PatentDe  


Dokumentenidentifikation DE60125797T2 06.12.2007
EP-Veröffentlichungsnummer 0001326636
Titel IMPFSTOFFZUSAMMESETZUNG
Anmelder Sanofi Pasteur, Lyon, FR
Erfinder HAENSLER, Jean, F-69290 Saint Genis les Ollières, FR;
HURPIN, Marcel, Christian, F-69280 St Didier au Mont d'Or, FR
Vertreter PFENNING MEINIG & PARTNER GbR, 80339 München
DE-Aktenzeichen 60125797
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE, TR
Sprache des Dokument FR
EP-Anmeldetag 08.10.2001
EP-Aktenzeichen 019763804
WO-Anmeldetag 08.10.2001
PCT-Aktenzeichen PCT/FR01/03098
WO-Veröffentlichungsnummer 2002028428
WO-Veröffentlichungsdatum 11.04.2002
EP-Offenlegungsdatum 16.07.2003
EP date of grant 03.01.2007
Veröffentlichungstag im Patentblatt 06.12.2007
IPC-Hauptklasse A61K 39/21(2006.01)A, F, I, 20051017, B, H, EP

Beschreibung[de]

Die Erfindung betrifft das Gebiet der Impfstoffzusammensetzungen. Insbesondere betrifft die Erfindung eine adjuvierte Impfstoffzusammensetzung.

Aus der bisherigen Technik sind zahlreiche Adjuvantien bekannt, die zur Verwendung auf dem Gebiet von Impfstoffen geeignet sind, um die bei ihrer Verabreichung ausgelöste Immunantwort zu verbessern. So beschreibt beispielsweise die Patentanmeldung WO96/14831 die Verwendung von Adjuvantien, die aus amphipathischen Verbindungen bestehen, die eine lipophile Gruppe einschließen, die sich von einem Sterin ableitet, das an eine kationische Gruppe gebunden ist, wie 3&bgr;-[N-(N',N'-Dimethylaminoethan)-carbamoyl]cholesterin, auch DC-Chol genannt.

So beschreibt die Patentanmeldung WO98/18810 Nucleotide, deren Nucleotidsequenz bestimmte Grundeinheiten aufweist (ein CG-Dinucleotid, das von Adenin, Guanin oder Thymin auf der einen Seite und von Cytosin und Thymin auf der anderen Seite eingerahmt ist), zu ihrer Verwendung als Immunstimulantien, insbesondere bei der Verabreichung von Impfstoffen.

Diese Anmeldungen sind nur Beispiel aus der umfangreichen Literatur bezüglich dieses Themas. Obwohl zahlreiche Substanzen in der bisherigen Technik bereits hinsichtlich ihrer Impfstoff-adjuvierenden Eigenschaften beschrieben wurden, wird immer noch danach gestrebt, die Qualität und Wirksamkeit von Impfstoffen zu verbessern, insbesondere durch die Verwendung von neuen Adjuvantien, durch die sich entweder die Menge von in dem Impfstoff vorhandenen Antigenen, um eine zufrieden stellende Immunantwort zu erhalten, verringern lässt oder die Immunantwort in eine gewünschte Richtung, abhängig beispielsweise von der betroffenen Krankheit, des gewählten Verabreichungsweges oder der gesuchten Wirkung (Prävention oder Behandlung), lenken lässt.

Eine der Schwierigkeiten hängt damit zusammen, dass es auch, wenn die Antworten des Immunsystems zunehmend besser bekannt sind, sehr schwer, ja unmöglich bleibt, sie vorauszusehen und dass die Kombination von zwei Adjuvantien sehr oft zu einem enttäuschenden Ergebnis führt, entweder weil die Toxizität nun zu hoch ist oder weil jedes der Adjuvantien, für sich allein aktiv, eine inhibitorische oder neutralisierende Wirkung auf das ihm beigefügte Adjuvants zu haben scheint.

Das Ziel der vorliegenden Erfindung besteht demnach darin, eine neue Impfstoffzusammensetzung vorzuschlagen, deren Immunogenizität bezüglich der bisherigen Technik verbessert ist, d.h. dass die in Folge ihrer Verabreichung ausgelöste Immunantwort bezüglich der bisherigen Technik erhöht ist.

Zum Erreichen dieses Ziels besteht der Gegenstand der Erfindung in der Verwendung einer Zusammensetzung, die mindestens ein Antigen, ein kationisches Lipid und ein Oligonucleotid einschließt, zur Herstellung eines Impfstoffs, der über die Schleimhaut verabreicht werden muss.

Nach einem Merkmal der Erfindung ist das kationische Lipid DC-Chol.

Nach einem besonderen Merkmal der Erfindung ist das Antigen ein Antigen des HIV-Virus.

Die vorliegende Erfindung wird beim Lesen der ausführlichen folgenden Beschreibung besser verstanden.

Unter Impfstoffzusammensetzung im Sinne der vorliegenden Erfindung wird eine Zusammensetzung verstanden, die dazu geeignet ist, an Mensch oder Tier verabreicht zu werden, um eine Antwort des Immunsystems auszulösen, wobei diese Antwort des Immunsystems sich in einer Produktion von Antikörpern oder einfach in einer Aktivierung von bestimmten Zellen, insbesondere von Antigen-präsentierenden Zellen, T-Lymphocyten und B-Lymphocyten, fortsetzen kann. Die Impfstoffzusammensetzung kann eine Zusammensetzung zur Prophylaxe oder zur Therapie oder für beides sein.

Die Impfstoffzusammensetzung wird über die Schleimhaut verabreicht und gestattet im Falle von Mikroorganismen mit einer Eintrittspforte über die Schleimhaut die Auslösung einer mukosale Immunantwort unter Produktion von speziellen Immunglobulinen A.

Demnach kann es interessant sein, diesen Antworttyp bei der Impfung gegen die Viren mit respiratorischer Eintrittspforte (respiratorisches Synzytial-Virus, Grippevirus, Parainfluenzavirus, etc....), mit digestiver Eintrittpforte (Poliovirus, Rotavirus, ...) oder auch mit vaginaler oder rektaler Eintrittspforte (HIV, Hepatitis B, ...) zu untersuchen.

Auf die gleiche Weise wird eine Immunantwort vom mukosalen Typ bei bakteriellen Affektionen untersucht, die durch Chlamydien, Neisseria gonorrheae, Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis hervorgerufen werden.

Im Gegensatz dazu ist in anderen Fällen statt dessen die Auslösung einer Antwort vom Typ TH1 unter Produktion von cytotoxischen Zellen erwünscht; dies ist insbesondere für die nicht cytopatischen Viren, wie Cytomegalovirus, die intrazellulären Mikroorganismen (Kochbazillus, Parasiten, wie Falciparum oder Leishmania, Bakterien, wie Listeria, Legionella, Yersinia enterolitica) oder andere Spirochäten, der Fall.

In bestimmten Fällen kann es auch erwünscht sein, mehrere Antworttypen auszulösen; dies ist insbesondere für Grippe oder Sida der Fall. In solchen Fällen ist die erfindungsgemäße Zusammensetzung von ganz besonderem Interesse, denn durch sie lassen sich nun verschiedene Antworttypen des Immunsystems erhalten.

Unter Antigen im Sinne der vorliegenden Erfindung wird jedes Antigen verstanden, das dazu geeignet ist, in einem Impfstoff verwendet zu werden, gleich ob es sich um ganze Keime oder um eine Untereinheit handelt und gleich welcher Natur: Peptid, Protein, Glycoprotein, Polysaccharid, Glycolipid, Lipopeptid ...., etc. Es kann sich um Virusantigene, Bakterien oder andere handeln, der Begriff Antigen umfasst auch die Polynucleotide, deren Sequenz gewählt ist, um die Antigene zu kodieren, deren Expression durch Individuen, denen die Polynucleotide verabreicht werden, bei der DNA-Immunisierung genannten Immunisierungstechnik zu sehen gewünscht ist. Es kann sich auch um eine Gesamtheit von Antigenen handeln, insbesondere im Falle einer mehrwertigen Impfstoffzusammensetzung, die Antigene umfasst, die zum Schutz gegen mehrere Krankheiten geeignet sind, oder im Falle einer Zusammensetzung, die mehrere verschiedene Antigene umfasst, um gegen eine einzige Krankheit zu schützen, wie es beispielsweise für bestimmte Impfstoffe gegen Keuchhusten oder Grippe der Fall ist.

Unter kationischem Lipid im Sinne der vorliegenden Erfindung wird eine Verbindung verstanden, die aus einem Fettteil (beispielsweise ein oder mehrere hydrophobe Ketten oder ein Sterinkern) und einem polaren Kopf, der bei physiologischem pH positiv geladen ist, gebildet ist. Insbesondere kann es sich um eine Verbindung, die eine lipophile Gruppierung einschließt, die sich von einem Sterin ableitet, das an eine kationische Gruppe gebunden ist, und insbesondere um ein Cholesterinderivat, das über eine Carbamoylbindung mit einem quaternären Ammonium oder mit einem protonierbaren Amin verknüpft ist, handeln. In der Tat weist eine solche Bindung den Vorteil auf, in der Zelle hydrolysierbar zu sein. Solche Verbindungen können sich in basischer Form, Salzform oder, dies ist am häufigsten der Fall, auch gleichzeitig in 2 Formen im Gleichgewicht in einem Gemisch befinden, wobei die Verschiebung des Gleichgewichts zu der einen oder der anderen Form von der Zusammensetzung des Gemisches und insbesondere von seinem pH-Wert abhängt. Eines der kationischen Lipide, die für die Ziele der Erfindung besonders interessant sind, ist das DC-Chol, das aus Cholesterinchlorformiat und N,N-Dimethylethylendiamin nach dem in der U.S.-Patentschrift 5283185 beschriebenen Verfahren oder bevorzugt nach einem Verfahren, das in Beispiel 8 der Patentanmeldung WO 96/40067 beschrieben ist, erhalten wird. Es ist auch möglich, ein Produkt zu verwenden, das durch die Umsetzung von Cholesterylchlorformiat und N,N,N-Trimethylethylendiamin erhalten wird.

Unter Oligonucleotid im Sinne der vorliegenden Erfindung wird ein einzelsträngiges Oligonucleotid mit 6 bis 100 Nucleotiden, vorzugsweise 6 bis 30 Nucleotiden verstanden. Es kann sich um Oligoribonucleotid oder Oligodesoxyribonucleotid handeln. Insbesondere werden Oligonucleotide verwendet, die mindestens eine Cytosin-Guanindin-Dinucleotidsequenz einschließen, wobei weder das Cytosin noch das Guanin methyliert sind. Jedes andere Nucleotid, von dem bekannt ist, dass es aufgrund seiner eigenen Natur immunstimulierend ist, kann ebenso für die Zwecke der Erfindung geeignet sein. Besonders gute Ergebnisse wurden unter Verwendung eines Oligonucleotids erhalten, dessen Sequenz in der Patentanmeldung WO96/02555 unter SEQ-ID NO: 15 beschrieben ist, das nachstehend aufgeführt ist: 5'GAGAACGCTCGACCTTCGAT3'.

Die für die Ziele der Erfindung geeigneten Oligonucleotide können, um sie, insbesondere hinsichtlich Stabilität, zu verbessern, in Phosphodiester-Form oder in jeder anderen untersuchten Form vorliegen, so ist es möglich, Oligonucleotide zu verwenden, die in Form von Phosphorothioaten oder Phosphodiester/Phosphorothioat-Hybriden vorliegen. Obwohl es möglich ist, Oligonucleotide zu verwenden, die existierenden Nucleinsäurequellen entstammen, wie genomische DNA oder cDNA, ist die Verwendung von synthetischen Oligonucleotiden bevorzugt. Somit ist es möglich, Oligonucelotide auf einem festen Träger unter Anwendung des &bgr;-Cyanoethylphosphoramiditverfahrens (Beaucage, S.L. and Caruthers, M.H. Tetrahedron Letters 22, 1859–1862 (1981)) für den 3'-5'-Zusammenbau zu entwickeln.

Bei den phosphorothioatierten Oligonucleotiden ist eines der Sauerstoffatome, das die Phosphatgruppe aufbaut, durch ein Schwefelatom ersetzt. Ihre Synthese kann wie bereits beschrieben durchgeführt werden, mit der Ausnahme, dass die Iod/Wasser/Pyridin-Tetrahydrofuran-Lösung, die im Oxidationsschritt verwendet wird, der für die Synthese der Phosphodiesterverknüpfungen notwendig ist, durch eine TETD (Tetraethylthiuramdisulfid)-Lösung ersetzt wird, die die Sulfationen einbringt, durch die sich die Phosphorothioatgruppe herstellen lässt.

Weitere Modifikationen der Phosphodiesterbindungen, der Basen oder der Zucker können ebenfalls betrachtet werden, um die Eigenschaften der verwendeten Oligonucleotide zu modifizieren und insbesondere um ihre Stabilität zu vergrößern.

Unter Immunantwort vom Typ TH1 im Sinne der vorliegenden Erfindung wird eine Immunantwort verstanden, die insofern auf das charakterisierte Antigen spezifisch ist als sie eine zielgerichtete Produktion von Cytokinen, hauptsächlich &ggr;-Interferon und IL2, und eine massive Produktion von bestimmten Antikörper-Unterklassen (d.h. IgG2a bei der Maus) auslöst.

Es kann auch eine Produktion von cytotoxischen T-Zellen festgestellt werden.

Unter Immunantwort vom Typ TH2 wird eine Immunantwort verstanden, die sich in einer überwiegenden Produktion von IL4 und IL5 sowie in einer massiven Produktion von bestimmten anderen Antikörper-Unterklassen (d.h. IgG1 bei der Maus) fortsetzt.

Will man den Typ von Immunantwort untersuchen, der von einer Impfstoffzusammensetzung ausgelöst wird, so können Vergleichsdosen von IgG1 und IgG2a, die spezifisch bei der Verabreichung der an Mäusen untersuchten Impfstoffzusammensetzung produziert wurden, ermittelt werden; eine Antwort vom Typ TH1 kommt in einer stärkeren spezifischen IgG2a-Produktion zu Ausdruck, die zu einem geringen Wert des IgG1/IgG2a-Verhältnisses führt, obgleich eine Antwort vom Typ TH2 in einer stärkeren spezifischen IgG1-Produktion zum Ausdruck kommt, die zu einem hohen Wert des IgG1/IgG2-Verhältnisses führt.

Alternativ gestattet es die Dosis der produzierten Cytokinen auch, bei Tests in vitro oder an Tieren, die Zielorientierung der Immunantwort abzuschätzen; insbesondere kann das Verhältnis IL5/INF&ggr; ermittelt werden; eine Reaktion vom Typ TH1 kommt in einem geringen Wert dieses Verhältnisses zum Ausdruck, obgleich eine Antwort vom Typ TH2 stattdessen in einem erhöhten Wert dieses Verhältnisses zum Ausdruck kommt.

Es ist ebenfalls möglich, die Menge an IgA zu beobachten, deren Produktion in einer Zielorientierung der Immunantwort in Richtung des Typs TH2 zum Ausdruck kommt.

Oder es kann erwünscht sein, die Immunantwort gemäß den Impf-Zielen, d.h. die Krankheiten, gegen die die Impfstoffzusammensetzungen bestimmt sind, auszurichten.

Die folgenden Beispiele erläutern die Ausführungsformen der Erfindung nicht einschränkend.

Beispiel 1

Es wird DC-Cholchlorhydrat (erhalten gemäß der Herstellungsweise, die in Beispiel 8 der Patentanmeldung WO 96/40067 beschrieben ist) verwendet, das bei 20 mg/ml in einem TRIS-NaCl-Puffer (20 mM TRIS, 150 mM NaCl, pH 6,8) suspendiert wird. Nach 8 h unter Rühren bei 35–40°C unter Argon wurde die Suspension mit Hilfe eines Mikrofluidisierers M-110S von Microfluidics (10 Cyclen bei 500 kPa) mikrofluidisiert, um eine homogene DC-Chol-Suspension zu erzeugen, die über ein Millex-Filter, 0,45 &mgr;m, filtriert wurde.

Beispiel 2

Oligonucleotide wurden mit einem automatischen Synthesegerät von der Firma Applied Biosystems hergestellt, wobei das chemische Phosphoramidit-Standardverfahren eingesetzt wurde, das in jedem Cyclus einen Oxidationsschritt einschließt.

Dieser Oxidationsschritt wurde mit einer Lösung von Iod/Wasser/Tetrahydrofuran/Acetonitril, um eine Phosphodiesterverbindung zu erhalten, und mittels einer Tetraethylthiuram/Acetonitrillösung, um eine Phosphorothioatverbindung zu erhalten, durchgeführt. Ebenfalls hergestellt wurde ein Oligonucleotid 3 Db(S), dessen Sequenz in der Patentanmeldung WO96/02555 unter SEQ-ID NO: 15 wiedergegeben ist und das Phosphorothioatbindungen über seine ganze Länge einschließt.

Ebenfalls hergestellt wurde ein Oligonucleotid MGC(S), dessen Sequenz in der Patentanmeldung WO00/15256 unter SEQ ID NO: 2 wiedergegeben ist, das gleichzeitig Phosphodiesterbindungen und Phosphorothioatbindungen einschließt. Die Phosphorothioatbindungen liegen an jedem Ende; es existieren 2 Phosphorothioatbindungen an 3' und 5 Phosphorothioatbindungen an 5'. Dieses Oligonucleotid besitzt keine CG-Sequenz und wird als negative Kontrolle verwendet.

Beispiel 3

Impfstoffzusammensetzungen gegen das Humanimmundefizienzvirus vom Typ 1 (HIV-1) wurden hergestellt, wobei das Antigen das Hüllglycoprotein gp160 MN/LAI-2 ist. Dieses Antigen enthält den gp120-Teil des HIV-1-MN-Isolats den gp41-Teil des HIV-1-LAI-Isolats. gp41 wurde aus seiner Schnittstelle mit dem gp 120 und aus seinem Transmembranteil so deletiert, dass ein nicht gespaltenes und im Wesentlichen sezerniertes Glycoprotein erhalten wurde. Das Antigen wird aus der Hamsterzelllinie BHK-21 produziert, die mit dem rekombinanten Virus des Impfstoffs VVTG.9150 infiziert wurde, der sich von der früheren Konstruktion VVTG.1163 (Kieny, M.-P. et al., 1988, Protein Eng, 2(3): 219–255) ableitet, anschließend wird es durch Ionenaustauscherchromatographie, gefolgt von Immunaffinitätschromatographie gereinigt.

Die Impfdosen von 20 &mgr;l gehorchen einer der folgenden Formulierungen:

  • – 25 &mgr;g nur gp 160-Einheit,
  • – 25 &mgr;g gp160 + 50 &mgr;g Oligonucleotid 3Db(S), hergestellt in Beispiel 2,
  • – 25 &mgr;g gp160 + 50 &mgr;g Oligonucleotid MGC, hergestellt in Beispiel 2 + 200 &mgr;g DC-Chol, hergestellt in Beispiel 1,
  • – 25 &mgr;g gp160 + 50 &mgr;g Oligonucleotid 3Db(S), hergestellt in Beispiel 2 + 200 &mgr;g DC-Chol, hergestellt in Beispiel 1.

Die hergestellten Impfstoffdosen wurden 4 Gruppen von 6 Mäusen (1 Formulierung pro Gruppe) rektal unter Anästhesie in einem Verhältnis von 4 separaten Injektionen alle 2 Wochen (d.h. J1, J15, J29 und J44) injiziert.

Bei J57 wurde Serum abgenommen, Kot wurde gesammelt, und es wurden Rektalspülungen durchgeführt, um die folgenden Dosen zu ermitteln:

  • – Dosis von IgG-Anti-gp160 im Serum durch ELISA,
  • – Dosis von Gesamt-IgA und Gesamt-IgG sowie von spezifischem IgA- und spezifischem IgG-anti-gp106 in Rektalspülungen durch ELISA,
  • – Dosis von Gesamt-IgA und Gesamt-IgG sowie von spezifischem anti-gp160-IgA und anti-gp160-IgG im Kot durch ELISA.

Die Impfstoffzusammensetzung, die das MGC-Oligonucleotid enthält, wurde als negative Kontrolle bezüglich des Oligonucleotids 3Db(S) betrachtet. In der Tat erwies sich das MGC-Oligonucleotid in den vorherigen Experimenten als nicht immunstimulierend.

Die erhaltenen Ergebnisse sind in der nachstehenden Tabelle zusammengefasst, nur die Mittelwerte pro Mäusegruppen, die die gleiche Impfstoffzusammensetzung erhielten, sind angegeben.

Tabelle 1: Dosis von spezifischen IgG im Serum:

Diese Ergebnisse zeigen die von 2 Adjuvantien ausgeübte Synergie auf die Produktion von IgG gegenüber dem gp160-Antigen bei einer Verabreichung über die Schleimhaut.

Tabelle 2: IgA- und IgG-Dosis in Rektalspülungen:

Tabelle 3: Dosis an IgA und IgG im Kot:

Diese Ergebnisse zeigen die erfindungsgemäß erhaltene synergistische Wirkung gegenüber der lokalen Produktion von spezifischen Immunglobulinen G und Immunglobulinen A.

Dieses Vermögen zur lokalen Stimulierung der spezifischen IgA-Produktion ist besonders bei bestimmten Impfstoffanwendungen gesucht und bestätigt das Interesse am Gegenstand der vorliegenden Erfindung.


Anspruch[de]
Verwendung einer Zusammensetzung, die mindestens ein Antigen, ein kationisches Lipid und ein Oligonucleotid einschließt, zur Herstellung eines Impfstoffs, der über die Schleimhaut verabreicht werden muss. Verwendung nach dem vorhergehenden Anspruch, dadurch gekennzeichnet, dass das kationische Lipid DC-Chol ist. Verwendung nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass das Antigen ein Antigen des HIV-Virus ist.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com