenröhrchen transferiert und bei höchster Geschwindigkeit 30 Minuten lang bei 4°C in einer Mikrozentrifuge zentrifugiert. Der Überstand wurde vorsichtig in ein sauberes Röhrchen transferiert und bei –20°C gelagert.

Um den gesamten Zellextrakt herzustellen wurde das zweite aus der Über Nachtkultur erhaltene Pellet in 0,5 ml PBS resuspendiert und für Minuten gekocht. Die Zelltrümmer wurden wie oben beschrieben pelletiert, der Überstand wurde in ein sauberes Röhrchen transferiert und bei –20°C gelagert.

Der Überstand, periplasmatische und ganze Teile des Zellextrakt wurden mit Hinblick auf die Anwesenheit von löslichen Antikörpern mit ELISA und Western Blot Assays analysiert.

10. Detektion von löslichen Antikörpern in Überstand, periplasmatischem Extrakt und Gesamtzellextrakt: die Detektion erfolgte mit dem anti-E Tag monoklonalen Antikörper (Pharmacia, Schweden), der für den Peptid E-Tag auf dem C-terminal von einkettigen, unter Verwendung des pCNATAB 5E Vektors exprimierten, Antikörperfragmenten spezifisch ist. Elektrophorese und Proteintransfer wurden im Wesentlichen wie in Sambrook. et al. (wie oben angegeben) durchgeführt. Die ELISA- und Western Blot Assays wurden gemäß den Anweisungen des Verkäufers der Anti-E-Tag Antikörper durchgeführt. Die Visualisierung der Proteinbande wurde durch ein verbessertes Chemilumineszenzverfahren durchgeführt. Die mit Antigen beschichteten Mikrotiterplatten für den ELISA-Assay wurden wie in Teil Eins beschrieben hergestellt.

DNA-Sequenzierung: Die DNA-Sequenz, die für den scFv ME1 Antikörper aus der Milz von hyperimmunisierten Mäusen kodiert, wurde unter Verwendung eines Applied Biosystems Model 377 Automated DNA Sequencing System in den Einrichtungen der Fakultät für Life Sciences der Universität von Tel Aviv bestimmt.

Doppelsträngige DNA-Templates für das Sequenzieren wurden mit Hilfe des Quiagen DNA-Reinigungskits gemäß des Herstellerprotokolls hergestellt. Einsträngige DNA-Templates wurden aus den rekombinante, einkettige Antikörper tragenden Phagenpartikeln durch Chloroformtechnik, wie in Sambrook. et al. beschrieben, hergestellt.

IV Expression von scFv ME1 – der einkettige Antikörper spezifisch für das bekannte Epitop von mutiertem p53 Protein – in eukaryotischen Zellen

Subklonieren des scFv ME1 Genfragmenfs in den pIRES-EGFP Expressionsvektor. Der Restriktionsverdau des pIRES-EGFP wurde durch Inkubation des 1 &mgr;g Vektor-DNA mit 1 &mgr;l von 10 Einheiten/&mgr;l Lösung von EcoR1 Restriktionsenzym (MBI Fermentas, Litauen) in EcoR1-Puffer bei 37°C über Nacht durchgeführt. Die verdaute DNA wurde in stark salziger Konzentration präzipitiert wie in (10) und durch Inkubation mit 5 &mgr;l von 1000 Einheiten/ml Lösung der alkalinen Phosphatase aus dem Kalbsdarm (Boehringer, Deutschland) dephosphoryliert. Die verdaute und dephosphorylierte DNA wurde mit Hilfe des High Pure PCR Product Purification Kit (Boehringer, Deutschland) gemäß den Anweisungen des Herstellers gereinigt und in 100 &mgr;l sterilem, destilliertem Wasser verdünnt.

Das scFv ME1 DNA-Fragment wurde durch PCR-Amplifikation unter Verwendung des pCANTAB5E-scFvME1 Konstrukts als Template hergestellt. Die Reaktionsmischung bestehend aus 10 &mgr;l Taq DNA-Polymerase-Puffer, 2 &mgr;l 10 mM dNTP Lösung, 8 &mgr;l 25 mM MgCl2 Lösung, 2 &mgr;l von 1 mM Lösung des Forward-Primer GCGAATTCATGGCCCAGGTCAA, 2 &mgr;l von 1 mM Lösung des Reverse-Primers GGAATTCAGTCTATGCGGCACG und 10 ng der Template-DNA wurden mit sterilem, destilliertem Wasser auf das Gesamtvolumen von 100 &mgr;l in 0,5 ml Röhrchen verdünnt. Das Röhrchen mit Reaktionsmischung wurde im PTC-200 Thermocycle (MJ Research, USA) platziert, 5 Minuten lang auf 95°C erhitzt und 1 &mgr;l von 5000 E/ml Lösung von Taq DNA-Polymerase (Fermentas, Litauen) wurde hinzugefügt. Die PCR-Reaktion wurde mit einem Programm wie folgt durchgeführt: 30 Zyklen – 94°C für 45 Sekunden; 55°C für 1 Minute; 72°C für 30 Sekunden. Das PCR-Produkt wurde mit Hilfe des High Pure PCR Product Purification Kit (Boehringer, Deutschland) gereinigt und 500 ng seiner DNA wurden dem Restriktionsverdau mit 1 &mgr;l von 10 Einheiten/&mgr;l Lösung von EcoR1 Restriktions-Endonuklease (MBI Fermentas, Litauen) in EcoR1-Puffer bei 37°C über Nacht unterzogen. Die verdaute DNA wurde wie oben beschrieben gereinigt und in 50 &mgr;l sterilem, destilliertem Wasser verdünnt.

Die Ligationsreaktion wurde durch Mischen von 1 &mgr;l von EcoR1 – verdauter und dephosphorylierter pIRES-EGFP DNA Lösung, 6 &mgr;l von EcoR1 – verdauter scFv ME1 DNA-Lösung 2 &mgr;l T4 DNA-Ligase 5x Puffer, 1 &mgr;l T4 DNA-Ligase (BRL, USA) vorbereitet und über Nacht bei 16°C inkubiert. 3 &mgr;l der Ligationsmischung wurden für Transformation von kompetenten E.coli Zellen durch Elektroporation, wie in Teil II beschrieben, entnommen. Transformierte Zellen wurden auf LB-Agarplatten (Sambrook et al., wie oben beschrieben) enthaltend 100 &mgr;l Ampicillin aufplattiert und über Nacht bei 37°C gezüchtet. Kolonien wurden neu plattiert und ihre Plasmid-DNA wurde unter Verwendung von High Pure Plasmid DNA Purification kit (Boehringer, Deutschland) isoliert. 10 &mgr;l jedes Plasmid-DNA-Präparats wurden dem Restriktionsverdau durch Inkubation mit 0,1 &mgr;l einer Lösung von BamHI Restriktions-Endonuklease (Fermentas, Litauen) bei 37°C über Nacht unterzogen Ausgewählte Kolonien wurden über Nacht in 10 ml LB-Medium bei 37°C unter Schütteln bei 200 Upm über Nacht gezüchtet. Die pIRES-EGFP-scFvME1 Plasmid-DNA wurde mit Hilfe des Quiagen Plasmid Purification Kit (Quiagen, USA) isoliert.

Expression von scFv ME1 in eukaryotischen Zellen – 293-Zelllinie (transformierte, primäre, embryonale, menschliche Nierenzellen) wurde in Dulbecco's Modified Eagle's Medium (DMEM) mit hoher Glukose (4,5 g/l) (Biological Industries (Israel)) supplementiert mit 5 mM L-Glutamin (Biological Industries (Israel)), 100 E/ml Penicillin- und Streptomycinlösung (Biological Industries, Israel) und 15% durch Hitze inaktiviertes (56°C, 30 Minuten) fetales Kälberserum (Biological Industries (Israel)) gezüchtet. Zellen wurden bei 10% CO2 bei 37°C in einer sechs-Well oder 35 mm Gewebskulturplatte (Costar, USA) bis 50% oder 70% Konfluenz vor Transfektion gezüchtet. Das Transfektionsverfahren wurde mit Hilfe von LipofecAMINE-Reagent (Gibco BRL, USA) in der folgenden Reihenfolge durchgeführt:

  • 1) 1,5 &mgr;g der transfizierenden DNA wurde in 100 &mgr;l des OPTI-MEM 1 reduzierten Serummedium (Gibco BRL, USA) in 12 x 75 mm sterilen Röhrchen (Falcon, USA) verdünnt;
  • 2) 7 &mgr;l von LipofectAMINE-Reagent wurden in 100 ml OPTI-MEM Medium in 12 x 75 mm sterilen Röhrchen verdünnt;
  • 3) Die beiden Lösungen wurden kombiniert und behutsam vermischt und für 45 Minuten bei Raumtemperatur inkubiert.
  • 4) Nach der Inkubation wurden 0,8 ml OPTI-MEM Medium zu jedem Röhrchen hinzugefügt, behutsam gemischt und die Rezipientenzellen, die zuvor mit 2 ml OPTI-MEM Medium gespült wurden, wurden damit überschichtet.
  • 5) Nach 5-stündiger Inkubation mit der Transfektionsmischung wurde 1 ml Wachstumsmedium enthaltend 30% fetales Kälberserum zu den Zellen hinzugefügt.
  • 6) Das Medium wurde 24 Stunden nach dem Start der Transfektion mit frischen, vollständigem Wachstumsmedium ersetzt.

48 Stunden nach der Transfektion wurden die Zellen einmal mit sterilem PBS gespült und EGFP-Fluoreszenz wurde mikroskopisch festgestellt.

Nach Beendigung der Fluoreszenzdetektion wurden Zellen von Gewebskulturplatten mit Hilfe eines Zellschabers („rubber policeman") geerntet, in 2 ml sterilem PBS enthaltend 0,5% Nonidet P-40 (Sigma, USA) resuspendiert und 5 Minuten lang auf Eis inkubiert. Die Suspension wurde 5 Minuten lang bei 1000 Upm in einer Tischzentrifuge bei 4°C zentrifugiert.

Überstand, der zytoplasmatisches Lysat enthielt, wurde gesammelt und bei –20°C eingefroren. Die Elektrophorese und der Western Blot Assay wurden entsprechen der Ausführungen in Abschnitt III durchgeführt.

Der Assay zur Transfektionseffizienz wurde unter Verwendung des pUT535-&bgr; gal Expressionsvektors durchgeführt.

V. Klonierung, Konstruktion und Phagen-Display von scFv aus der Milz hyperimmunisierter Mäuse (a) Immunisierungsprotokoll

Fünf weibliche BALB/c Mäuse wurden mit dem mutierten p53 Epitop-Peptip zu BSA konjugiert und mit dem Konjugat verstärkt. Um den Vorgang der Immunisierung zu verfolgen, wurden die Mäuse ausgeblutet und polyklonale Sera wurden gemäß Harlow E. Lane D. (1988), wie oben angegeben, hergestellt. Titer der für das konjugierte und nicht konjugierte Heptapeptid spezifischen Antikörper wurden in ELISA-Assays gemessen und oben in Abschnitt I beschrieben.

B. BEISPIELE 1. Isolierung des einzelkettigen Antikörper ME1 aus einer Phagendisplay-Bibliothek hergestellt mit dem mutierten p53 Peptid.

BALB/c Mäuse wurden mit dem mutierten p53 Epitop-Peptip (FRHSW) zu BSA konjugiert und mit dem Konjugat verstärkt. Eine immunisierte Maus, die den am Ende höchsten Serumtiter der Antikörper gegen das Konjugat (mehr als 1/1000, wie durch ELISA getestet) aufwies, wurde ausgewählt, ihre Milz wurde entfernt und die Splenozyten durch wiederholtes Waschen mit DMEM-Medium extrahiert; die mRNA wurde isoliert und die Splenozyten durch das RT-PCR Verfahren in cDNA konvertiert. Zwei PCR Klonierungsreaktionen für die variablen Regionen von schweren (VH) und leichten (VL) Ketten von Antikörpergenen wurden mit den Primersets im Recombinant Antibody Phage System Kit (Pharmacia) durchgeführt. Die zwei DNA-Fragmente wurden mit dem Linker-DNA-Fragment aus dem selben Kit assembliert. Die resultierende einkettige Antikörper-DNA (scFv) wurde in den pCANTAB 5E Expressionsvektor (Pharmacia) kloniert. E. coli TG1-Zellen wurden mit dem obigen Konstrukt transformiert. Auf Phagen präsentierte scFv-Moleküle wurden durch Gewinnung der scFv-DNA des Phagemids pCANTAB 5E mit dem Helferphagen M13KO7 aus den gepoolten ampicillinresistenten Transformanten hergestellt.

Das Biopanning wurde in zwei Abschnitte unterteilt. Im ersten Abschnitt wurden vier Panning-Runden auf mit dem Konjugat beschichteten ELISA-Platten durchgeführt; in den letzten zwei Runden wurde die Konzentration des Konjugats auf der Platte sequentiell um eine Größenordnung pro Runde reduziert, um so den Phagen mit der höchsten Affinität zu dem Peptid auszuwählen. Als negative Kontrolle wurde Panning auf mit BSA beschichteten ELISA-Platten durchgeführt. Die Anzahl an Phagen, die nach der vierten Panning-Runde von den antigenbeschichteten Platten eluierten, wurden um 2 Größenordnungen im Vergleich zu der mit BSA beschichteten Platte angereichert. Im zweiten Teil des Panningverfahrens wurden zwei zusätzliche Runden auf mit dem mutierten p53-Protein beschichteten ELISA-Platten durchgeführt. Wie zuvor wurde die Antigenkonzentration auf der Platte nach und nach um einen Größenordnung pro Runde reduziert. Die Anzahl an Phagen, die nach der letzten Panning-Runde eluierten, betrug 105 PFU.

E.coli TG1 Zellen wurden mit den eluierten Phagen infiziert und ihre Titer wurden untersucht. Einzelne erhaltene Kolonien wurden verwendet, um 90 individuelle Phagenklone zu gewinnen. Diese wurden durch ELISA (1a) analysiert. Sechs ELISA-positive Phagen wurden ausgewählt. Ihre Spezifität mit Bezug auf das Antigen wurde in einem kompetitiven ELISA-Assay unter Verwendung von p53 und dem Epitop-Peptip (1b) analysiert. Zusätzlich wurde ihre Fähigkeit, als lösliches Protein separat von dem Phagenantikörper synthetisiert zu werden, bestimmt. Zwei der Phagen, welche die beste Ausbeute ergaben, wurden für weitere Untersuchungen ausgewählt.

Die DNA-Region, die das scFV ME1 Antikörpergen lieferte, wurde sequenziert und wird in 2a gezeigt. Der von dieser Sequenz kodierte scFv wurde als ME1 (für mutiertes Epitop) bezeichnet. E. coli HB2151, ein nicht-Suppressorstamm, wurde mit dem isolierten, rekombinanten Phagen infiziert und lösliches scFv-Protein wurde in der perisplasmatischen Fraktion durch Western Blot mit einem für das C-terminate Epitop (E) Tag des scFv spezifischen Antikörper detektiert. (3).

2. Intrazelluläre Expression des ME1 scFv Gen im Zytoplasma von Säugetierzellen

p53-Protein und seine mutierten Formen werden vorwiegend im Zellzytoplasma exprimiert. Um die Bindungsaktivität des ME1 scFv-Antikörper in vivo zu überprüfen, wurde ein zytosolischer Modus der ME1 scFv Expression entwickelt. Mehrere Modifikationen wurden in der scFv Konstruktion für die Expression des scFv ME1 Gens durchgeführt. Die für bakterielle Sekretion benötigte Leadersequenz wurde entfernt und ein Methionin ATG-Startcodon wurde durch PCR in die für ME1 scFv kodierende Sequenz eingeführt. Im Allgemeinen beginnt das Antikörper VH-Polypeptid mit einem Glutaminrest. Die direkte Nachbarschaft des großen Glutamin kann die posttranslationale Entfernung des ersten Methionins erfolgreich verhindern. Um mit dieser Situation umzugehen, wurde durch PCR ein Alanincodon als ein Spacer nach dem Startcodon hinzugefügt. 2b zeigt die Sequenz von scFv ME1, genmodifiziert für die eukaryotische Expression.

Nach mehreren Studiein wurde der Expressionsvektor pIRES-EGFP als Mittel für die intrazytosolische Abgabe des ME1 scFv in Säugetierzellen ausgewählt (4). Dieser Vektor benutzt den „major immediate early Promotor/Enhancer" des humanen Cytomegalovirus (CMV IE) um die Transkription von bicistronischer mRNA zu steuern. Ribosomen können in die bicistronische mRNA am 5'-Ende eintreten, um das Gen von Interesse zu translatieren und sie können an der internen ribosomalen Eintrittsstelle (IRES) eintreten, um das Gen für das verstärkte grün fluoreszierende Protein zu translatieren. pIRES-EGFP verwendet eine teilweise außer Funktion gesetzte IRES-Sequenz, die zu einer reduzierten Geschwindigkeit bei der Translationsinitüerung am EGFP-Startcodon in Bezug zu dem des klonierten Gens führt. Dies ermöglicht die Detektion von Zellen, in denen die mRNA und damit das Zielprotein in hohen Mengen produziert wird, um eine suboptimale Translationsgeschwindigkeit von EGFP zu kompensieren. Nach der Modifizierung wie oben beschrieben, wurde die ME1 scFv DNA-Sequenz in die multiple cloning site (MCS) von pIRES-EGFP eingefügt.

Ein transienter Expressions-Assay wurde durchgeführt, in dem mehrere Wirtszelllinien verwendet wurden: p53 Null Mausfibroblasten, die selben Zellen, die stabil mit dem mutierten p53-Gen transfiziert wurden und humane embryonale Nierenzelllinie 293. Mit der Hilfe des &bgr;-gal-Reportersystems wurde gefunden, dass das Lipofectamin-Transfektionsverfahren eine optimale Technik für den Gentransport in die Wirtszelllinien ist. Nach der Transfektion mit dem pIRES-EGFP-ME1 DNA-Konstrukt wurden leicht detektierbare Mengen von EGFP Fluoreszenz in 293-Zellen gefunden, was bedeutete, dass eine signifikante Transkription des ME1 scFv Gens (5) stattgefunden hatte.

Sequenzprotokoll


Anspruch[de]
Ein DNA-Molekül, das für einen einkettigen Antikörper kodiert, der mutiertes p53 mit einem Epitop, das die Aminosäurefrequenz FRHSVV, jedoch kein Wildtyp p53 umfasst, binden kann. Das DNA-Molekül gemäß Anspruch 1, mit mindestens 95%iger Sequenzidentität zu SEQ. ID: No. 1. Das DNA-Molekül gemäß Anspruch 2, mit mindestens 99%iger Sequenzidentität zu SEQ. ID: No. 1. Das DNA-Molekül gemäß Anspruch 1, das SEQ. ID NO: 1 umfasst. Das DNA-Molekül gemäß Anspruch 1, wobei ein oder mehr als ein Nukleotid eines DNA-Moleküls gemäß Anspruch 4 hinzugefügt, entfernt oder substituiert wurde(n). Das DNA-Molekül gemäß Anspruch 1, das SEQ. ID NO: 3 umfasst. Ein Vektor, der ein DNA-Molekül gemäß einem der Ansprüche 1–6 umfasst. Eine Wirtszelle, die den Vektor aus Anspruch 7 umfasst. Ein einkettiges Antikörpermolekül, das mutiertes p53 mit einem Epitop, das die Aminosäurefrequenz FRHSVV, aber kein Wildtyp p53 umfasst, binden kann. Das einkettige Antikörpermolekül gemäß Anspruch 9, das die Aminosäuresequenz, wie in SEQ.ID No:2 dargestellt, umfasst. Das einkettige Antikörpermolekül gemäß Anspruch 9, wobei eine oder mehr als eine Aminosäure eines Antikörpermoleküls gemäß Anspruch 9 hinzugefügt, entfernt oder substituiert wurde(n). Das einkettige Antikörper-Molekül gemäß Anspruch 11, wobei die Antigenbindungsstelle (CDR) des Moleküls modifiziert wurde. Das einkettige Antikörper-Molekül gemäß Anspruch 9, das die Aminosäuresequenz, wie in SEQ.ID No: 4 dargestellt, umfasst. Ein Polypeptid, das eine Aminosäuresequenz mit mindestens 95%iger Sequenzidentität zu SEQ. ID. No. 2 umfasst, wobei dieses Polypeptid mutiertes p53, das die Aminosäuresequenz FRHSVV aber kein Wildtyp p53 enthält, spezifisch erkennt. Das einkettige Antikörpermolekül gemäß Anspruch 14, das eine Aminosäuresequenz umfasst, die mindestens eine 99%ige Sequenzidentität zu SEQ. ID. No: 2 aufweist. Das Polypeptid gemäß Anspruch 15, das eine Aminosäuresequenz, die in SEQ.ID. No: 2 gezeigt wird, umfasst. Ein Polypeptid, das eine Aminosäuresequenz, die in SEQ.ID. No: 4 gezeigt wird, umfasst. Eine pharmazeutische Zusammensetzung, die ein DNA-Molekül gemäß einem der Ansprüche 1–6 und einen pharmazeutisch annehmbaren Arzneiträger umfasst. Eine pharmazeutische Zusammensetzung, die einen Vektor gemäß Anspruch 7 und einen pharmazeutisch annehmbaren Arzneiträger umfasst. Eine pharmazeutische Zusammensetzung, die ein einkettiges Antikörpermolekül gemäß einem der Ansprüche 9–13 und einen pharmazeutisch annehmbaren Arzneiträger umfasst. Verwendung eines DNA-Moleküls gemäß einem der Ansprüche 1–6 in der Herstellung einer pharmazeutischen Zusammensetzung für die Verwendung in einer Methode zur Behandlung eines Patienten, der an einer Krankheit leidet, deren Ätiologie mit einer Mutation im p53 Gen zusammenhängt. Verwendung eines Vektors gemäß Anspruch 7 in der Herstellung einer pharmazeutischen Zusammensetzung für die Verwendung in einer Methode zur Behandlung eines Patienten, der an einer Krankheit leidet, deren Ätiologie mit einer Mutation im p53 Gen zusammenhängt. Verwendung eines einkettigen Antikörpermoleküls gemäß einem der Ansprüche 9–13 in der Herstellung einer pharmazeutischen Zusammensetzung für die Verwendung in einer Methode zur Behandlung eines Patienten, der an einer Krankheit leidet, deren Ätiologie mit einer Mutation im p53 Gen zusammenhängt. Die Verwendung gemäß einem der Ansprüche 21–23, wobei es sich bei dieser Krankheit um Krebs handelt. Ein immundiagnostisches Kit für den Nachweis des Vorhandenseins von mutiertem p53 mit einem Epitop, das die Aminosäurefrequenz FRHSVV, jedoch kein Wildtyp p53 umfasst, in einer Probe, wobei das Kit ein einkettiges Antikörpermolekül gemäß einem der Ansprüche 9–13 umfasst.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com