PatentDe  


Dokumentenidentifikation DE69935507T2 06.12.2007
EP-Veröffentlichungsnummer 0001067956
Titel VERFAHREN UND PRODUKTE ZUR STIMULIERUNG DES IMMUNSYSTEMS MITTELS IMMUNOTHERAPEUTISCHER OLIGONUKLEOTIDE UND ZYTOKINE
Anmelder University of Iowa Research Foundation, Iowa City, Ia., US
Erfinder KRIEG, Arthur M., 540 EM RB Iowa City, IA 52242, US;
WEINER, George, Iowa City, IA 52242, US
Vertreter Bohmann & Loosen, 80335 München
DE-Aktenzeichen 69935507
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 02.04.1999
EP-Aktenzeichen 999163322
WO-Anmeldetag 02.04.1999
PCT-Aktenzeichen PCT/US99/07335
WO-Veröffentlichungsnummer 1999051259
WO-Veröffentlichungsdatum 14.10.1999
EP-Offenlegungsdatum 17.01.2001
EP date of grant 14.03.2007
Veröffentlichungstag im Patentblatt 06.12.2007
IPC-Hauptklasse A61K 38/19(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse A61K 31/70(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
Gebiet der Erfindung

Die vorliegende Erfindung betrifft synergistische Kombinationen von immunstimulatorischen CpG-Oligonukleotiden und immunpotenzierenden Cytokinen. Insbesondere betrifft die Erfindung Verfahren zum Stimulieren einer Immunantwort unter Verwendung der synergistischen Kombination von Verbindungen und von Produkten, die diese betreffen.

Hintergrund der Erfindung

Die Theorie der Immunüberwachung besagt, dass eine Hauptfunktion des Immunsystems darin besteht, neoplastische Zellen zu entdecken und zu eliminieren, bevor sich ein Tumor bildet. Ein grundlegendes Prinzip dieser Theorie besteht darin, dass sich Krebszellen hinsichtlich der Antigene von normalen Zellen unterscheiden und somit Immunantworten auslösen, die denjenigen ähneln, die die Abstoßung von immunologisch unverträglichen Homotransplantaten bewirken. Es wurde in Studien bestätigt, dass sich Tumorzellen entweder qualitativ oder quantitativ im Hinblick auf die Expression von Antigenen unterscheiden. Zum Beispiel sind „tumorspezifische Antigene" Antigene, die spezifisch mit Tumorzellen, aber nicht mit normalen Zellen verbunden sind. Virale Antigene in durch DNA- oder RNA-Viren induzierten Tumoren sind Beispiele für tumorspezifische Antigene. „Mit einem Tumor verbundene" Antigene liegen sowohl in Tumorzellen als auch in normalen Zellen vor, liegen in Tumorzellen aber in einer unterschiedlichen Menge oder einer unterschiedlichen Form vor. Beispiele für solche Antigene sind onkofötale Antigene (zum Beispiel karzinoembryonales Antigen), Differenzierungsantigene (zum Beispiel T- und Tn-Antigene) und Onkogenprodukte (zum Beispiel HER/neu).

Es wurden verschiedene Arten von Zellen identifiziert, die Tumorziele in vitro und in vivo abtöten können: natürliche Killerzellen (NK-Zellen), cytolytische T-Lymphozyten (CTLs), lymphokinaktivierte Killerzellen (LAKs) und aktivierte Makrophagen. NK-Zellen können Tumorzellen abtöten, ohne vorher hinsichtlich spezifischer Antigene sensibilisiert worden zu sein, und die Aktivität erfordert nicht die Anwesenheit von Antigenen der Klasse I auf Zielzellen, für die der Haupthistokompatibilitätskomplex (MHC) kodiert. Man nimmt an, dass NK-Zellen an der Kontrolle von entstehenden Tumoren und an der Kontrolle von metastatischem Wachstum mitwirken. Im Gegensatz zu NK-Zellen können CTLs Tumorzellen nur abtöten, nachdem sie im Hinblick auf Tumorantigene sensibilisiert worden sind, und wenn das Zielantigen auf den Tumorzellen exprimiert wird, die auch Klasse I-MHC exprimieren. Man nimmt an, dass CTLs bei der Abstoßung von transplantierten Tumoren und von durch DNA-Viren verursachten Tumoren Effektorzellen sind. LAK-Zellen sind eine Untermenge von Null-Lymphozyten, die von NK- und CTL-Populationen unterscheidbar ist. Aktivierte Makrophagen können Tumorzellen auf eine Weise abtöten, die weder antigenabhängig noch im Hinblick auf MHC begrenzt ist, wenn sie einmal aktiviert sind. Von aktivierten Makrophagen nimmt man an, dass sie die Wachstumsgeschwindigkeit von den Tumoren verringern, in die sie eindringen. Mit in vitro-Tests wurden andere Mechanismen des Immunsystems wie beispielsweise die antikörperabhängigen, zellvermittelten, cytotoxischen Reaktionen und die Lyse durch Antikörper zusammen mit Komplement identifiziert. Man nimmt jedoch an, dass diese Immunwirkungsmechanismen in vivo weniger wichtig sind als die Funktion von NK, CTLs, LAK und Makrophagen (siehe Überblick von Piessens, W.F., und David, J., „Tumor Immunology", In: Scientific American Medicine, Bd. 2, Scientific American Books, N.Y., S. 1-13, 1996).

Eines der komplexesten Phänomene in der Krebsimmunologie betrifft das Versagen des Immunsystems, Tumore zu eliminieren. In den 1970er Jahren sprach Hewitt die Vorstellung aus, dass die meisten Tumore keine tumorspezifischen Antigene oder Neoantigene exprimieren und somit nicht durch das Immunsystem als „fremd" erkannt werden können. Tatsächlich wurde von praktisch keinem Antigen auf der Oberfläche von Tumorzellen, das durch Antikörper erkannt wird, festgestellt, dass es tumorspezifisch wäre, und man hielt die meisten spontanen murinen Tumore weiterhin für „schwach immunogen", was derart definiert ist, dass ihre Eliminierung mißlingt, wenn sie in erbgleiche Wirte überführt werden (Hewitt, et al., Br. J. Cancer, 33:241-259, 1976). Diese gleichen Tumore konnten jedoch durch Mutagenese „immunogen" gemacht werden (Van Pel and Boon, Proc. Natl. Acad. Sci. USA, 79:4718-4722, 1982), wenn neue Antigene auf der Oberfläche der Tumorzellen exprimiert wurden. Es ist möglich, dass es dem Immunsystem nicht deshalb mißlingt, Tumore zu eliminieren, weil Neoantigene fehlen, sondern vielmehr, weil die in vivo Antwort auf Antigene ungeeignet ist. Deshalb würde ein Verfahren zum Erhöhen der Immunogenität von Tumorzellen dadurch, dass die Immunantwort des Wirtes auf die Tumorzellen potenziert wird, einen wesentlichen Fortschritt bei der Immuntherapie bereitstellen.

Das Ziel einer Immuntherapie ist es, die Immunantwort eines Patienten auf einen etablierten Tumor zu verstärken. Ein Verfahren bei einer Immuntherapie umfasst die Verwendung von Adjuvanzien. Als Adjuvans wirkende Substanzen, die aus Mikroorganismen wie beispielsweise Bacillus Calmette-Guerin stammen, steigern die Immunantwort und erhöhen bei Tieren den Widerstand gegen Tumore. Obwohl das Bacillus Calmette-Guerin in zahlreichen klinischen Versuchen untersucht worden ist, waren die Ergebnisse uneindeutig, und der Wert von dieser Art von Therapie mit einem bakteriellen Adjuvans bleibt unklar (Piessens and David, 1996, oben).

Von einer Reihe bakterieller Produkte wie beispielsweise Lipopolysacchariden ist bekannt, dass sie die Immunantworten von Säugetieren stimulieren. Kürzlich wurde berichtet, dass bakterielle DNA selbst ein solches Molekül ist (z. B. Krieg, A.M., et al., 1995, Nature 374:546-9). Einer der Hauptunterschiede zwischen bakterieller DNA, die starke immunstimulatorische Wirkungen aufweist, und von Wirbeltier-DNA, die diese Wirkung nicht aufweist, besteht darin, dass bakterielle DNA eine höhere Häufigkeit von unmethylierten CpG-Dinukleotiden als Wirbeltier-DNA aufweist. Von ausgewählten synthetischen Oligodesoxynukleotiden (ODN), die unmethylierte CpG-Motive (CpG-ODN) enthalten, wurde gezeigt, dass sie immunologische Wirkungen aufweisen und die Aktivierung von B-Zellen, NK-Zellen und antigenpräsentierenden Zellen (APCs) wie beispielsweise Monozyten und Makrophagen induzieren (Krieg, A.M., et al., oben). Sie können auch die Produktion von Cytokinen erhöhen, von denen man weiß, dass sie an der Entwicklung einer aktiven Immunantwort mitwirken, einschließlich des Tumornekrosefaktors-&agr;, IL-12 und IL-6 (z. B. Klinman D.M., et al., Proc. Natl. Acad. Sci. USA, 93:2879-83, 1996).

Hinsichtlich der Bindung von DNA an Zellen wurde gezeigt, dass sie einer Liganden-Rezeptor-Wechselwirkung ähnlich ist: die Bindung ist saturierbar, kompetitiv und führt zur DNA-Endozytose und zum Abbau der DNA zu Oligonukleotiden (Benne, R.M., et al., J. Clin. Invest. 76:2182, 1995). Wie DNA sind Oligodesoxyribonukleotide in der Lage, in Zellen im Rahmen eines Vorganges einzutreten, der sequenz-, temperatur- und energieunabhängig ist (Jaroszewski and Cohen, Ad. Drug. Del. Rev. 6:235, 1991). Von der Aufnahme von Oligodesoxyribonukleotiden durch Lymphozyten wurde gezeigt, dass sie durch die Zellaktivierung reguliert ist (Krieg, A.M., et al., Antisense Research and Development 1:161, 1991).

Von GM-CSF ist bekannt, dass es die Zellproliferation unter Grund- und Stress-Bedingungen regelt, und es ist von ihm bekannt, dass es die tumorzerstörende Aktivität von Makrophagen aktiviert. Einige Studien zeigen an, dass die gleichzeitige Behandlung mit GM-CSF und mit einer standardmäßigen Induktionschemotherapie die Wirksamkeit einer Chemotherapie erhöhen kann (Estey, E.H., Blood 83:2015, 1994). Es wurde postuliert, dass der Hauptnutzen von koloniestimulierenden Faktoren wie beispielsweise GM-CSF in ihrer Verwendung bei der Behandlung von Pancytopenie, einer der Komplikationen bei einer Chemotherapie, besteht (Piessens and David, 1996, oben).

Zusammenfassung der Erfindung

Die vorliegende Erfindung betrifft Produkte zum Induzieren einer synergistischen Immunantwort unter Verwendung von einer Kombination von einem CpG-Oligonukleotid und einem Cytokin. In einem Aspekt dient die Erfindung dem Stimulieren einer Immunantwort bei einem Patienten. Das Produkt zur Verwendung bei der Therapie oder Prophylaxe umfasst ein immunpotenzierendes Cytokin und ein immunstimulatorisches CpG-Oligonukleotid, das eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, wobei C und G unmethyliert sind, und wobei X1 und X2 Nukleotide sind.

Das Cytokin kann zum Beispiel GM-CSF, IL-3, IL-5, IL-12 oder Interferon-&ggr; sein. Das immunpotenzierende Cytokin kann auch ein Antigen-Cytokin-Fusionsprotein sein. In einer bevorzugten Ausführungsform ist das Antigen-Cytokin-Fusionsprotein ein Antigen-GM-CSF-Fusionsprotein. Andere Ausführungsformen des Produktes sind wie in den abhängigen Ansprüchen 3 bis 12 definiert.

Das Antigen kann jede Art von Antigen sein, das auf dem Gebiet bekannt ist. In einer Ausführungsform ist das Antigen aus der Gruppe ausgewählt, die ein Tumorantigen, ein mikrobielles Antigen und ein Allergen umfasst. Das Antigen ist bevorzugterweise ein Tumorantigen. In dieser Ausführungsform kann der Patient eine neoplastische Störung aufweisen. In anderen Ausführungsformen ist das Antigen ein virales Antigen, und der Patient leidet unter einer Virusinfektion oder trägt ein Risiko, an einer solchen zu erkranken.

In einigen Ausführungsformen wird das Antigen an den Patienten zusammen mit dem immunstimulatorischen CpG-Oligonukleotid und dem immunpotenzierenden Cytokin verabreicht. In anderen Ausführungsformen wird der Patient gegenüber dem Antigen passiv exponiert.

In anderen Aspekten ist die Erfindung eine Zusammensetzung einer zum synergistischen Aktivieren einer dendritischen Zelle wirksamen Menge von einem immunstimulatorischen CpG-Oligonukleotid, das eine Sequenz aufweist, das mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, wobei C und G unmethyliert sind und wobei X1 und X2 Nukleotide sind, und von einem Cytokin, das aus der Gruppe gewählt ist, die aus GM-CSF, IL-4, TNF&agr;, Flt3-Ligand und IL-3 besteht. Das Cytokin ist bevorzugterweise GM-CSF.

Die Zusammensetzung kann auch ein Antigen umfassen. In einigen Ausführungsformen ist das Antigen aus der Gruppe ausgewählt, die aus einem Krebsantigen, einem mikrobiellen Antigen und einem Allergen besteht.

Gemäß einem weiteren Aspekt der Erfindung wird ein in vitro Verfahren zum Aktivieren einer dendritischen Zelle bereitgestellt. Das Verfahren umfasst den Schritt des Kontaktierens einer dendritischen Zelle, die gegenüber einem Antigen exponiert ist, mit einer wirksamen Menge eines immunpotenzierenden Cytokins und eines immunstimulatorischen CpG-Oligonukleotids zum synergistischen Aktivieren einer dendritischen Zelle, wobei das CpG-Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, wobei C und G unmethyliert sind, und wobei X1 und X2 Nukleotide sind.

Das Cytokin kann zum Beispiel GM-CSF, IL-3, IL-5, IL-12 oder Interferon-&ggr; sein. Das immunpotenzierende Cytokin kann auch ein Antigen-Cytokin-Fusionsprotein sein. In einer bevorzugten Ausführungsform ist das Antigen-Cytokin-Fusionsprotein ein Antigen-GM-CSF-Fusionsprotein.

Das Antigen kann jede Art von Antigen sein, das auf dem Gebiet bekannt ist. In einer Ausführungsform ist das Antigen aus der Gruppe ausgewählt, die aus einem Tumorantigen, einem mikrobiellen Antigen und einem Allergen besteht. Das Antigen ist bevorzugterweise ein Tumorantigen. In dieser Ausführungsform kann der Patient eine neoplastische Störung aufweisen. In anderen Ausführungsformen ist das Antigen ein virales Antigen, und der Patient hat eine Virusinfektion oder trägt ein Risiko, an einer solchen zu erkranken.

Gemäß einem weiteren Aspekt stellt die Erfindung die Verwendung eines wie oben beschriebenen Produktes bei der Herstellung eines Arzneimittels zum Behandeln eines Patienten dar, der eine neoplastische Störung aufweist. Das Verfahren umfasst den Schritt des Verabreichens von einem immunpotenzierenden Cytokin und einem immunstimulatorischen CpG-Oligonukleotid, das eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, wobei C und G unmethyliert sind und wobei X1 und X2 Nukleotide sind, in einer Menge an den Tumor eines Patienten, der eine neoplastische Störung aufweist, die das synergistische Erhöhen der Überlebenszeit des Patienten im Vergleich zu einem Patienten bewirkt, an den das immunstimulatorische CpG-Oligonukleotid oder das immunpotenzierende Cytokin alleine verabreicht wurde.

Der Tumor ist bevorzugterweise aus der Gruppe ausgewählt, die aus einem Tumor des Hirnes, der Lunge, der Ovarien, der Brust, der Prostata, des Kolons, der Haut und des Blutes besteht. In einer Ausführungsform werden das immunstimulatorische CpG-Oligonukleotid und das immunpotenzierende Cytokin direkt in den Tumor injiziert.

Es wird auch ein Verfahren zur Empfängnisverhütung offenbart. Zu dem Verfahren gehört der Schritt des Verabreichens eines Antigens, eines immunpotenzierendes Cytokins und eines immunstimulatorischen CpG-Oligonukleotids an einen Patienten, wobei das CpG-Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, wobei C und G unmethyliert sind und wobei X1 und X2 Nukleotide sind, wobei das Antigen ein Antigen ist, das aus der Gruppe ausgewählt ist, die aus einem Antigen der Gonaden und einem Antigen aus einem Cytokin oder einem Hormon besteht, das zur Erhaltung einer Gonadenzelle benötigt wird.

Noch ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines wie oben beschriebenen Produktes zur Herstellung eines Arzneimittels zur Behandlung oder Prophylaxe einer infektiösen Erkrankung, bevorzugterweise einer Virusinfektion.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines wie oben beschriebenen Produktes zur Herstellung eines Arzneimittels zur Behandlung oder Prophylaxe einer allergischen Erkrankung.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines wie oben beschriebenen Produktes zur Herstellung eines Arzneimittels zur Behandlung oder Prophylaxe von Asthma.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines wie oben beschriebenen Produktes zur Herstellung eines Arzneimittels zum Induzieren einer synergistischen spezifischen Immunantwort auf ein Antigen.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines wie oben beschriebenen Produktes zur Herstellung eines Arzneimittels zum synergistischen Aktivieren einer dendritischen Zelle. Bei diesem Aspekt kann das Cytokin aus der Liste ausgewählt sein, die aus GM-CSF, IL-4, TNF&agr;, Flt3-Ligand und IL-3 besteht. In einigen Ausführungsformen wurde die dendritische Zelle gegenüber einem Antigen exponiert.

Ein noch weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines wie oben beschriebenen Produktes zur Herstellung eines Arzneimittels zur Verabreichung an einen Tumor in einem Patienten, der eine neoplastische Störung aufweist.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines wie oben beschriebenen Produktes zur Herstellung eines Arzneimittels zur Behandlung oder Prophylaxe von Individuen, die einem Antigen passiv ausgesetzt sind.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines wie oben beschriebenen Produktes zur Herstellung eines Arzneimittels zum Verabreichen zusammen mit einem Antigen.

Noch ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunstimulatorischen CpG-Oligonukleotides, das eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind, zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunpotenzierenden Cytokin, um eine Immunantwort bei einem Patienten zu stimulieren.

Ein alternativer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid, um eine Immunantwort bei einem Patienten zu stimulieren, wobei das Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind.

In einigen Ausführungsformen ist das Arzneimittel zur Verwendung zusammen mit einem Antigen bestimmt, um eine antigenspezifische Immunantwort bei dem Patienten zu stimulieren.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunstimulatorischen CpG-Oligonukleotides, das eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23', wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist, und X1 und X2 Nukleotide sind, zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunpotenzierenden Cytokin, um eine neoplastische Störung bei einem Patienten zu behandeln oder zu verhindern.

Ein alternativer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid, um eine neoplastische Störung bei einem Patienten zu behandeln oder zu verhindern, wobei das Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist, und X1 und X2 Nukleotide sind.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunstimulatorischen CpG-Oligonukleotides, das eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind, zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunpotenzierenden Cytokin, um eine infektiöse Erkrankung bei einem Patienten zu behandeln oder zu verhindern.

Ein alternativer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid, um eine infektiöse Erkrankung bei einem Patienten zu behandeln oder zu verhindern, wobei das Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunstimulatorischen CpG-Oligonukleotides, das eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind, zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunpotenzierenden Cytokin, um eine allergische Erkrankung bei einem Patient zu behandeln oder zu verhindern.

Ein alternativer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid, um eine allergische Erkrankung bei einem Patienten zu behandeln oder zu verhindern, wobei das Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunstimulatorischen CpG-Oligonukleotides, das eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind, zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunpotenzierenden Cytokin, um bei einem Patienten Asthma zu behandeln oder zu verhindern.

Ein alternativer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid, um Asthma bei einem Patienten zu behandeln oder zu verhindern, wobei das Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunstimulatorischen CpG-Oligonukleotides, das eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind, zur Herstellung eines Arzneimittels zur Verwendung zusammen mit einem immunpotenzierenden Cytokin, um einen Patienten zu behandeln, der eine Virusinfektion hat.

Ein alternativer Aspekt der vorliegenden Erfindung betrifft die Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Verwendung in Verbindung mit einem immunstimulatorischen CpG-Oligonukleotid, um einen Patienten zu behandeln, der eine Virusinfektion hat, wobei das Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind.

Andere Ausführungsformen sind wie in den abhängigen Ansprüchen 41 bis 56 definiert.

Bei einigen der oben beschriebenen Verwendungen liegt das Cytokin in der Form eines Antigen-Cytokin-Fusionsproteins vor. In einer bevorzugten Ausführungsform ist das Antigen-Cytokin-Fusionsprotein ein Antigen-GM-CSF-Fusionsprotein.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft ein Produkt, das ein immunstimulatorisches CpG-Oligonukleotid umfasst, das eine Sequenz aufweist, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, C unmethyliert ist und X1 und X2 Nukleotide sind, ein immunpotenzierendes Cytokin und ein Antigen zur gleichzeitigen, getrennten oder sequenziellen Verwendung bei einem kombinierten therapeutischen oder prophylaktischen Verfahren umfasst.

Jede der Beschränkungen der Erfindung kann verschiedene Ausführungsformen der Erfindung umfassen. Es wird daher erwartet, dass jede der Beschränkungen der Erfindung, zu der ein jedes Element oder alle Kombinationen von Elementen gehören, von jedem Aspekt der Erfindung umfasst sein kann.

Kurze Beschreibung der Figuren

1 ist eine Kurve, die die Produktion von anti-Id IgG nach Immunisierung unter Verwendung von einer Kombination von CpG-ODN und löslichem GM-CSF zeigt. Die Mäuse wurden mit 50 &mgr;g Id-KLH in der Form einer einzelnen subkutanen Dosis immunisiert, die in wässriger Lösung mit GM-CSF, CpG-ODN oder beiden vermischt war. Es wurde wöchentlich Blut abgenommen, und das Serum wurde durch ELISA auf das Vorhandensein von anti-Id IgG untersucht. Als ein Standard wurde normales Mausserum verwendet, das mit einer bekannten Konzentration von monoklonalem anti-Id supplementiert war. Jede Gruppe umfasste drei Mäuse.

2 ist eine Kurve, die zeigt, dass die Immunisierung unter Verwendung von Id/GM-CSF-Fusionsprotein und CpG-ODN die Produktion von antigenspezifischem IgG erhöht. Die Mäuse wurden mit 50 &mgr;g Id/GM-CSF in der Form von einer einzelnen subkutanen Dosis mit oder ohne CpG-ODN immunisiert. Es wurde wöchentlich Blut abgenommen, und das Serum wurde durch ELISA auf das Vorhandensein von anti-Id IgG untersucht. Als ein Standard wurde normales Mausserum verwendet, das mit einer bekannten Konzentration von monoklonalem anti-Id supplementiert war. Jede Gruppe umfasste drei Mäuse.

3 ist eine Kurve, die zeigt, dass die Immunisierung unter Verwendung von wiederholten Immunisierungen mit einer Kombination von Id/GM-CSF-Fusionsprotein und CpG-ODN hohe Konzentrationen von antigenspezifischem IgG induziert. Die Mäuse wurden in Woche 0 und noch einmal in Woche 2 mit 50 &mgr;g Id/GM-CSF in der Form von einer subkutanen Dosis mit oder ohne CpG-ODN immunisiert. Es wurde wöchentlich Blut abgenommen und das Serum wurde durch ELISA auf das Vorhandensein von anti-Id IgG untersucht. Als ein Standard wurde normales Mausserum verwendet, das mit einer bekannten Konzentration von monoklonalem anti-Id supplementiert war. Jede Gruppe umfasste drei Mäuse.

4 ist ein Balkendiagramm, das zeigt, dass CpG-ODN die Produktion von antigenspezifischem Antikörper des IgG2a-Isotyps erhöht. Die Mäuse wurden mit einer einzelnen Dosis unter Verwendung verschiedener Kombinationen von Id-KLH, GM-CSF, Id/GM-CSF-Fusionsprotein und CpG-ODN immunisiert. Vier Wochen nach einer einzelnen Immunisierung wurde Serum erhalten. Anti-Id IgG1 und IgG2a wurden durch ELISA bestimmt. Jede Gruppe umfasste drei Mäuse.

5 ist eine Überlebenskurve, die zeigt, dass CpG-ODN die schützende Wirkung des Id/GM-CSF-Schutzes vor Tumorwachstum erhöht. Die Mäuse wurden mit einer einzelnen Injektion Id/GM-CSF und/oder CpG-ODN immunisiert und drei Tage später einem Tumor ausgesetzt. Das Überleben wurde 100 Tage lang verfolgt. Alle Mäuse, die nach 51 Tagen lebendig waren, blieben über die gesamte Zeit der Beobachtung tumorfrei. Jede Gruppe umfasste 20 Mäuse.

6 ist ein Balkendiagramm, das die Expression von Klasse I-MHC, Klasse II-MHC, CD80 und CD86 nach der Gabe eines Pulses mit Id/GM-CSF und/oder CpG-ODN an aus dem Knochenmark stammende dendritische Zellen zeigt.

7 ist ein Balkendiagramm, das veranschaulicht, dass CpG-ODN die Produktion von IL-12 durch dendritische Zellen erhöht, die mit Id-KLH oder Id/GM-CSF gepulst waren. Aus dem Knochenmark stammende dendritische Zellen wurden mit Antigen mit oder ohne CpG-ODN 18 Stunden lang gepulst, und die Produktion von IL-12 und IL-6 wurde durch ELISA bestimmt. CpG-ODN erhöhte die Produktion von IL-12 durch dendritische Zellen deutlich, besonders bei denjenigen, die mit dem Id/GM-CSF-Fusionsprotein gepulst waren.

8 zeigt FACS-Abbildungen, die die Expression von ICAM-1- und MHC II durch dendritische Zellen als Antwort auf GM-CSF und CpG zeigen. Dendritische Vorläuferzellen wurden 48 Stunden lang in Gegenwart von GM-CSF (800 U/ml) und 2006 (CpG-Phosphothioat; 6 &mgr;g/ml) inkubiert. Die Expression von ICAM-1 (CD54) und MHC II wurde mittels Durchflusszytometrie (in jedem Beispiel sind 2500 lebende Zellen gezählt) abgeschätzt.

9 besteht aus mehreren Kurven, die die Induktion der Expression von co-stimulierenden Molekülen auf dendritischen Zellen durch CpG zeigen. Dendritische Vorläuferzellen wurden wie angegeben 48 Stunden lang in Gegenwart von GM-CSF (800 U/ml) und Oligonukleotiden (2006: CpG-Phosphothioate, 6 &mgr;g/ml) inkubiert. Die Expression von CD54 (ICAM-1) (Feld A), CD86 (B7-2) (Feld B) und CD40 (Feld C) wurde mittels Durchflusszytometrie (MFI, mittlere Fluoreszenzintensität) quantifiziert. Die Kombination von GM-CSF und 2006 zeigt beim Erhöhen der Expression von CD86 und CD40 eine Synergie, während die Wirkung auf CD54 additiv war. Die Ergebnisse stehen für das Mittel von fünf unabhängigen Experimenten (CD54 und CD86) und vier Experimenten (CD40). Die statistische Signifikanz der Erhöhung im Vergleich zu der Probe, die nur Zellen enthielt, wird durch * angezeigt (p < 0,05). Die statistische Untersuchung ist mit Hilfe des ungepaarten t-Tests durchgeführt, Fehlerbalken zeigen die SEM.

Detaillierte Beschreibung der Erfindung

Die Erfindung betrifft Verfahren und Produkte zum Stimulieren einer Immunantwort bei einem Patienten. Es wurde gemäß der Erfindung entdeckt, dass mit Kombinationen von immunpotenzierenden Verbindungen synergistische Antworten erreicht werden konnten. Diese synergistischen Wirkungen wurden in vitro, in vivo und ex vivo beobachtet. Eine synergistische Erhöhung der Überlebensrate wurde selbst bei Tieren beobachtet, die einen etablierten Tumor aufwiesen. Das Verfahren wird durch das Verabreichen einer zum Induzieren einer synergistischen antigenspezifischen Immunantwort wirksamen Menge eines immunpotenzierenden Cytokines und eines immunstimulatorischen CpG-Oligonukleotides an den Patienten durchgeführt, der gegenüber einem Antigen exponiert war.

Die Erkenntnis beruht auf der Entdeckung, dass die bewirkte Immunantwort synergistisch ist, wenn ein immunstimulatorisches CpG-Oligonukleotid in Kombination mit einem immunpotenzierenden Cytokin an einen Patienten verabreicht wird. Sowohl CpG-Oligonukleotide als auch immunpotenzierende Cytokine haben die Fähigkeit, eigenständig Immunantworten hervorzurufen, wenn sie an einen Patienten verabreicht werden. Wenn die Kombination der beiden jedoch zusammen verabreicht wird, verändert sich die Quantität und die Art der Immunantwort. Z. B. wird eine synergistische Induktion von Antigen-spezifischem IgG beobachtet, wie in 3 gezeigt, wenn das CpG-Oligonukleotid und das immunpotenzierende Cytokin zusammen mit einem Antigen unter Verwendung von wiederholten Immunisierungen verabreicht werden. Zusätzlich entwickelt sich eine Antikörperantwort, die sowohl IgG2a (das eine Th1-Immunantwort anzeigt) als auch IgG1 (das eine Th2-Immunantwort anzeigt) umfasst, wenn CpG und GM-CSF zusammen verabreicht werden, während IgG2a-Antikörper in Abhängigkeit von dem Stamm des Tieres nicht nachweisbar sind oder in geringer Konzentration vorliegen, wenn GM-CSF allein verabreicht wird.

Erstaunlicherweise hat die Kombination eines CpG-Oligonukleotides und eines immunpotenzierenden Cytokines eine dramatische Wirkung auf die Überlebensrate von Tieren, denen ein Tumor injiziert wurde, selbst dann, wenn sie mehrere Tage nach der Tumorinokulierung verabreicht wird. Diese Erkenntnis war bemerkenswert, weil sie zeigte, dass die Kombination der Wirkstoffe in der Lage war, einen etablierten Tumor zu eliminieren. Typische Immunisierungsstrategien des Standes der Technik werden im Allgemeinen vor der Inokulierung durchgeführt, um die Etablierung eines Tumors zu verhindern. Wenn den Mäusen ein Tumor injiziert wurde und für sie keine nachfolgende Tumorbehandlung bereitgestellt wurde, betrug die Überlebensrate 0 %. Mäuse, die mit CpG-Oligonukleotid alleine bzw. GM-CSF und Antigen behandelt wurden, zeigten Überlebensraten von 0 bzw. 30 %. Die Kombination von CpG-Oligonukleotid und GM-CSF rief eine dramatische Überlebensrate von 70 % hervor. Diese Erkenntnis hat für die Behandlung etablierter Tumore und für die Verhinderung der Entwicklung von Tumoren gleichermaßen wichtige Konsequenzen.

Das Produkt der Erfindung kann bei einem Verfahren zum Stimulieren einer Immunantwort bei einem Patienten verwendet werden. Das Verfahren wird durch das Verabreichen einer zum Induzieren einer synergistischen antigenspezifischen Immunantwort wirksamen Menge eines immunpotenzierenden Cytokins und eines immunstimulatorischen CpG-Oligonukleotides an den Patienten durchgeführt, der gegenüber einem Antigen exponiert war. Das immunstimulatorische CpG-Oligonukleotid weist eine Sequenz auf, die mindestens die folgende Formel umfasst: 5'X1CGX23' wobei das Oligonukleotid mindestens 8 Nukleotide umfasst, wobei C und G unmethyliert sind und wobei X1 und X2 Nukleotide sind.

Wie hierin verwendet, ist ein „Antigen" ein Molekül, das in der Lage ist, eine Immunantwort auszulösen. Antigene umfassen, sind aber nicht beschränkt auf Zellen, Zellextrakte, Polysaccharide, Polysaccharidkonjugate, Lipide, Glykolipide, Kohlenhydrate, Peptide, Proteine, Viren und virale Extrakte. Der Begriff Antigen umfasst im weiten Sinne jede Art von Molekül, das von einem Wirtsimmunsystem als fremd erkannt wird. Antigen umfassen, sind aber nicht beschränkt auf Krebsantigene, mikrobielle Antigene und Allergene.

Die Produkte der Erfindung sind durch das Stimulieren einer antigenspezifischen Immunantwort gegen ein Krebsantigen zum Behandeln von Krebs nützlich. Wie hierin verwendet, ist ein „Krebsantigen" eine Verbindung wie beispielsweise ein Peptid, die mit einem Tumor oder einer Krebszellenoberfläche verbunden ist, und die in der Lage ist, eine Immunantwort auszulösen, wenn sie auf der Oberfläche einer antigenpräsentierenden Zelle im Zusammenhang mit einem MHC-Molekül exprimiert wird. Krebsantigene können aus Krebszellen entweder durch das Herstellen unreiner Extrakte von Krebszellen, wie es z. B. in Cohen et al., 1994, Cancer Research, 54: 1055 beschrieben ist, durch teilweises Aufreinigen der Antigene, durch rekombinante Techniken oder durch die de novo-Synthese bekannter Antigene hergestellt werden. Krebsantigene umfassen Antigene, die die immunogenen Teile von einem ganzen Tumor oder Krebsgeschwür oder den ganzen Tumor oder das ganze Krebsgeschwür umfassen. Solche Antigene können isoliert werden oder rekombinant oder durch jedes andere auf dem Gebiet bekannte Mittel hergestellt werden. Krebsarten oder Tumore umfassen, sind aber nicht beschränkt auf Gallengangkarzinom, Hirnkarzinom, Brustkarzinom, Zervikalkarzinom, Choriokarzenom, Kolonkarzinom, Endometriumkarzinom, Ösophaguskarzinom, Magenkarzinom, intraepitheliale Neoplasmen, Lymphome, Leberkarzinom, Lungenkarzinom (z. B. kleinzelliges und nicht-kleinzelliges), Melanom, Neuroblastome, Oralkarzinom, Ovarialkarzinom, Pankreaskarzinom, Prostatakarzinom, Rektalkarzinom, Sarkome, Hautkarzinom, Hodenkarzinom, Schilddrüsenkarzinom oder Nierenkarzinom genauso wie andere Karzinome und Sarkome.

Tumore sind antigen und können für eine immunologische Zerstörung anfällig sein. Der Begriff „Tumor" ist normalerweise mit Neoplasma gleichgestellt, was wörtlich „neues Wachstum" bedeutet und synonym mit „Krebs" verwendet wird. Eine „neoplastische Störung" ist jede Störung, die mit Zellproliferierung, spezifisch mit einem Neoplasma, verbunden ist. Ein „Neoplasma" ist eine abnormale Gewebemasse, die nach Entfernung des karzinogenen Faktors, der ihr Erscheinen ausgelöst hat, bestehen bleibt und proliferiert. Es gibt zwei Arten von Neoplasmen, gutartige und bösartige. Nahezu alle gutartigen Tumore sind eingekapselt und nichtinvasiv; im Gegensatz dazu sind bösartige Tumore fast nie eingekapselt und dringen durch infiltrierendes, zerstörendes Wachstum in benachbartes Gewebe ein. Dieses infiltrative Wachstum kann von dem Einnisten von Tumorzellen an Stellen gefolgt sein, die mit dem ursprünglichen Tumor nicht zusammenhängen. Das Produkt der Erfindung kann verwendet werden, um neoplastische Störungen beim Menschen zu behandeln, die folgende umfassen, aber nicht beschränkt sind auf: Sarkom, Karzinom, Fibrom, Lymphom, Melanom, Neuroblastom, Retinoblastom und Gliom genauso wie alle anderen Tumore, die hierin beschrieben sind.

Das Produkt der Erfindung kann ebenfalls verwendet werden, um Krebs und Tumore bei nichtmenschlichen Patienten zu behandeln. Krebs ist eine der häufigsten Todesursachen bei Begleittieren (d. h. Katzen und Hunden). Krebs befällt gewöhnlicherweise ältere Tiere, die im Falle von Haustieren in die Familie integriert worden sind. Wahrscheinlich erliegen 45 % der Hunde, die älter als 10 Jahre sind, der Krankheit. Die üblichsten Behandlungsoptionen umfassen einen chirurgischen Eingriff, eine Chemotherapie und eine Strahlentherapie. Andere Behandlungsmodalitäten, die mit einem gewissem Erfolg verwendet worden sind, sind Lasertherapie, Cryotherapie, Hyperthermie und Immuntherapie. Die Wahl der Behandlung hängt von der Art des Krebses und dem Ausmaß der Dissemination ab. Wenn das bösartige Wachstum nicht auf einen abgetrennten Teil des Körpers begrenzt ist, ist es schwierig, nur bösartiges Gewebe zu entfernen, ohne auch normale Zellen in Mitleidenschaft zu ziehen.

Bösartige Störungen, die bei Hunden und Katzen üblicherweise diagnostiziert werden, umfassen, sind aber nicht beschränkt auf Lymphosarkom, Osteosarkom, Brusttumore, Mastozytom, Hirntumor, Melanom, adenosquamöses Karzinom, karzinoider Lungentumor, Bronchialdrüsentumor, bronchiales Adenokarzinom, Fibrom, Myxochondrom, Lungensarkom, Neurosarkom, Osteom, Papillom, Retinoblastom, Ewing-Sarkom, Wilms Tumor, Burkitt-Tumor, Mikrogliom, Neuroblastom, Osteoclastom, orale Neoplasie, Fibrosarkom, Osteosarkom und Rhabdomyosarkom. Andere Neoplasmen bei Hunden umfassen genitales Plattenzellkarzinom, übertragbarer veneraler Tumor, Hodentumor, Seminom, Sertoli-Zelltumor, Hemangiopericytom, Histiocytom, Chlorom (Granulozytensarkom), Hornhautpapillom, Hornhautplattenzellkarzinom, Hemangiosarkom, Pleuralmesotheliom, Basalzellentumor, Thymom, Magenkrebs, Nebennierendrüsenkarzinom, orale Papillomatose, Hemangioendotheliom und Cystadenom. Zusätzliche Bösartigkeiten, die bei Katzen diagnostiziert werden, umfassen Follikel-Lymphom, intestinales Lymphosarkom, Fibrosarkom und Lungenplattenzellkarzinom. Vom Frettchen, einem zunehmend beliebten Haustier, ist bekannt, dass es Insulinom, Lymphom, Sarkom, Neurom, Pankreasinselzellentumor, gastrisches MALT-Lymphom und gastrisches Adenokarzinom entwickelt.

Neoplasien, die landwirtschaftliches Nutzvieh in Mitleidenschaft ziehen, umfassen Leukämie, Hämangiopericytom und okulare Neoplasie von Rindern (bei Rindern); preputiales Fibrosarkom, ulceratives Plattenzellkarzinom, preputiales Karzinom, Bindegewebsneoplasie und Mastocytom (bei Pferden), hepatozelluläres Karzinom (bei Schweinen), Lymphom und pulmonare Adenomatose (bei Schafen), pulmonäres Sarkom, Lymphom, Rous-Sarkom, Reticulendotheliose, Fibrosarkom, Nephroblastom, B-Zell-Lymphom und lymphoide Leukose (bei Vogelarten), Retinoblastom, Leberneoplasie, Lymphosarkom (lymphoblastisches Lymphom), plasmazellenartige Leukämie und Schwimmblasensarkom (bei Fischen), käsige Lumphadenitis (CLA): die chronische, infektiöse, ansteckende Krankheit von Schafen und Ziegen, die durch das Bakterium Corynebacterium pseudotuberculosis verursacht wird, und ansteckender Lungentumor bei Schafen, der durch Jaagsiekte verursacht wird.

CpG-Oligonukleotide können beim Aktivieren von B-Zellen, NK-Zellen und antigenpräsentierenden Zellen wie beispielsweise Monozoyten und Makrophagen nützlich sein. Ein CpG-Oligonukleotid erhöht die antikörperabhängige zelluläre Zytotoxizität und kann zusammen mit Tumorantigen als Adjuvans verwendet werden, um vor einem Tumorbefall zu schützen (Wooldridge, J.E. et al., 1987, oben; Weiner, G.J. et al., Proc Natl Acad Sci USA 94:10833-10837, 1997). Diese Erfindung beruht auf der Erkenntnis, dass ein CpG-Oligonukleotid und ein immunpotenzierendes Cytokin synergistisch wirken, um eine Immunantwort gegen einen Tumor zu bewirken, so dass die Wirkung des CpG-Oligonukleotides und des immunpotenzierenden Agens größer als die Summe der einzelnen Wirkungen entweder von dem CpG-Oligonukleotid oder dem immunpotenzierenden Agens ist.

CpG-Oligonukleotide werden mit einem immunpotenzierenden Cytokin verwendet. „Immunpotenzierende Cytokine" sind diejenigen Moleküle und Verbindungen, die die humorale und/oder zelluläre Immunantwort stimulieren. Der Begriff „Cytokin" wird als generischer Name für eine vielfältige Gruppe von löslichen Proteinen und Peptiden verwendet, die bei nano- bis picomolaren Konzentrationen als humorale Regulatoren wirken und die die funktionalen Aktivitäten einzelner Zellen und Gewebe entweder unter normalen oder unter pathologischen Bedingungen modulieren. Diese Proteine vermitteln auch direkt Wechselwirkungen zwischen Zellen und regulieren Vorgänge, die in der extrazellulären Umgebung stattfinden. Beispiele für Cytokine umfassen, sind aber nicht beschränkt auf IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, Granulozyten-Makrophagen-Kolonie-stimulierenden Faktor (G-MCSF), Granulozytenkolonie-stimulierender Faktor (GCSF), Interferon-&ggr; (&ggr;-INF), Tumornekrosefaktor (TNF), TGF-&bgr;, FLT-3-Ligand und CD40-Ligand.

Der FLT3-Ligand umfasst eine Klasse von Verbindungen, die in EP 0 627 487 A2 und WO 94/28391 beschrieben sind. Die cDNA des menschlichen FLT3-Liganden wurden bei der American Tissue Type Culture Collection, Rockville, Maryland eingereicht, und ihr wurde die Zugangsnummer ATCC69382 zugeordnet. Interleukine (Ils) wurden auf dem Gebiet umfangreich beschreiben, z. B. Mosley et al., 1989, Cell 59: 335, Idzerda et al., 1990, J. Exp. Med. 171: 861. GM-CSF ist im Handel als Sargramostin, Leukin (Immunex) erhältlich.

Cytokine spielen beim Lenken der T-Zellenantwort eine Rolle. Helfer (CD4+)-T-Zellen orchestrieren die Immunantwort von Säugetieren durch die Produktion löslicher Faktoren, die auf andere Zellen des Immunsystems wirken, einschließlich anderer T-Zellen. Die meisten reifen CD4+-T-Helferzellen exprimieren eines von zwei Cytokinprofilen: Th1 oder Th2. Th1-Zellen exprimieren IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, GM-CSF und geringe Mengen von TNF-&agr;. Die TH1-Untermenge fördert Hyperempfindlichkeit vom verzögerten Typ, zellvermittelte Immunität und den Wechsel der Immunoglobulinklasse zu IgG2a. Die Th2-Untermenge induziert die humorale Immunität durch das Aktivieren von B-Zellen, das Fördern der Antikörperproduktion und das Induzieren des Klassenwechsels zu IgG1 und IgE.

Tumore können „tumorspezifische Antigene" exprimieren, die Antigene sind, die potentiell Immunantworten stimulieren können, die anscheinend tumorspezifische Immunantworten sind. Für Antigene können normale Gene kodieren, und diese gehören zu verschiedenen Kategorien: (1) normalerweise stille Gene, (2) Differenzierungsantigene, (3) embryonale und fötale Antigene, und (4) klonale Antigene, die nur auf einigen normalen Zellen exprimiert werden wie beispielsweise den Zellen, von denen der Tumor ausging. Für tumorspezifische Antigene können mutierte zelluläre Gene wie beispielsweise Onkogene (z. B. aktiviertes Ras-Onkogen), Suppressorgene (z. B. mutiertes p53) kodieren, wobei Fusionsproteine das Ergebnis interner Deletionen oder chromosomaler Translokationen sind. Für tumorspezifische Antigene können auch virale Gene, wie beispielsweise die von RNA- oder DNA-Tumorviren, kodieren.

Bei der Behandlung von Lymphom dient der Idiotyp des sekretierten Immunoglobulins als hochspezifisches, mit dem Tumor verbundenes Antigen. Mit „Idiotyp" ist die Gruppe der Determinanten der V-Region gemeint, die für einen spezifischen Antikörper oder eine begrenzte Reihe von Antikörpern spezifisch sind. In einer Ausführungsform ist das immunpotenzierende Cytokin ein Protein (ein Fusionsprotein), das aus einem spezifischen Antigenidiotyp besteht, der von einem Lymphom sekretiert wird, und an das immunpotenzierende Cytokin fusioniert ist. Verfahren zum Herstellen von Antigen-Cytokin-Fusionsproteinen sind auf dem Gebiet wohlbekannt (z. B. Tao, M.H., Levy, R., Nature 362: 755-758, 1993). In einer Ausführungsform ist das Fusionsprotein ein Antigen-GM-CSF-Fusionsprotein.

Die Produkte der Erfindung sind auch beim Behandeln infektiöser Erkrankungen nützlich. Eine infektiöse Erkrankung ist, wie hierin verwendet, eine Krankheit, die durch die Anwesenheit eines fremden Mirkoorganismus im Körper entsteht. CpG und immunpotenzierende Cytokine werden verwendet, um eine antigenspezifische Immunantwort zu stimulieren, die eine T- oder B-Zell-Antwort gegen ein Antigen des Mikroorganismus aktivieren kann. Die Verfahren werden unter Verwendung eines mikrobiellen Antigens auf die gleiche Weise durchgeführt, die oben unter Bezug auf den Tumor beschrieben ist, abgesehen davon, dass das Antigen spezifisch für einen Mikroorganismus ist. Ein „mikrobielles Antigen" ist, wie hierin verwendet, ein Antigen eines Mikroorganismus und umfasst, ist aber nicht beschränkt auf einen infektiösen Virus, infektiöse Bakterien und infektiöse Pilze. Solche Antigene umfassen den intakten Mikroorganismus genauso wie natürliche Isolate oder Fragmente oder Derivate davon und auch synthetische Verbindungen, die hinsichtlich der natürlichen Antigene des Mikroorganismus identisch oder ähnlich sind und eine für diesen Mikroorganismus spezifische Immunantwort induzieren. Eine Verbindung ist einem natürlichen Antigen eines Mikroorganismus ähnlich, wenn sie eine Immunantwort (humoral und/oder zellulär) auf das natürliche Antigen eines Mikroorganismus induziert. Solche Antigene werden auf dem Gebiet routinemäßig verwendet und sind Fachleuten auf dem Gebiet wohlbekannt.

Beispiele für infektiöse Viren, die in Menschen gefunden wurden, umfassen, sind aber nicht beschränkt auf Retroviridae (z. B. menschliche Immundefizienzviren, wie HIV-1 (auch bezeichnet als HTLV-III, LAV oder HTLV-III/LAV oder HIV-III; und andere Isolate, wie HIV-LP); Picornaviridae (z. B. Polioviren, Hepatitis A-Virus; Enteroviren, menschliche Coxsackie-Viren, Rhinoviren, Echoviren); Calciviridae (z. B. Stämme, die Gastroenteritis verursachen); Togaviridae (z. B. Pferdeenzephalitisviren, Rubellaviren); Flaviridae (z. B. Dengue-Viren, Enzephalitisviren, Gelbfieberviren); Coronoviridae (z. B. Coronaviren); Rhabdoviridae (z. B. vesikuläre Stomatitisviren, Tollwut-Viren); Coronaviridae (z. B. Coronaviren); Rhabdoviridae (z. B. vesikuläre Stomatitisviren, Tollwut-Viren); Filoviridae (z. B. Ebolaviren); Paramyxoviridae (z. B. Parainfluenzaviren, Mumpsvirus, Masernvirus, Atmungs-syncytial-Virus); Orthomyxoviridae (z. B. Grippeviren); Bungaviridae (z. B. Hantaan-Viren, Bungaviren, Phleboviren und Nairo-Viren); Arena viridae (hämorrhagische Fieberviren); Reoviridae (z. B. Reoviren, Orbiviren und Rotaviren); Birnaviridae; Hepadnaviridae (Hepatitis B-Virus); Parvoviridae (Parvoviren); Papovaviridae (Papillomaviren, Polyomaviren); Adenoviridae (die meisten Adenoviren); Herpesviridae (Herpes simplex-Virus (HSV) 1 und 2, Varizella Zoster-Virus, Cytomegalievirus (CMV), Herpesviren); Poxviridae (Variolaviren, Impfpockenviren, Pockenviren); und Iridoviridae (z. B. Afrikanischer Schweinefiebervirus); und unklassifizierte Viren (z. B. die ätiologischen Agenzien der spongiformen Enzephalopathien, das Agens der Delta-Hepatitis-Krankheiten (man glaubt, dass es sich um einen defekten Satellit des Hepatitis B-Virus handelt), die Agenzien der nicht-A-, nicht-B-Hepatitis (Klasse 1 = innerlich übertragen; Klasse 2 = parenteral übertragen (d. h. Hepatitis C); Norwalk- und verwandte Viren und Astroviren).

Sowohl Gram-negative als auch Gram-positive Bakterien können bei Wirbeltieren als Antigene dienen. Solche grampositiven Bakterien umfassen, sind aber nicht beschränkt auf Pasteurella-Arten, Staphylococcus-Arten und Streptococcus-Arten. Gram-negative Bakterien umfassen, sind aber nicht beschränkt auf Escherichia coli, Pseudomonas-Arten und Salmonella-Arten. Spezifische Beispiele infektiöser Bakterien umfassen, sind aber nicht beschränkt auf Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps. (z. B. M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Gruppe A-Streptokokken), Streptococcus agalactiae (Gruppe B-Streptokokken), Streptococcus (viridans-Gruppe), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobe sps.), Streptococcus pneumoniae, pathogene Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus antracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nukleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia und Actinomyces israelli.

Beispiele für infektiöse Pilze umfassen: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans. Andere infektiöse Organismen (d. h. Protisten) umfassen: Plasmodium-Arten wie beispielsweise Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale und Plasmodium vivax und Toxoplasma gondii.

Andere medizinisch relevante Mikroorganismen wurden umfangreich in der Literatur beschrieben, siehe zum Beispiel C.G.A Thomas, Medical Microbiology, Bailliere Tindall, Great Britein 1983.

Die Produkte der Erfindung sind auch zum Behandeln allergischer Erkrankungen nützlich. Die Verfahren werden auf die gleiche Weise durchgeführt wie oben hinsichtlich der Tumorimmuntherapie und der Behandlung infektiöser Erkrankungen beschrieben ist, abgesehen davon, dass das Antigen spezifisch für ein Allergen ist. Zurzeit werden allergische Erkrankungen im Allgemeinen durch die Injektion kleiner Dosen des Antigens, gefolgt von anschließend erhöhter Dosierung von Antigen behandelt. Man glaubt, dass diese Vorgehensweise eine Gedächtnisimmunantwort bewirkt, um weitere allergische Antworten zu verhindern. Diese Verfahren sind jedoch mit dem Risiko von Nebenwirkungen wie beispielsweise einer allergischen Antwort verbunden. Mit den Verfahren der Erfindung vermeidet man diese Probleme.

Als ein „Allergen" wird eine Substanz (Antigen) bezeichnet, die eine allergische oder asthmatische Antwort bei einem empfindlichen Patienten induziert. Die Liste von Allergenen ist enorm und kann Pollen, Insektengifte, Tierstaub und -schuppen, Pilzsporen und Wirkstoffe (z. B. Penicillin) umfassen. Beispiele für natürliche, tierische und pflanzliche Allergene umfassen, sind aber nicht beschränkt auf Proteine, die für die folgenden Gattungen spezifisch sind: Canine (Canis familiaris); Dermatophagoides (z.B. Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfodia) Lodium (z.B. Lolium perenne oder Lolium multiflorum); Cryptomeria (Cryptomeria japonica); Adternaria (Alternaria alternata); Alder; Alnus (Alnus gultinosa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artermisia (Artermisia vulgaris); Plantago (z.B. Plantago lanceolata); Parietaria (z.B. Parietaria ofjicinalis oder Parietaria judaica); Blattella (z.B. Blattella germanica); Apis (z.B. Apis multiflorum); Cupressus (Cupressus sempervirens, Cupressus arzonica und Cupressus macrocarpa); Juniperus (z.B. Juniperus sabinoides, Juniperus virginia, Juniperus communis und Juniperus ashei); Thuya (z.B. Thuya orientalis); Chamaecyparis (z.B. Chamaecyparis obtusa); Periplaneta (z.B. Periplaneta americana); Agropyron (z.B. Agropyron repens); Secale (z.B. Secale cereale); Triticum (z.B. Triticum aestivum); Dactylis (z.B. Dactydis glomerata); Festuca (z.B. Festuca elatior); Poa (Poa pratensis oder Poa compressa); Avena (z.B. Agena sativa); Holcus (z.B. Holcus lanatus); Antoxanthum (z.B. Anthxanthum odoratum); Arrhenatherum (z.B. Arrhenatherum elatius); Agrostis (z.B. Agrostis alba); Phleum (z.B. Phleum pratense); Phalaris (z.B. Phalaris arundinacea); Paspalum (z.B. Paspalum notatum); Sorghum (z.B. Sorghum halepensis); und Bromus (z.B. Bromus inermis).

Als „Allergie" wird eine erworbene Überempfindlichkeit gegen eine Substanz (Allergen) bezeichnet. Allergische Zustände umfassen, sind aber nicht beschränkt auf Ekzeme, allergische Rhinitis oder Nasenkatarrh, Heuschnupfen, bronchiale Asthma, Urticaria (Nesselsucht) und Lebensmittelallergien und andere atopische Zustände. Ein Patient, der eine allergische Antwort aufweist, ist ein Patient, der eine Allergie entwickelt oder das Risiko trägt, eine solche zu entwickeln.

Allergien werden im allgemeinen durch die Erzeugung von IgE-Antikörper gegen harmlose Allergene bewirkt. Die Cytokine, die durch unmethylierte CpG-Oligonukleotide induziert werden, gehören vorwiegend zu einer Klasse, die als „Th1" bezeichnet wird und die bei einer zellulären Immunantwort am deutlichsten ist und mit IL-12 und IFN-&ggr; und der Produktion von IgG2a-Antikörpern verbunden ist. Die andere Hauptklasse der Immunantworten wird als Th2-Immunantwort bezeichnet und ist eher mit einer IgG1-Antikörper-Immunantwort und mit der Produktion von IL-4, IL-5 und IL-10 verbunden. Allgemein scheint es, dass allergische Erkankungen durch Immunantworten vom Th2-Typ und Autoimmunkrankheiten durch Immunantworten vom Th1-Typ vermittelt werden. Aufgrund der Fähigkeit der Kombination von CpG-Oligonukleotiden und immunpotenzierenden Cytokinen, die Immunantwort bei einem Patienten von einer Th2- (die mit der Produktion von IgE-Antikörpern und Allergie verbunden ist und als Antwort auf GM-CSF alleine ausgelöst wird) auf eine Th1-Antwort (die vor allergischen Reaktionen schützt) zu lenken, kann eine wirksame Dosis eines CpG-Oligonukleotides und eines immunpotenzierenden Cytokins an einen Patienten verabreicht werden, um eine Allergie zu behandeln oder zu verhindern.

In Kombination mit immunpotenzierenden Cytokinen können CpG-Oligonukleotide auch eine erhebliche therapeutische Nützlichkeit bei der Behandlung von Asthma zeigen. Th2-Cytokine, besonders IL-4 und IL-5, sind in den Luftwegen von asthmatischen Patienten erhöht. Diese Cytokine fördern wichtige Aspekte der asthmatischen Entzündungsantwort, die einen IgE-Isotopenwechsel, die Chemotaxis von Eosinophilen und die Aktivierung und das Wachstum von Mastzellen fördern. Th1-Cytokine, insbesondere IFN-&ggr; und IL-12, können die Bildung von Th2-Klonen und die Produktion von Th2-Cytokinen unterdrücken. Als „Asthma" bezeichnet man eine Störung des Atmungssystems, die durch Entzündung, das Verengen der Luftwege und eine erhöhte Reaktivität der Luftwege auf inhalierte Agenzien gekennzeichnet ist. Asthma ist häufig, wenn auch nicht ausschließlich, mit atopischen oder allergischen Symptomen verbunden.

Wie in der gleichzeitig anhängigen Patentanmeldung mit der US Seriennr. 08/960,774 beschrieben ist, verhinderten Oligonukleotide, die ein unmethyliertes CpG-Motiv (d. h. TCCATGACGTTCCTGACGTT; SEQ ID NO: 93) enthielten, aber nicht ein Kontrolloligonukleotid (TCCATGAGCTTCCTGAGTCT; SEQ ID NO: 103), die Entwicklung eines entzündlichen zellulären Infiltrates und einer Eosinophilie in einem Mausmodell von Asthma. Weiterhin war die Unterdrückung der eosinophilen Entzündung mit einer Unterdrückung der Th2-Antwort und einer Induktion der Th1-Antwort verbunden.

Ein „Patient" soll einen Menschen oder ein Wirbeltier bedeuteten, was einen Hund, eine Katze, ein Pferd, eine Kuh, ein Schwein, ein Schaf, eine Ziege, ein Huhn, einen Primaten, z. B. Affen, einen Fisch (Arten der Aquakultur), z. B. Lachs, eine Ratte und eine Maus umfasst, aber nicht darauf beschränkt ist.

Obwohl viele der oben beschriebenen Störungen menschliche Störungen betreffen, ist die Erfindung auch zum Behandeln anderer nichtmenschlicher Wirbeltiere nützlich. Nicht-menschliche Wirbeltiere sind ebenfalls in der Lage, Krebs, Infektionen, Allergien und Asthma zu entwickeln. Zum Beispiel sind die Produkte der Erfindung zusätzlich zur Behandlung infektiöser menschlicher Erkankungen zum Behandeln von Infektionen bei Tieren nützlich.

Wie hierin verwendet, beziehen sich die Begriffe „behandeln", „behandelt" oder „Behandeln", wenn sie mit Bezug auf eine infektiöse Erkrankung verwendet werden, auf eine prophylaktische Behandlung, die die Widerstandfähigkeit eines Patienten im Hinblick auf eine Infektion mit einem Krankheitserreger erhöht oder, in anderen Worten, die Wahrscheinlichkeit verringert, dass der Patient durch den Krankheitserreger infiziert wird, sowie auf eine Behandlung, nachdem der Patient infiziert wurde, um die Infektion zu bekämpfen, zum Beispiel die Infektion zu verringern oder zu eliminieren oder zu verhindern, dass sie schlimmer wird. Viele Impfstoffe für die Behandlung von nichtmenschlichen Wirbeltieren sind in Bennett, K. Compendium of Veterinary Products, 3rd ed. North American Compendiums, Inc., 1995, offenbart.

Somit sieht die vorliegende Erfindung die Verwendung von CpG-Oligonukleotiden und immunpotenzierenden Cytokinen vor, um eine antigenspezifische Immunantwort bei Menschen und nichtmenschlichen Tieren zu induzieren. Wie oben diskutiert, umfassen Antigene infektiöse Mikroben wie beispielsweise einen Virus, Bakterien und Pilze und Fragmente davon, die aus natürlichen Quellen stammen oder synthetischen Ursprungs sind.

Infektiöse Viren sowohl von menschlichen als auch nicht-menschlichen Wirbeltieren umfassen Retroviren, RNA-Viren und DNA-Viren. Diese Gruppe der Retroviren umfasst sowohl einfache Retroviren als auch komplexe Retroviren. Die einfachen Retroviren umfassen die Untergruppen der B-Typ-Retroviren, C-Typ-Retroviren und D-Typ-Retroviren. Ein Beispiel eines B-Typ-Retrovirus ist das Maus-Brustkrebsvirus (MMTV). Die C-Typ-Retroviren umfassen die Subgruppen C-Typ Gruppe A (umfasst Rous-Sarkom-Virus (RSV), Vogel-Leukämie-Virus (ALV) und Vogelmyeloblastose-Virus (AMV)) und C-Typ Gruppe B (umfasst murines Leukämie-Virus (MLV), Katzenleukämie-Virus (FeLV), murines Sarkomvirus (MSV), Gibbon-Affen-Leukämievirus (GALV), Milz-Nekrose-Virus (SNV), Reticuloendotheliosevirus (RV) und Affensarkomvirus (SSV)). Die D-Typ-Retroviren umfassen Mason-Pfizer-Affenvirus (MPMV) und Affenretrovirus Typ 1 (SRV-1). Die komplexen Retroviren umfassen die Untergruppen der Lentiviren, T-Zellen-Leukämie-Viren und Foamyviren. Lentiviren umfassen HIV-1, umfassen aber auch HIV-2, SIV, Visnavirus, Katzen-Immunodefizienz-Virus (FIV) und Pferde-infektiöse-Anämie-Virus (EIAV). Die T-Zellen-Leukämie-Viren umfassen HTLV-1, HTLV-2, Affen-T-Zellen-Leukämie-Virus (STLV) und Rinder-Leukämie-Virus (BFV). Die Foamyviren umfassen menschliches Foamyvirus (HFV), Affen-Foamyvirus (SFV) und Rinder-Foamyvirus (BFV).

Beispiele für andere RNA-Viren, die bei Wirbeltieren Antigene darstellen, umfassen, sind aber nicht beschränkt auf die folgenden: Mitglieder der Familie der Reoviridae, einschließlich der Gattung Orthoreovirus (verschiedene Serotypen sowohl von Säugetier- als auch Vogel-Retroviren), die Gattung Orbivirus (Blauzungenvirus, Eugenangeevirus, Kemerovovirus, Afrikanische Pferdekrankheit-Virus und Colorado-Zecken-Fieber-Virus), der Gattung Rotavirus (menschliches Rotavirus, Nebraska-Kalb-Diarrhoe-Virus, murines Rotavirus, Affen-Rotavirus, Rinder- oder Schafs-Rotavirus, Vogel-Rotavirus); die Familie Picornaviridae, einschließlich der Gattung Enterovirus (Poliovirus, Coxsackievirus A und B, menschliche enterisch-zytopathische Orphan (ECHO)-Viren, Hepatitis A-Virus, Affen-Enteroviren, murine Encephalomyelitis (ME)-Viren, Poliovirus muris, Rinder-Enteroviren, Schweine-Enteroviren, der Gattung Cardiovirus (Encephalomyocarditis-Virus (EMC), Mengovirus), der Gattung Rhinovirus (menschliche Rhinoviren, die mindestens 113 Subtypen umfassen; andere Rhinoviren), der Gattung Apthovirus (Maul- und Klauenseuche (FMDV) umfasst; die Familie Calciviridae, einschließlich vesikuläres Exanthema des Schweinevirus, San Miguel Seelöwen-Virus, Katzen-Picornavirus und Norwalkvirus umfasst; der Familie Togaviridae, einschließlich der Gattung Alphavirus (östliche Pferdeencephalitis-Virus, Semliki-Forest-Virus, Sindbis-Virus, Chikungunya-Virus, O'Nyong-Nyong-Virus, Ross-River-Virus, venezuelanische Pferdeencephalitis-Virus, westliches Pferdeencephalitis-Virus), die Gattung Flavirius (durch Moskito übertragenes Gelbfiebervirus, Dengue-Virus, japanische Encephalitis-Virus, St. Louis Encephalitis-Virus, Murray Valley Encephalitis-Virus, West-Nile-Virus, Kunjin-Virus, zentraleuropäisches- Zecken-übertragenes Virus, Far Eastern Zecken-übertragenes Virus, Kyasanur-Forrest-Virus, Louping-III-Virus, Powassan-Virus, Omsk-hämorrhagisches Fiebervirus), der Gattung Rubivirus (Rubella-Virus), der Gattung Pestivirus (Schleimhaut-Krankheiten-Virus, Hog-Cholera-Virus, Border-disease-Virus); die Familie Bunyaviridae, einschließlich der Gattung Bunyvirus (Bunyamwera und verwandte Viren, kalifornische Encephalitis-Gruppe-Viren), der Gattung Phlebovirus (sizilianisches Sandfliegenfieber-Virus, Rift Valley Fieber-Virus), der Gattung Nairovirus (Krim-Kongo hämorrhagisches Fiebervirus, Nairobi Schafskrankheit-Virus) und der Gattung Uukuvirus (Uukuniemi und verwandte Viren); der Familie Orthomyxoviridae, einschließlich der Gattung Grippevirus (Grippevirus Typ A, viele menschliche Subtypen); Schweinegrippevirus und Vogel- und Pferde-Grippe-Viren; Grippetyp B (viele menschliche Subtypen), und Grippetyp C (mögliche separate Gattung); der Familie Paramyxoviridae, einschließlich der Gattung Paramyxovirus (Parainfluenzavirus Typ 1, Sendaivirus, Hämadsorptions-Virus, Parainfluenza-Viren Typ 2-5, Newcastle-Disease-Virus, Mumpsvirus), der Gattung Morbillivirus (Masernvirus, subakute sklerosierende Panencephalitis-Virus, Distemper-Virus, Rinderpest-Virus), der Gattung Pneumovirus (respiratorisches synzytiales-Virus (RSV), respiratorisches synzytiales Rinder-Virus und Lungenentzündungsvirus von Mäusen); Forest-Virus, Sindbis-Virus, Chikungunya-Virus, O'Nyong-Nyong-Virus, Ross-river-Virus, venezuelanische Pferde-Encephalitis, westliche Pferde-Encephalitis-Virus), der Gattung Flavirius (Mosquito-übertragenes Gelbfiebervirus, Dengue-Virus, japanische Encephalitis-Virus, St. Louis Encephalitis-Virus, Murray Valley Encephalitis Virus, West-Nile-Virus, Kunjin-Virus, zentraleuropäisches Zecken-übertragenes Virus, Far Eastern Zecken-übertragenes Virus, Kyasanur Forest-Virus, Louping III-Virus, Powassan virus, Omskhämorrhagisches Fiebervirus), der Gattung Rubivirus (Rubella-Virus), der Gattung Pestivirus (Schleimhaut-Krankheit-Virus, Wildschwein Cholera-Virus, Border-disease-Virus); der Familie Bunyaviridae, einschließlich der Gattung Bunyvirus (Bunyamwera und verwandte Viren, kalifornische Encephalitisgruppe-Viren), der Genus Phlebovirus (sizilianisches Sandfliegen-Fiebervirus, Rift Valley-Fiebervirus), der Gattung Nairovirus (Krim-Kongo hämorrhagisches Fiebervirus, Nairobi-Schafskrankheitsvirus) und der Gattung Uukuvirus (Uukuniemi und verwandte Viren); der Familie Orthomyxoviridae, die Gattung Grippe-Virus (Grippe-Virus Typ A, viele menschliche Subtypen); Schweine-Grippevirus und Vogel- und Pferdegrippeviren; Grippetyp B (viele menschliche Subtypen) und Grippe Typ C (mögliche separate Gattung); der Familie Paramyxoviridae, einschließlich der Gattung Paramyxovirus (Parainfluenza-Virus Typ 1, Sendai-Virus, Hämadsorptions-Virus, Parainfluenza-Viren Typ 2-5, Newcastle-disease-Virus, Mumpsvirus), der Gattung Morbillivirus (Masernvirus, subakute sklerotisierende Panencephalitis-Virus, Distemper-Virus, Rinderpestvirus), die Gattung Pneumovirus (Respiratory-synzytiales-Virus (RSV), respiratorisches synzytiales Rinder-Virus und Lungenentzündungsviren der Mäuse); der Familie Rhabdoviridae, einschließlich der Gattung Vesiculovirus (VSV), Chandipura-Virus, Flanders-Hart-Park-Virus), der Gattung Lyssavirus (Tollwut-Virus), Fischrhabdo-Viren, und zwei wahrscheinliche Rhabdoviren (Marburg-Virus und Ebola-Virus); der Familie Arenaviridae, einschließlich des die lymphozytischen Choriomengitis-Virus (LCM), Tacaribe-Virus-Komplexes und Lassa-Virus; der Familie Coronaviridae, einschließlich des infektiösen Bronchitisvirus (IBV), Maus-Hepatitis-Virus, menschlichen enteralen Coronavirus, und der Katzen-infektiöse Peritonitis (Katzen-Coronavirus).

Beispielhafte DNA-Viren, die in Wirbeltieren Antigene darstellen, umfassen, sind aber nicht beschränkt auf die Familie Poxviridae, einschließlich der Gattung Orthopoxvirus (Variola major, Variola minor, Affenpocken-Vaccinia, Kuhpocken, Büffelpocken, Kanninchenpocken, Ectromelie), der Gattung Leporipoxvirus (Myxom, Fibrom), der Gattung Avipoxvirus (Geflügelpocken, andere Vogelpockenviren), einschließlich der Gattung Capripoxvirus (Schafpocken, Ziegenpocken), der Gattung Suipoxvirus (Schweinepocken), einschließlich der Gattung Parapoxvirus (ansteckender postularer Dermatitisvirus, Pseudokuhpocken, papillärer Rinder-Stomatitis-Virus); der Familie Iridoviridae (afrikanisches Schweinefiebervirus, Froschviren 2 und 3, Fisch-Lymphozysten-Virus); die Familie Herpesviridae, die &agr;-Herpesviren (Herpes Simplex Typen 1 und 2, Varicella-Zoster, Pferde-Abort-Virus, Pferde-Herpesvirus 2 und 3, Pseudotollwutvirus, infektiöser Rinderkeratoconjunctivitis-Virus, infektiöser Rinderrhinotracheitis-Virus, Katzenrhinotracheitis-Virus, infektiöser Laryngoracheitis-Virus), der Beta-Herpes-Viren (menschlicher Cytomegalievirus und Cytomegalieviren von Schweinen, Affen und Nagetieren); der Gamma-Herpesviren (Epstein-Barr-Virus (EBV), Marek-Virus, Herpes saimiri, Herpesvirus ateles, Herpesvirus sylvilagus, Meerschweinchen-Herpesvirus, Lucke-Tumor-Virus); der Familie Adenoviridae, einschließlich der Gattung Mastadenovirus (menschliche Untergruppen A, B, C, D, E, und ungruppierte; Affenadenoviren (mindestens 23 Serotypen), infektiöse Hunde-Hepatitis und Adenoviren von Rindern, Schweinen, Schafen, Fröschen und vielen anderen Arten, der Gattung Aviaadenovirus (Vogel-Adenoviren); und nicht-kultivierbare Adenoviren; der Familie Papoviridae, einschließlich der Gattung Papillomavirus (menschliche Papillomaviren, Rinderpapillomaviren, Shope-Kanninchen-Papillomavirus und verschiedene pathogene Papilloma-Viren anderer Arten), der Gattung Polyomavirus (Polyomavirus, Affenbläschenbildendes Agens (SV-40), Kanninchen-bläschenbildendes Agens (RKV), K-Virus, BK-Virus, JC-Virus und andere Primaten-Polyomaviren wie lymphotropher Papillomavirus); der Familie Parvoviridae, einschließlich der Gattung adenoverbundene Viren, der Gattung Parvovirus (Katzen-Panleukopenie-Virus, Rinderparvovirus, Hunde-Parvovirus, Aleuten-Nerz-Krankheit-Virus, etc.). Schließlich können DNA-Viren Viren umfassen, die nicht in die obigen Familien passen, wie Kuru- und Creutzfeld-Jacob-Krankheit-Viren und chronische infektiöse neuropathische Agenzien (CHINA-Virus).

Eine jede der vorhergehenden Listen dient der Veranschaulichung, und es ist nicht beabsichtigt, dass sie beschränkend sein sollen.

Zusätzlich zur Verwendung der Kombination von CpG-Oligonukleotiden und immunpotenzierenden Cytokinen, um bei Menschen eine antigenspezifische Immunantwort zu induzieren, sind die Verfahren der bevorzugten Ausführungsformen besonders gut für die Behandlung von Vögeln wie Hennen, Hühnern, Truthähnen, Enten, Gänsen, Wachteln und Fasanen geeignet. Vögel sind die Hauptziele vieler Arten von Infektionen.

Schlüpfende Vögel sind kurz nach der Geburt gegenüber pathogenen Mikroorganismen exponiert. Obwohl diese Vögel anfänglich durch von der Mutter stammende Antikörper vor Krankheitserregern geschützt sind, besteht dieser Schutz nur zeitweilig, und das eigene unreife Immunsystem des Vogels muss anfangen, den Vogel vor Krankheitserregern zu schützen. Es ist oft wünschenswert, Infektionen bei jungen Vögeln zu verhindern, wenn sie am empfindlichsten sind. Es ist auch wünschenswert, Infektionen bei älteren Vögeln zu verhindern, besonders wenn die Vögel in geschlossenen Unterkünften gehalten werden, was zu einer schnellen Verbreitung von Krankheiten führt. Somit ist es wünschenswert, dass CpG-Oligonukleotid und das immunpotenzierende Cytokin der Erfindung an Vögel zu verabreichen, um eine antigenspezifische Immunantwort zu verstärken, wenn das Antigen vorhanden ist.

Ein Beispiel für eine bei Hühnern gewöhnliche Infektion ist das infektiöse Hühneranämievirus (CIAV). CIAV wurde erstmalig 1979 in Japan während der Untersuchung einer Unterbrechung bei der Impfung gegen die Marek'sche Krankheit isoliert (Yuasa et al., 1979, Avian Dis. 23:366-385). Seit dieser Zeit ist CIAV in allen wichtigen geflügelproduzierenden Ländern bei im Handel erhältlichem Geflügel nachgewiesen worden (van Bulow et al., 1991, Seiten 690-699) in Diseases of Poultry, 9th edition, Iowa State University Press).

Die CIAV-Infektion führt bei jungen, empfindlichen Hühnern zu einer klinisch-manifesten Krankheit, die durch Anämie, Blutung und Immunsuppression gekennzeichnet ist. Eine Atrophie des Thymus und des Knochenmarkes und konsistente Verletzungen von mit CIAV infizierten Hühnern kennzeichnen eine CIAV-Infektion ebenfalls.

Die Verminderung der Lymphozyten im Thymus und gelegentlich in der Bursa Fabricii führt zu einer Immunsuppression und zu einer erhöhten Empfindlichkeit gegen sekundäre Virus-, bakterielle oder Pilzinfektionen, die den Verlauf der Krankheit dann verkomplizieren. Die Immunsuppression nach der Infektion mit einem oder mehr als einem der folgenden kann einen schlimmeren Krankheitsverlauf verursachen: das Virus der Marek'schen Krankheit (MDV), das Virus der infektiösen Bursa-Krankheit, das Reticuloendotheliose-Virus, ein Adenovirus oder ein Reovirus. Es wurde berichtet, dass der Krankheitsverlauf von MDV durch CIAV verschlimmert wird (DeBoer et a., 1989, Seite 28 in Proceedings of the 38th Western Poultry Diseases Conference, Tempe, Ariz.). Weiterhin wurde berichtet, dass CIAV die Anzeichen der infektiösen Bursa-Krankheit verschlimmert (Rosenberger et al., 1989, Avian Dis. 33:707-713). Hühner entwickeln aufgrund von CAA eine Altersresistenz gegen die experimentell induzierte Krankheit. Diese ist bis zum Alter von zwei Wochen im Wesentlichen vollständig entwickelt, aber ältere Vögel sind bezüglich der Infektion immer noch empfindlich (Yuasa, N. et al., 1979 oben; Yuasa, N et al., Arian Diseases 24, 202-209, 1980). Wenn Hühner jedoch doppelt mit CAA und einem immunosuppresiven Agens (IBDV, MDV etc.) infiziert sind, wird die Altersresistenz gegen die Krankheit verzögert (Yuasa, N. et al., 1979 und 1980 oben; Bulow von V. et al., J. Veterinary Medicine 33, 93-116, 1986). Die Kennzeichen von CIAV, die die Krankheitsübertragung erhöhen, umfassen eine hohe Resistenz gegen eine Inaktivierung durch die Umgebung und durch gewöhnliche Desinfektionsmittel. Der ökonomische Einfluss der CIAV-Infektion auf die Geflügelindustrie wird durch die Tatsache verdeutlicht, dass 10% bis 30% der infizierten Vögel bei Ausbrüchen der Krankheit sterben.

Die Impfung der Vögel kann wie bei anderen Wirbeltieren in jedem Alter durchgeführt werden. Normalerweise werden die Impfungen mit einem lebendigen Mikroorganismus bis zu einem Alter von 12 Wochen durchgeführt und bis zu einem Alter von 14-18 Wochen, wenn ein inaktivierter Mikroorganismus oder eine andere Art Impfstoff verwendet wird. Bei der in ovo-Impfung kann die Impfung während des letzten Viertels der Embryonalentwicklung durchgeführt werden. Der Impfstoff kann subkutan, durch ein Spray, oral, intraokular, intratracheal, nasal, in ovo oder durch andere hierin beschriebene Verfahren verabreicht werden. Somit kann das CpG-Oligonukleotid und das immunpotenzierende Cytokin der Erfindung Vögeln und anderen nichtmenschlichen Wirbeltieren unter Verwendung von routinemäßigen Impfplänen verabreicht werden, und das Antigen wird, wie hierin beschrieben, nach einer geeigneten Zeitdauer verabreicht.

Rinder und Vieh sind ebenfalls gegen Infektionen empfindlich. Krankheiten, die diese Tiere in Mitleidenschaft ziehen, können schwere wirtschaftliche Verluste hervorrufen, besonders unter Rindern. Die Verfahren der Erfindung können verwendet werden, um Vieh wie beispielsweise Kühe, Pferde, Schweine, Schafe und Ziegen vor Infektionen zu schützen.

Kühe können von Rinderviren infiziert werden. Das virale Diarrhöe-Virus von Rindern (BVDV) ist ein kleines Virus mit einer Hülle und RNA mit positiven Strängen und wird zusammen mit dem Schweine-Choleravirus (HOCV) und dem Schaf-Grenzkrankheit-Virus (BDV) in die Gattung Pestivirus eingeordnet. Obwohl Pestiviren früher in die Togaviridae-Familie eingeordnet wurden, haben einige Studien nahegelegt, dass sie zusammen mit dem Flavivirus und dem Hepatitis-C-Virus (HCV)-Gruppen neu in die Flaviviridae-Familie eingeordnet werden sollten (Francki, et al., 1991).

Bei BVDV, das ein wichtiger Krankheitserreger bei Rindern ist, können auf der Grundlage der Analyse von Zellkulturen zytopathogene (CP) und nichtzytopathogene (NCP) Biotypen unterschieden werden. Der NCP-Biotyp ist weiter verbreitet, obwohl beide Biotypen in Rindern gefunden werden können. Wenn eine trächtige Kuh mit einem NCP-Stamm infiziert wird, kann die Kuh ein widerstandsfähig infiziertes und spezifisch immuntolerantes Kalb gebären, das den Virus während seiner Lebenszeit verbreiten wird. Die widerstandsfähig infizierten Rinder können der Schleimhautkrankheit unterliegen, und beide Biotypen können dann aus dem Tier isoliert werden. Die klinischen Manifestierungen können Abort, Teratogenese und Atmungsprobleme, Schleimhautkrankheit und milde Diarrhöe umfassen. Zusätzlich wurde eine schwere Trombozytopenie beschrieben, die mit Herdenepidemien verbunden ist und zum Tode des Tieres führen kann, und Stämme, die mit dieser Krankheit verbunden sind, scheinen virulenter zu sein als die klassischen BVDVs.

Pferdeherpesviren (EHV) umfassen eine Gruppe hinsichtlich der Antigene unterscheidbarer biologischer Agenzien, die eine Vielzahl von Infektionen bei Pferden verursachen, die von Krankheiten ohne klinische Anzeichen bis zu tödlichen Krankheiten reichen. Diese umfassen das Pferde-Herpesvirus-1 (EHV-1), einen ubiquitären Krankheitserreger bei Pferden. EHV-1 ist mit epidemisch auftretenden Aborten, Atemwegskrankheiten und Störungen des zentralen Nervensystems verbunden. Die primäre Infektion der oberen Atemwege junger Pferde führt zu einer Fieberkrankheit, die 8 bis 10 Vage andauert. Immunologisch erfahrene Stuten können über die Atemwege wieder infiziert werden, ohne dass die Krankheit zu Tage tritt, so dass ein Abort gewöhnlich ohne Warnung auftritt. Das neurologische Syndrom ist mit Atemwegskrankheiten oder Abort verbunden und kann Tiere jeden Geschlechts und in jedem Alter in Mitleidenschaft ziehen, was zu Koordinationsstörungen, Schwäche und zur Lähmung des Hinterteils führt (Telford, E.A.R. et al., Virology 189, 304-316, 1992). Andere EHVs umfassen EHV-2 oder Pferde-Cytomegalovirus, EHV-3, Koital-Exanthem-Virus von Pferden und EHV-4, das früher als EHV-1 Suptyp 2 eingeordnet war.

Schafe und Ziegen können von einer Vielzahl gefährlicher Mikroorganismen infiziert werden, die Visna-Maedi umfassen.

Primaten, wie beispielsweise Affen, Menschenaffen und Makaken können vom Affen-Immunodefizienz-Virus infiziert werden. Von Impfstoffen aus inaktivierten zusammen mit Zellen oder zellfrei vorliegenden ganzen Affenimmunodefizienzvirus wurde berichtet, dass sie bei Makaken Schutz verleihen (Stott et al. (1990) Lancet 36:1538-1541; Desrosiers et al. PNAS U.S.A. (1989) 86:6353-6357; Murphey-Corb et al. (1989) Science 246:1293-1297; und Carlson et al. (1990) AIDS Res. Human Retroviruses 6:1239-1246). Von einem rekombinanten HIV gp120-Impfstoff wurde berichtet, dass er bei Schimpansen Schutz verleiht (Berman et al. (1990) Nature 345:622-625).

Sowohl Hauskatzen als auch Wildkatzen sind gegen die Infektion mit einer Vielzahl von Mikroorganismen empfindlich. Zum Beispiel ist die infektiöse Katzenperitonitis eine Krankheit, die sowohl bei Hauskatzen als auch Wildkatzen wie beispielsweise bei Löwen, Leoparden, Geparden und Jaguaren auftritt. Wenn es wünschenswert ist, der Infektion mit diesen und anderen Arten von krankheitserregenden Organismen bei Katzen vorzubeugen, können die Verfahren der Erfindung verwendet werden, um die Katzen zu impfen, um bei ihnen Infektionen zu verhindern.

Hauskatzen können von verschiedenen Retroviren infiziert werden, die das Katzen-Leukämievirus (FeLV), das Katzen-Sarkomvirus (FeSV), das Oncornavirus vom endogenen Typ C (RD-114) und das synzytienbildende Virus von Katzen (FeSFV) umfassen, aber nicht auf diese beschränkt sind. Von diesen ist das FeLV der bedeutendste Krankheitserreger und verursacht verschiedene Symptome, die lymphoreticuläre und myeloide Neoplasmen, Anämien, immunvermittelte Störungen und ein Immundeffizienz-Syndrom umfassen, das dem Syndrom der menschlichen erworbenen Immundeffizienz (AIDS) ähnlich ist. Kürzlich wurde eine bestimmte replikationsdefekte FeLV-Mutante, die als FeLV-AIDS bezeichnet wird, noch spezifischer mit immunsuppressiven Eigenschaften in Verbindung gebracht.

Von der Entdeckung des T-lymphotropen Katzen-Lentiviruses (auch als Katzen-Immunodeffizienz bezeichnet) wurde erstmalig in Pedersen et. al. (1987) Science 235:790-793 berichtet. Von den Kennzeichen des FIV wurde in Yamamoto et al. (1988) Leukemia, Dezember-Ausgabe 2:204S-215S; Yamamoto et al (1988) Am.J.Vet Ressource. 49:1246-1258; und Ackley et al. (1990) J. Virol. 64:5652-5655) berichtet. Die Klonierung und Sequenzanalyse von FIV wurde in Olmsted et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86:2448-2452 und 86:4355-4360 veröffentlicht.

Infektiöse Katzen-Peritonitis (FIP) ist eine sporadisch auftretende Krankheit, die unvorhersehbar bei Haus- und Wildkatzen auftritt. Während FIP primär eine Krankheit von Hauskatzen ist, wurde sie schon bei Löwen, Berglöwen, Leoparden, Geparden und dem Jaguar diagnostiziert. Kleinere Wildkatzen, die von FIP heimgesucht wurden, umfassen den Luchs und den Karakal, die Sandkatze und die Pallaskatze. Bei Hauskatzen tritt die Krankheit vorwiegend bei jungen Tieren auf, obwohl Katzen jeder Altersstufe empfindlich sind. Ein Peak hinsichtlich des Auftretens tritt im Alter von 6 bis 12 Monaten auf. Ein Abnehmen des Auftretens wird im Alter von 5 bis 13 Jahren festgestellt, gefolgt von einem erhöhten Auftreten bei Katzen im Alter von 14 bis 15 Jahren.

Virale und bakterielle Krankheiten bei Flossenfischen, Schalentieren oder anderen aquatischen Lebensformen stellen ein ernstes Problem für die Aquakulturindustrie dar. Aufgrund der hohen Tierdichte in den Schlüpfbecken oder umschlossenen Gebieten bei der Meereshaltung können Infektionskrankheiten einen großen Teil des Bestandes auslöschen, z. B. in einer Anlage für Flossenfische, Schalentiere oder andere aquatische Lebensformen. Die Prävention von Krankheiten ist ein wünschenswerterer Ausweg aus diesen Bedrohungen für die Fische als ein Eingreifen zu einem Zeitpunkt, wenn die Krankheit schon am Fortschreiten ist. Die Impfung von Fischen ist das einzige präventive Verfahren, das durch Immunität einen langanhaltenden Schutz bietet. Impfungen auf der Grundlage von Nukleinsäuren sind im US-Patent Nr. 5,780,448 beschrieben, das an Davis erteilt wurde.

Das Immunsystem von Fischen weist viele Merkmale auf, die dem Immunsystem von Säugetieren ähnlich sind, wie beispielsweise das Vorhandensein von B-Zellen, T-Zellen, Lymphokinen, Komplement und Immunglobulinen. Fische besitzen Unterklassen von Lymphozyten, deren Rollen in vielerlei Hinsicht denjenigen der B- und T-Zellen von Säugetieren ähnlich zu sein scheinen. Impfstoffe können oral oder durch Immersion oder Injektion verabreicht werden.

In der Aquakultur verwendete Arten umfassen, sind aber nicht beschränkt auf Flossenfische, Schalentiere und andere aquatische Lebensformen. Flossenfische umfassen alle Fische mit Wirbelsäule, welche Knochen- oder Knorpelfische, wie beispielsweise Lachsartige, Karpfen, Wels, Gelbschwanz, Goldbrasse und Wolfsbarsch sein können. Lachsartige sind eine Familie von Flossenfischen, die die Forelle (einschließlich die Regenbogenforelle), den Lachs und den arktischen Saibling umfassen. Beispiele für Schalentiere umfassen, sind aber nicht beschränkt auf Muscheln, Hummer, Shrimps, Krabben und Austern. Andere gehaltene Wassertiere umfassen, sind aber nicht beschränkt auf Aale, Tintenfische und Octopusse.

Polypeptide von viralen Krankheitserregern der Aquakultur umfassen, sind aber nicht beschränkt auf das Glykoprotein (G) oder das Nukleoprotein (N) des viralen Blutungs-Septikämie-Virus (VHSV); die G- oder N-Proteine des infektiösen hämatopoetischen Nekroseviruses (IHNV); VP1-, VP2-, VP3- oder N-Strukturproteine des infektiösen pankreatischen Nekrosevirus (IPNV); das G-Protein der Frühlings-Virämie des Karpfens (SVC) und ein mit einer Membran verbundenes Protein, Tegumin oder Kapsel-Protein oder das Glycoprotein des Kanalwelsvirus (CCV).

Polypeptide von bakteriellen Krankheitserregern umfassen, sind aber nicht beschränkt auf ein eisenreguliertes Protein der äußeren Membran (IROMP), ein Protein der äußeren Membran (OMP) und ein A-Protein von Aeromonis salmonicida, das Furunkulose verursacht, das p57-Protein von Renibacterium salmoninarum, das die bakterielle Nierenkrankheit (BKD) verursacht, das Haupt-oberflächenverbundene-Antigen (msa), ein an der Oberfläche exprimiertes Cytotoxin (mpr), ein an der Oberfläche exprimiertes Hemolysin (ish), und ein Flagellen-Antigen der Yersiniose; ein extrazelluläres Protein (ECP), ein eisenreguliertes Protein der äußeren Membran (IROMP), und ein strukturelles Protein der Pasteurellose; ein OMP und ein Flagellen-Protein von Vibrosis anguillarum und V. ordalii; ein Flagellen-Protein, ein OMP-Protein, aroA, und purA von Edwardsiellosis ictaluri und E. tarda; und das Oberflächen-Antigen von Ichthyophtirius; und ein strukturelles und regulatorisches Protein von Cythophaga columnari; und ein strukturelles und regulatorisches Protein von Rickettsia.

Polypeptide eines parasitischen Krankheitserregers umfassen, sind aber nicht beschränkt auf die Oberflächenantigene von Ichthyophtirius.

Der Patient ist gegenüber dem Antigen exponiert. Wie hierin verwendet, bezieht sich der Begriff "gegenüber ... exponiert" entweder auf den aktiven Schritt des Kontaktierens des Patienten mit einem Antigen oder das passive Exponiertsein des Patienten gegenüber dem Antigen in vivo. Verfahren zum aktiven Exponieren eines Patienten gegenüber einem Antigen sind auf dem Gebiet wohlbekannt. Im Allgemeinen wird ein Antigen direkt an den Patienten durch jedes Mittel wie beispielsweise intravenöse, intramuskuläre, orale, transdermale, mukosale, intranasale, intratracheale oder subkutane Verabreichung, verabreicht. Das Antigen kann systemisch oder lokal verabreicht werden. Verfahren zum Verabreichen des Antigens und des CpGs und des immunpotenzierenden Cytokins sind unten detaillierter beschrieben. Ein Patient ist gegenüber einem Antigen passiv exponiert, wenn das Antigen zum Exponieren gegenüber den Immunzellen im Körper verfügbar wird. Ein Patient kann z. B. durch das Eindringen eines fremden Krankheiterregers in den Körper oder durch die Entwicklung einer Tumorzelle, die ein fremdes Antigen auf ihrer Oberfläche exprimiert, gegenüber einem Antigen passiv exponiert sein. Wenn ein Patient gegenüber einem Antigen passiv exponiert ist, wird bevorzugt, dass das CpG-Oligonukleotid ein Oligonukleotid von einer Länge von 8-100 Nukleotiden ist und/oder ein phosphatmodifiziertes Rückgrat aufweist.

Die Verfahren, bei denen ein Patient gegenüber einem Antigen passiv exponiert ist, können besonders von der zeitlichen Abstimmung der Verabreichung des CpG-Oligonukleotides und des immunpotenzierenden Cytokins abhängen. Zum Beispiel kann einem Patienten, der ein Risiko trägt, Krebs oder eine infektiöse Erkrankung oder eine allergische oder asthmatische Antwort zu entwickeln, das CpG-Nukleotid und das immunpotenzierende Cytokin regelmäßig verabreicht werden, wenn das Risiko am größten ist, d. h. während der im Hinblick auf Allergien kritischen Jahreszeit oder nach dem Exponieren gegenüber einem krebsverursachenden Agens. Zusätzlich können das CpG-Oligonukleotid und das immunpotenzierende Cytokin an Reisende verabreicht werden, bevor sie in fremde Länder reisen, wo für sie das Risiko einer Exponierung gegenüber infektiösen Agenzien besteht. Gleichermaßen können das CpG-Oligonukleotid und das immunpotenzierende Cytokin an Soldaten oder Zivilisten verabreicht werden, bei denen das Risiko der Exponierung gegenüber biologische Kriegswaffen besteht, um eine systemische Immunantwort auf das Antigen zu induzieren, wenn und falls der Patient ihm gegenüber ausgesetzt ist.

Ein Patient, bei dem das Risiko der Entwicklung einer Krebsart besteht, kann auch gemäß den Verfahren der Erfindung durch passives oder aktives Exponieren gegenüber einem Antigen, gefolgt von CpG und immunpotenzierendem Cytokin, behandelt werden. Ein Patient, bei dem das Risiko des Entwickelns von Krebs besteht, ist ein Patient, der eine hohe Wahrscheinlichkeit aufweist, Krebs zu entwickeln. Diese Patienten umfassen z. B. Patienten, die eine genetische Abnormalität aufweisen, von deren Vorhandensein gezeigt wurde, dass sie mit einer höheren Wahrscheinlichkeit korreliert, dass es zur Entwicklung von Krebs kommt, sowie Patienten, die gegenüber krebsauslösenden Agenzien wie Tabak, Asbest oder anderen chemischen Toxinen exponiert sind. Wenn ein Patient, bei dem das Risiko des Entwickelns von Krebs besteht, mit einem CpG und einem immunpotenzierenden Cytokin regelmäßig, z. B. monatlich, behandelt wird, wird der Patient in der Lage sein, ein Antigen zu erkennen und eine antigenspezifische Immunantwort zu zeigen. Wenn sich in dem Patient ein Tumor zu bilden beginnt, wird der Patient eine spezifische Immunantwort gegen eines oder mehr als eines der Tumorantigene entwickeln. Dieser Aspekt der Erfindung ist besonders vorteilhaft, wenn das Antigen, gegenüber dem der Patient exponiert sein wird, unbekannt ist. Zum Beispiel ist bei Soldaten, bei denen das Risiko der Exponierung gegenüber biologischen Kriegswaffen besteht, im Allgemeinen nicht bekannt, gegenüber welcher biologischen Waffe der Soldat exponiert sein könnte.

Das Antigen kann an das Immunsystem des Patienten alleine oder mit einem Träger abgegeben werden. Zum Beispiel können kolloidale Dispersionssysteme verwendet werden, um Antigen an einen Patient abzugeben. Wie hierin verwendet, bezeichnet ein "kolloidales Dispersionssystem" ein natürliches oder synthetisches Molekül, das nicht eines derjenigen ist, die aus bakteriellen oder viralen Quellen stammen, und das in der Lage ist, das Antigen in einem Patient abzugeben und es freizusetzen. Kolloidale Dispersionssysteme umfassen makromolekulare Komplexe, Nanokapseln, Mikrosphären, Kügelchen und auf Lipiden basierende Systeme, die Emulsionen von Öl in Wasser, Mizellen, gemischte Micellen und Liposomen umfassen. Ein bevorzugtes kolloidales System der Erfindung ist ein Liposom. Liposomen sind künstliche Membrangefäße, die als Abgabevektor in vivo oder in vitro nützlich sind. Es wurde gezeigt, dass große unilamellare Gefäße (LUV), die einen Größenbereich von 0,2-4,0 &mgr; aufweisen, große Makromoleküle innerhalb des wässrigen Inneren einkapseln können und dass diese Makromoleküle in einer biologisch aktiven Form an Zellen abgegeben werden können (Fraley, et al., Trends Biochem. Sci., 6:77 (1981)).

Lipid-Formulierungen zur Transfektion sind im Handel von QIAGEN erhältlich, z. B. in der Form von EFFECTENETM (ein nicht-liposomales Lipid mit einem besonderen DNA-kondensierenden Verstärker) und SUPER-FECTTM (eine auf eine neue Weise wirkende dendrimerische Technologie) genauso wie von Gibco BRL, z. B. in der Form von LIPOFECTINTM und LIPOFECTACETM, die aus kationischen Lipiden wie beispielsweise N-[1-(2,3-Dioleyloxy)-propyl]-N,N,N-Trimethylammoniumchlorid (DOTMA) und Dimethyldioctadecylammoniumbromid (DDAB) gebildet sind. Verfahren zur Herstellung von Liposomen sind auf dem Gebiet wohlbekannt und wurden in zahlreichen Veröffentlichungen beschrieben. Liposomen wurden in einem Überblick von Gregoriadis, G., Trends in Biotechnology 3:235-241 (1985) beschrieben.

Es herrscht die Vorstellung, dass das Antigen an den Patient in einem Nukleinsäuremolekül abgegeben werden kann, das für das Antigen kodiert, so dass das Antigen in vivo exprimiert werden muss. Bei diesen Ausführungsformen der Erfindung kann das Nukleinsäuremolekül auch ein CpG-Dinukleotid mit der Sequenz der Nukleinsäure umfassen. Aber in diesem Fall ersetzt das Nukleinsäuremolekül nicht das CpG-Oligonukleotid. Das Antigen muss zusammen mit einem CpG-Oligonukleotid verabreicht werden, das von dem Nukleinsäuremolekül getrennt ist. Die Nukleinsäure, die für das Antigen kodiert, ist funktionsfähig mit einer Genexpressionssequenz verbunden, die Expression der Antigen-Nukleinsäure innerhalb einer eukaryontischen Zelle steuert. Die "Genexpressionssequenz" ist jede regulatorische Nukleotidsequenz, wie beispielsweise eine Promotor-Sequenz oder eine Kombination von Promotor und Enhancer, die die effiziente Transkription und Translation der Antigen-Nukleinsäure, mit der sie funktionsfähig verbunden ist, erleichtert. Die Genexpressionssequenz kann z. B. ein Säugetier- oder ein Virus-Promotor wie beispielsweise ein konstitutiver oder ein induzierbarer Promotor sein. Konstitutive Säugetier-Promotoren umfassen, sind aber nicht beschränkt auf die Promotoren der folgenden Gene: Hypoxanthin-Phosphoribosyl-Transferase (HPTR), Adenosindeaminase, Pyruvatkinase, &bgr;-Aktin-Promotor und andere konstitutive Promotoren. Beispielhafte virale Promotoren, die in eukaryontischen Zellen konstitutiv funktionieren, umfassen z. B. Promotoren des Affenvirus, des Papillomvirus, des Adenovirus, des menschlichen Immunodeffizienzvirus (HIV), des Rous-Sarkom-Virus, des Cytomegalievirus, der langen terminalen Wiederholungen (LTR) des Moloney-Leukämieviruses und anderer Retroviren, und der Thymidinkinase-Promoter des Herpes-simplex-Virus. Andere konstitutive Promotoren sind Fachleuten auf dem Gebiet bekannt. Die als Genexpressionsequenzen nützlichen Promotoren der Erfindung umfassen auch induzierbare Promotoren. Induzierbare Promotoren werden bei Anwesenheit eines induzierenden Agens exprimiert. Zum Beispiel wird der Metallothionein-Promotor bei Anwesenheit bestimmter Metallionen induziert, Transkription und Translation zu fördern. Andere induzierbare Promotoren sind den Fachleuten auf dem Gebiet bekannt.

Im Allgemeinen soll die Genexpressionssequenz wie notwendig 5' nicht-transkribierende und 5' nicht-translatierende Sequenzen umfassen, die an der Initiation der Transkription und Translation beteiligt sind, wie beispielsweise eine TATA-Box, die Kappungssequenz, die CAAT-Sequenz und dergleichen. Insbesondere werden solche 5' nicht-transkribierende Sequenzen eine Promotor-Region umfassen, die eine Promotorsequenz zur transkriptionellen Kontrolle der funktionsfähig verbundenen Antigen-Nukleinsäure umfassen. Die Genexpressionssequenzen umfassen optional wie gewünscht Verstärkersequenzen oder stromaufwärtige Aktivierungssequenzen.

Die Antigen-Nukleinsäure ist mit der Genexpressionssequenz operativ verbunden. Wie hierin verwendet, werden die Antigen-Nukleinsäuresequenz und die Genexpressionssequenz" funktionsfähig verbunden" genannt, wenn sie in der Weise kovalent verbunden sind, dass die Expression oder Transkription und/oder Translation der für das Antigen kodierenden Sequenz unter dem Einfluss oder der Kontrolle der Genexpressionssequenz gestellt wird. Von zwei DNA-Sequenzen wird gesagt, dass sie funktionsfähig verbunden sind, wenn die Induktion eines Promotors der 5'-Genexpressionssequenz die Transkription der Antigen-Sequenz bewirkt, und wenn die Natur der Verbindung zwischen den beiden DNA-Sequenzen nicht (1) in der Einführung einer Mutation mit einer Verschiebung des Leserasters bewirkt, (2) nicht die Fähigkeit der Promotor-Region stört, die Transkription der Antigen-Sequenz zu steuern, oder (3) die Fähigkeit des entsprechenden RNA-Transkriptes stört, zu einem Protein translatiert zu werden. Somit wäre eine Genexpressionssequenz mit einer Antigen-Nukleinsäuresequenz funktionsfähig verbunden, wenn die Genexpressionssequenz in der Lage wäre, die Transkription dieser Antigen-Nukleinsäuresequenz derart zu bewirken, dass das sich ergebende Transkript zu dem gewünschten Protein oder Polypeptid translatiert wird.

Die Antigen-Nukleinsäure der Erfindung kann an das Immunsystem alleine oder in Verbindung mit einem Vektor abgegeben werden. Im weitesten Sinne ist ein "Vektor" jedes Vehikel, das in der Lage ist, den Übergang der Antigen-Nukleinsäure auf die Zellen des Immunsystems und bevorzugterweise APCs zu erleichtern, so dass das Antigen auf der Oberfläche von einer APC exprimiert und präsentiert werden kann. Bevorzugterweise transportiert der Vektor die Nukleinsäure zu den Immunzellen bei relativ zu dem Ausmaß des Abbaus, das sich bei Abwesenheit des Vektors ergeben würde, verringertem Abbau. Der Vektor umfasst optional die oben beschriebene Genexpressionssequenz, um die Expression der Antigen-Nukleinsäure in APCs zu erhöhen. Im Allgemeinen umfassen die Vektoren, die bei der Erfindung nützlich sind, die folgenden, sind aber nicht beschränkt auf Plasmide, Phagemide, Viren, andere Vehikel, die aus viralen und bakteriellen Quellen stammen, die durch Insertion oder Einbau der Antigen-Nukleinsäure manipuliert worden sind. Virale Vektoren sind eine bevorzugte Art Vektor und umfassen, sind aber nicht beschränkt auf Nukleinsäuresequenzen aus den folgenden Viren: Retrovirus, wie beispielsweise muriner Moloney-Leukämievirus, muriner Harvey-Sarkomvirus, muriner Brusttumorvirus und Rouse-Sarkomvirus; Adenovirus, adenoverbundener Virus; Viren vom SV40-Typ; Polyomviren; Epstein-Barr-Viren; Papillomviren; Herpesvirus; Vakzinvirus; Poliovirus; und RNA-Virus wie beispielsweise ein Retrovirus. Man kann leicht andere Vektoren verwenden, die hier nicht genannt sind, aber auf dem Gebiet bekannt sind.

Bevorzugte virale Vektoren basieren auf nicht-zytopathischen eukaryontischen Viren, bei denen nicht-essentielle Gene durch interessierende Gene ersetzt worden sind. Nicht-zytopathische Viren umfassen Retroviren, deren Lebenszyklus die reverse Transkription von genomischer viralen RNA zu DNA mit nachfolgender proviraler Integration in die zelluläre DNA des Wirtes umfasst. Retroviren sind zur Verwendung bei Versuchen zur menschlichen Gentherapie genehmigt worden. Am nützlichsten sind diejenigen Retroviren, die replikationsdefizient sind (d. h. in der Lage, die Synthese von den erwünschten Proteinen zu lenken, aber nicht in der Lage, einen infektiösen Partikel herzustellen). Solche genetisch veränderten retroviralen Expressionsvektoren weisen generelle Nützlichkeit hinsichtlich der hocheffizienten Transduktion von Genen in vivo auf. Standardprotokolle zur Herstellung replikationsdefizienter Retroviren (die die Schritte des Einbaus von exogenem genetischem Material in ein Plasmid, die Transfektion einer Verpackungszelle, die mit Plasmid ausgekleidet ist, die Produktion von rekombinanten Retroviren durch die Verpackungszellinie, die Gewinnung von viralen Partikeln aus Gewebekulturmedium und die Infektion der Zielzellen mit viralen Partikeln umfassen) werden bereitgestellt in Kriegler, M., "Gene Transfer und Expression, A Laboratory Manual," W.H. Freeman C.O., New York (1990) and Murry, E.J. Ed. "Methods in Molecular Biology", Band 7, Humana Press, Inc., Cliffton, New Jersey (1991).

Das adenoverbundene Virus, ein Virus mit doppelsträngiger DNA, ist für bestimmte Anwendungen ein bevorzugter Virus. Das adeno-assoziierte Virus kann derart verändert werden, dass es replikationsdefizient wird, und es ist in der Lage, eine breite Auswahl an Zelltypen und -arten zu infizieren. Es weist weiterhin Vorteile auf wie beispielsweise Stabilität gegen Hitze und lipidische Lösungsmittel, hohe Transduktionshäufigkeit bei Zellen diverser Abstammung, einschließlich hämopoetischer Zellen, und das Fehlen einer Superinfektions-Inhibition, und erlaubt somit mehrere Transduktionsrunden. Wie berichtet wurde, kann das adeno-assoziierte Virus sich auf eine ortsspezifische Weise in menschliche DNA integrieren, und minimiert dadurch die Möglichkeit der Entstehung von Mutationen durch die Insertion und von Schwankungen der Expression eingesetzter Gene, was ein Kennzeichen einer retroviralen Infektion ist. Zusätzlich wurden Infektionen mit dem Wildtyp des adeno-assoziierten Virus in der Gewebekultur über mehr als 100 Passagen bei Abwesenheit von Selektionsdruck verfolgt, was impliziert, dass die genomische Integration des adeno-assoziierten Virus ein vergleichsweise stabiles Ereignis ist. Das adeno-assoziierte Virus kann auch in einer extra-chromosomalen Weise funktionieren.

Andere Vektoren umfassen Plasmidvektoren. Plasmidvektoren wurden auf dem Gebiet umfangreich beschrieben und sind Fachleuten wohlbekannt. Siehe z. B. Sambrook et al., "Molecular Cloning: A Laboratory Manual", Second Edition, Cold Spring Harbor Laboratory Press, 1989. In den letzten Jahren wurde festgestellt, dass Plasmidvektoren zum Abgeben von Genen an Zellen in vivo, aufgrund von ihrer Unfähigkeit, innerhalb eines Wirtsgenomes zu replizieren und darin zu integrieren, besonders vorteilhaft sind. Diese Plasmide weisen jedoch einen Promotor auf, der mit der Wirtszelle kompatibel ist, und können ein Peptid von einem Gen exprimieren, für das das Plasmid funktionsfähig kodiert. Einige üblicherweise verwendete Plasmide umfassen pBR322, pUC18, pUC19, pRC/CMV, SV40 und pBlueScript. Andere Plasmide sind den Fachleuten auf dem Gebiet wohlbekannt. Zusätzlich können Plasmide unter Verwendung von Restriktionsenzymen und Ligationsreaktionen zum spezifischen Entfernen oder Hinzuzufügen von DNA-Fragmente anwendungsspezifisch gestaltet werden.

Kürzlich wurde entdeckt, dass Plasmide, die Gene tragen, unter Verwendung von Bakterien an das Immunsystem abgegeben werden können. Modifizierte Formen von Bakterien wie beispielsweise Salmonella können mit dem Plasmid transfiziert werden und als Abgabevehikel verwendet werden. Die bakteriellen Abgabevehikel können an einen Wirtspatienten oral oder durch andere Verabreichungsmittel verabreicht werden. Die Bakterien geben das Plasmid an Immunzellen, z. B. dendritische Zellen, ab, vermutlich indem sie durch die Darmbarriere hindurchtreten. Unter Verwendung dieser Methode wurde ein hohes Maße an immunologischem Schutz erreicht.

Somit ist die planmäßige Verabreichung von CpG-Oligonukleotiden und immunpotenzierenden Cytokinen vorgesehen. Die Oligonukleotide können einem Patienten wöchentlich oder monatlich verabreicht werden. Wenn bei einem Patienten das Risiko einer Exponierung gegenüber einem Antigen oder Antigenen besteht, können das CpG und das immunpotenzierende Cytokin regelmäßig verabreicht werden, damit das Antigen unmittelbar nach der Exponierung erkannt und eine antigenspezifische Immunantwort bewirkt wird. Ein Patient, bei dem das Risiko einer Exponierung gegen ein Antigen besteht, ist jeder Patient, der eine hohe Wahrscheinlichkeit aufweist, gegenüber einem Antigen exponiert zu sein und eine Immunantwort gegen das Antigen zu entwickeln. Wenn das Antigen ein Allergen ist und der Patient allergische Antworten auf dieses besondere Antigen entwickelt und der Patient gegenüber dem Antigen exponiert ist, z. B. während der Pollenflug-Jahreszeit, dann besteht bei dem Patient das Risiko einer Exponierung gegenüber dem Antigen.

Die CpG-Oligonukleotide der Erfindung sind Nukleinsäuremoleküle, die eine unmethylierte Cytosin-Guanin-Dinukleotidsequenz (d. h. "CpG DNA" oder DNA, die ein 5'-Cytosin, gefolgt von einem 3'-Guanosin, umfasst, und die durch eine Phosphatbindung verbunden sind) enthält und das Immunsystem aktiviert. Die CpG-Oligonukleotide können doppelsträngig oder einzelsträngig sein. Im allgemeinen sind doppelsträngige Moleküle in vivo stabiler, wohingegen einzelsträngige Moleküle eine erhöhte Immunaktivität aufweisen.

Die Begriffe "Nukleinsäure" und "Oligonukleotid" werden synonym verwendet und bedeuten mehrere Nukleotide (d. h. Moleküle, die einen Zucker (z. B. Ribose oder Desoxyribose) umfassen, der an eine Phosphatgruppe und an eine austauschbare organische Base gebunden ist, die entweder ein substituiertes Pyrimidin (z. B. Cytosin (C), Thymin (T) oder Uracil (U)) oder ein substituiertes Purin (z. B. Adenin (A) oder Guanin (G)) ist. Wie hierin verwendet, beziehen sich die Begriffe gleichermaßen auf Oligoribonukleotide und Oligodesoxyribonukleotide. Diese Begriffe sollen auch Polynukleoside (d. h. ein Polynukleotid minus dem Phosphat) und jedes andere Polymer, das organische Basen enthält, umfassen. Nukleinsäuremoleküle können aus vorhandenen Nukleinsäurequellen (z. B. genomischen oder cDNA) erhalten werden, sind aber bevorzugterweise synthetisch (z. B. durch Oligonukleotidsynthese produziert). Das gesamte CpG-Oligonukleotid kann unmethyliert sein, oder Teile davon können unmethyliert sein, aber mindestens das C des 5' CG 3' muss unmethyliert sein.

In einer bevorzugten Ausführungsform stellt die Erfindung ein CpG-Oligonukleotid bereit, das mindestens durch die Formel: 5'N1X1CGX2N23' dargestellt ist, wobei mindestens ein Nukleotid aufeinanderfolgende CpGs trennt; X1 Adenin, Guanin oder Thymin ist; X2 Cytosin, Adenin oder Thymin ist; N jedes Nukleotid und N1 und N2 Nukleinsäuresequenzen sind, die jeweils aus etwas 0-25 Ns zusammengesetzt sind.

In einer weiteren Ausführungsform stellt die Erfindung ein isoliertes CpG-Oligonukleotid bereit, das mindestens durch die Formel: 5'N1X1X2CGX3X4N23' dargestellt ist, wobei mindestens ein Nukleotid aufeinanderfolgende CpGs trennt; X1X2 aus der Gruppe ausgewählt ist, die aus GpT, GpA, ApA, GpG und ApT besteht; X3X4 aus der Gruppe ausgewählt ist, die aus TpT, CpT, TpC, CpC und ApT besteht; N jedes Nukleotid ist und N1 und N2 Nukleinsäuresequenzen sind, die jeweils aus etwa 0-25 Ns zusammengesetzt sind. In einer bevorzugten Ausführungsform enthalten N1 und N2 aus der Nukleinsäure kein CCGG-Quadmer oder nicht mehr als ein CCG- oder CGG-Trimer. In einer weiteren bevorzugten Ausführungsform weist das CpG-Oligonukleotid die Sequenz 5'TCN1TX1X2CGX3X43' auf.

Bevorzugterweise umfassen die CpG-Oligonukleotide der Erfindung X1X2, das aus der Gruppe ausgewählt ist, die aus GpT, GpG, GpA und ApA besteht, und X3X4 ist aus der Gruppe ausgewählt, die aus TpT, CpT, und GpT besteht. Um die Aufnahme in Zellen zu erleichtern, haben CpG enthaltende Oligonukleotide bevorzugterweise eine Länge im Bereich von 8 bis 30 Basen. Jedoch sind Nukleinsäuren jeder Größe, die größer als 8 Nukleotide ist (selbst viele kb lang), in der Lage, eine Immunantwort gemäß der Erfindung zu induzieren, falls eine ausreichende Zahl von immunstimulatorischen Motiven vorhanden ist, weil größere Nukleinsäuren im Inneren der Zelle zu Oligonukleotiden abgebaut werden. Bevorzugte synthetische Oligonukleotide umfassen kein CCGG-Quadmer oder nicht mehr als ein CCG- oder CGG-Trimer an oder nahe den 5'- und/oder 3'-Enden. Stabilisierte Oligonukleotide, wobei das Oligonukleotid eine Modifikation des Phosphat-Rückgrats aufweist, wie unten detaillierter diskutiert wird, sind ebenfalls bevorzugt. Die Modifikation kann z. B. eine Phosphothioat- oder Phosphodithioat-Modifikation sein. Die Modifikation des Phosphatrückgrats tritt bevorzugterweise am 5'-Ende der Nukleinsäure, z. B. bei den ersten zwei Nukleotiden des 5'-Endes des Oligonukleotides auf. Weiterhin kann die Modifikation des Phosphat-Rückgrates am 3'-Ende der Nukleinsäure auftreten, z. B. bei den letzten fünf Nukleotiden des 3'-Endes der Nukleinsäure. Alternativ kann das Oligonukleotid vollständig oder teilweise modifiziert sein.

Bevorzugterweise weist das CpG-Oligonukleotid eine Größe im Bereich zwischen 8 und 100 und bevorzugtererweise zwischen 8 und 30 Nukleotiden auf. Alternativ können CpG-Oligonukleotide im großen Maßstab als Plasmide hergestellt werden und zu Oligonukleotiden abgebaut werden.

Das CpG-Oligonukleotid und das immunpotenzierende Cytokin können dem Patienten direkt verabreicht oder zusammen mit einem Nukleinsäure-Abgabekomplex verabreicht werden. Ein "Nukleinsäure/Cytokin-Abgabekomplex" soll ein Nukleinsäuremolekül und/oder ein Cytokin bedeuten, das (z. B. ionisch oder kovalent daran gebunden oder darin eingekapselt) mit einem Zielmittel (z. B. ein Molekül, das zu einer höheren Bindungsaffinität zu einer Zielzelle (z. B. dendritische Zelloberflächen und/oder zu erhöhter zellulärer Aufnahme durch die Zielzellen führt) verbunden ist. Beispiele für Nukleinsäure-/Cytokin-Abgabekomplexe umfassen Nukleinsäuren/Cytokine, die verbunden sind mit: einem Sterol (z. B. Cholesterin), einem Lipid (z. B. ein kationisches Lipid, Virosom oder Liposom) oder einem zielzellenspezifischen Bindungsagens (z. B. ein Ligand, der von einem zielzellenspezifischen Rezeptor erkannt wird). Bevorzugte Komplexe sollten in vivo ausreichend stabil sein, um eine erhebliche Trennung vor der Internalisierung durch die Zielzelle zu verhindern. Jedoch sollte der Komplex unter geeigneten Bedingungen im Inneren der Zelle spaltbar sein, so dass die Nukleinsäure/das Cytokin in einer funktionellen Form freigesetzt wird.

Eine "palindromische Sequenz" soll eine seitenverkehrte Wiederholung bedeuten (d. h. eine Sequenz wie beispielsweise ABCDEE'D'C'B'A', bei der A und A' Basen sind, die gewöhnliche Watson-Crick-Basenpaare zu bilden in der Lage sind). Solche Sequenzen können in vivo doppelsträngige Strukturen bilden. In einer Ausführungsform enthält das CpG-Oligonukleotid eine palindromische Sequenz. Eine palindromische Sequenz, die in diesem Zusammenhang verwendet wird, bezeichnet ein Palindrom, bei dem das CpG Teil des Palindroms ist und bevorzugterweise das Zentrum des Palindroms darstellt. In einer weiteren Ausführungsform enthält das CpG-Oligonukleotid kein Palindrom. Ein CpG-Oligonukleotid, das kein Palindrom enthält, ist ein CpG-Oligonukleotid, bei dem das CpG-Dinukleotid nicht Teil eines Palindroms ist. Ein solches Oligonukleotid kann ein Palindrom umfassen, bei dem das CpG nicht Teil des Palindroms ist.

Ein "stabilisiertes Nukleinsäuremolekül" soll ein Nukleinsäuremolekül bedeuten, das relativ resistent gegen den Abbau (z. B. durch eine Exo- oder Endonuklease) in vivo ist. Die Stabilisierung kann eine Funktion der Länge oder der Sekundärstruktur sein. Unmethylierte CpG-Oligonukleotide, die mehrere zehn bis hundert kb lang sind, sind gegen in vivo-Abbau relativ resistent. Bei kürzeren CpG-Oligonukleotiden kann die Sekundärstruktur stabilisieren und die Wirkung der Oligonukleotide erhöhen. Wenn z. B. das 3'-Ende eines Oligonukleotides selbst komplementär zu einer stromaufwärtigen Region des gleichen Moleküls ist, so dass es rückfalten und eine Art Stem-Loop-Struktur bilden kann, dann wird das Oligonukleotid stabilisiert und zeigt deshalb mehr Aktivität.

Bevorzugte stabilisierte Oligonukleotide der vorliegenden Erfindung weisen ein modifiziertes Rückgrat auf. Es wurde gezeigt, dass die Modifikation des Oligonukleotidrückgrats eine erhöhte Aktivität des CpG-Oligonukleotides bereitstellt, wenn es in vivo verabreicht wird. CpG-Konstrukte, die mindestens zwei Phosphothioat-Verbindungen am 5'-Ende des Oligonukleotides und mehreren Phosphothioat-Verbindungen am 3'-Ende, bevorzugterweise fünf, umfassen, stellen die maximale Aktivität bereit und schützten das Oligonukleotid vor dem Abbau durch intrazelluläre Exo- und Endonukleasen. Weitere modifizierte Oligonukleotid umfassen Phosphodiester-modifizierte Oligonukleotide, Kombinationen von Phosphodiester- und Phosphothioat-Oligonukleotiden, Methylphosphonat, Methylphosphothioat, Phosphodithioat und Kombinationen davon. Jede dieser Kombinationen und ihre besonderen Wirkungen auf Immunzellen sind detaillierter in WO 98/18810 diskutiert. Man glaubt, dass diese modifizierten Oligonukleotide aufgrund von erhöhter Nukleaseresistenz, erhöhter zellulärer Aufnahme, erhöhter Proteinbindung und/oder veränderter intrazellulärer Lokalisierung mehr stimulatorische Aktivität zeigen können.

Sowohl Phosphothioat- als auch Phosphodiester-Oligonukleotide, die CpG-Motive enthalten, sind in APCs wie beispielsweise dendritischen Zellen aktiv. Auf der Grundlage der Konzentration, die benötigt wird, um CpG-spezifische Wirkungen zu induzieren, sind die CpG-Oligonukleotide mit nukleaseresistentem Phosphothioat-Rückgrat wirksamer (2 &mgr;g/ml beim Phosphothioat gegenüber einer Gesamtmenge von 90 &mgr;g/ml beim Phosphodiester).

Andere stabilisierte Oligonukleotide umfassen: nichtionische DNA-Analoga wie beispielsweise Alkyl- und Arylphosphate (bei denen der geladene Phosphonatsauerstoff durch eine Alkyl- oder Arylgruppe ersetzt ist), Phosphodiester und Alkylphosphotriester, bei denen der geladene Sauerstoffrest alkyliert ist. Es wurde auch gezeigt, dass Oligonukleotide mit einem Diol wie beispielsweise Tetraethylenglycol oder Hexaethylenglycol an einem oder beiden Enden im Wesentlichen resistent gegen Nukleaseabbau sind.

Die Nukleinsäuresequenzen der Erfindung, die zum Induzieren des Umbaus des Immunsystems nützlich sind, sind diejenigen, die oben breit beschrieben sind und in WO 98 18810 breit offenbart sind. Beispielhafte Sequenzen umfassen, sind aber nicht beschränkt auf diejenigen immunstimulatorischen Sequenzen, die in Tabelle 1 gezeigt sind, genauso wie auf

Der Stimulierungsindex einer bestimmten immunstimulatorischen CpG-DNA kann mit verschiedenen Immunzelltests untersucht werden. Bevorzugterweise beträgt der Stimulierungsindex der immunstimulatorischen CpG-DNA bezüglich der B-Zellproliferation mindestens ungefähr 5, bevorzugter mindestens ungefähr 10, bevorzugterer mindestens ungefähr 15 und am bevorzugtesten mindestens ungefähr 20, wie durch den Einbau von 3H-Uridin in einer murinen B-Zellkultur bestimmt wurde, die 20 Std. lang bei 37°C mit 20 &mgr;M Oligonukleotiden kontaktiert, mit 1 &mgr;Ci 3H-Uridin gepulst und 4 Std. später geerntet und gezählt wurde, wie es detailliert in der gleichzeitig anhängigen PCT-Patentanmeldung mit der US-Seriennummer 08/960,774 beschrieben ist. Für die Verwendung in vivo, beispielsweise um eine Defizienz des Immunsystems durch das Stimulieren einer zellvermittelten (lokalen) Immunantwort bei einem Patienten zu stimulieren, ist es wichtig, dass die immunstimulatorische CpG-DNA in der Lage ist, die Cytokinsekretion durch APCs wie beispielsweise dendritische Zellen, wirksam zu induzieren.

Bevorzugte immunstimulatorische CpG-Nukleinsäuren sollten abhängig von der therapeutischen Indikation eine Wirkung von mindestens ungefähr 500 pg/ml TNF-&agr;, 15 pg/ml IFN-&ggr;, 70 pg/ml GM-CSF, 275 pg/ml IL-6, 200 pg/ml IL-12 haben, wie durch die Tests bestimmt wird, die in den Beispielen beschrieben sind. Andere bevorzugte immunstimulatorische CpG-DNAs sollten die Wirkung einer mindestens 10 %-igen, bevorzugter mindestens etwa 15 %-igen und am bevorzugtesten mindestens ungefähr 20 %-igen YAC-1-T-Zell-spezifischen Lyse oder die einer mindestens ungefähr 30, bevorzugt mindestens ungefähr 35 und am bevorzugtesten mindestens ungefähr 40 %-igen 2C11-Zellspezifischen Lyse haben. Wenn sie zusammen mit einem immunpotenzierenden Cytokin verabreicht werden, werden die Mengen von sowohl dem CpG-Oligonukleotid als auch dem Cytokin, die benötigt werden, um eine erwünschte Immunantwort zu bewirken, geringer sein.

Bevorzugterweise beträgt der Stimulierungsindex des CpG-Oligonukleotids bezüglich der B-Zellproliferation mindestens ungefähr 5, bevorzugt mindestens ungefähr 10, bevorzugter mindestens ungefähr 15 und am bevorzugtesten mindestens ungefähr 20, wie durch den Einbau von 3H-Uridin in einer murinen B-Zellkultur bestimmt wurde, die 20 Std. lang bei 37°C mit 20 &mgr;M Oligonukleotid kontaktiert, mit 1 &mgr;Ci 3H-Uridin gepulst und 4 Std. später geerntet und gezählt wurde, wie detailliert in den gleichzeitig anhängigen veröffentlichten PCT-Patentanmeldungen beschrieben ist, die die Priorität der US-Seriennummern 08/738,652 bzw. 08/960,774 beansprucht, die am 30. Oktober 1996 bzw. am 30. Oktober 1997 eingereicht wurden. Zur Verwendung in vivo ist es z. B. wichtig, dass das CpG-Oligonukleotid und das Cytokin in der Lage sind, die Aktivierung von APCs, wie beispielsweise dendritischen Zellen, wirksam zu induzieren. Oligonukleotide, die dies bewirken können, sind zum Beispiel diejenigen Oligonukleotide, die in WO 9818810 beschrieben sind.

CpG-Oligonukleotide und immunpotenzierende Cytokine können einem Patienten vor der Verabreichung eines Antigens alleine verabreicht werden. Die Oligonukleotide und Cytokine können an einen Patienten auch zusammen mit einem Antigen verabreicht werden, um eine unmittelbare, antigenspezifische Antwort bereitzustellen. Ein zweites Antigen, das bezogen auf das erste Antigen das gleiche oder ein unterschiedliches Antigen sein kann, kann anschließend zu einem Zeitpunkt nach der Verabreichung des CpG und des immunpotenzierenden Cytokins bei Anwesenheit oder Abwesenheit von zusätzlichem CpG und Cytokin an den Patienten verabreicht werden. Der Begriff „zusammen mit" bezeichnet die Verabreichung von dem CpG-Oligonukleotid und dem immunpotenzierenden Cytokin kurz vor oder kurz nach oder gleichzeitig mit dem Antigen. Die Begriffe kurz vor und kurz nach bedeuten eine Zeitspanne von 24 Stunden und bevorzugterweise 12 Stunden. Das CpG und das Cytokin werden zusammen miteinander verabreicht und können somit auch zusammen oder getrennt verabreicht werden.

Wenn das CpG-Oligonukleotid und das immunpotenzierende Cytokin zusammen mit einem ersten Antigen verabreicht werden, wird das erste Antigen die Spezifität der unmittelbaren Immunantwort bestimmen. Das CpG-Oligonukleotid und das immunpotenzierende Cytokin wirken als ein wirksames „Gefahrensignal" und bewirken, dass das Immunsystem stark auf neue Antigene aus der Umgebung antwortet. Dieser Wirkungsmodus ist vermutlich primär die Folge von stimulatorischen lokalen Wirkungen des CpG-Oligonukleotides und des immunopotenzierenden Cytokins auf dendritische Zellen und auf andere „professionelle" antigenpräsentierende Zellen, genauso wie von den co-stimulatorischen Wirkungen auf B-Zellen. Diese Wirkung tritt unmittelbar nach der Verabreichung des CpG-Oligonukleotides auf.

Zur Verwendung bei einer Therapie kann eine wirksame Menge eines geeigneten CpG-Oligonukleotides und eines geeigneten immunpotenzierenden Cytokins alleine oder formuliert in der Form eines Nukleinsäure/Cytokin-Abgabekomplexes an den Patienten durch jeden Modus verabreicht werden, der erlaubt, dass das Oligonukleotid von den geeigneten Zielzellen (z. B. dendritischen Zellen) aufgenommen wird. Bevorzugte Verabreichungswege umfassen, sind aber nicht beschränkt auf oral, transdermal (z. B. über ein Pflaster), Injektion (subkutan, intravenös, parenteral, intraperitoneal, intrathekal, etc.), intranasal, intratracheal und mukosal. Eine Injektion kann in der Form einer Bolus- oder in der Form einer kontinuierlichen Infusion stattfinden.

Der Begriff „wirksame Menge" eines CpG-Oligonukleotides bedeutet die Menge, die notwendig oder ausreichend ist, um eine erwünschte biologische Wirkung zu verwirklichen. Zum Beispiel könnte eine wirksame Menge eines Oligonukleotids, das mindestens ein unmethyliertes CpG enthält, zur Behandlung einer Defizienz des Immunsystems die Menge sein, die notwendig ist, um die Aktivierung des Immunsystems zu bewirken, die das Ergebnis der Entwicklung einer antigenspezifischen Immunantwort nach Exponierung gegenüber dem Antigen ist. Eine wirksame Menge ist, wie hierin verwendet, eine Menge, die eine synergistische Immunantwort bewirkt. Eine synergistische Menge ist die Menge, die eine Immunantwort gegen ein spezifisches Antigen bewirkt, die größer als die Summe der einzelnen Wirkungen ist, die entweder das CpG oder das Cytokins allein hat.

Die wirksame Menge für eine bestimmte Anwendung kann von solchen Faktoren wie der zu behandelt werdende Krankheit oder dem behandelt werdenden Zustand, dem speziellen verabreichten CpG-Oligonukleotid/Cytokin (z. B. die Zahl der unmethylierten CpG-Motive oder ihre Position auf der Nukleinsäure), der Größe des Patienten oder der Schwere der Krankheit oder des Zustandes abhängen. Ein Fachmann auf dem Gebiet kann die wirksame Menge eines bestimmten Oligonukleotides/Cytokins empirisch bestimmen, ohne dass unangemessene Experimente notwendig sind.

Eine andere Verwendung eines CpG-Oligonukleotides in Kombination mit einem immunpotenzierenden Cytokin ist die Durchführung eines Verfahrens zur Empfnängnisverhütung zur Verwendung bei einem Patienten. In dieser besonderen Ausführungsform ist der Patient bevorzugterweise ein Säugetier und bevorzugterweise kein Mensch. Die Hoden und Ovarien sind „immunprivilegiert", d. h. dass sie anatomisch vom Immunsystem getrennt sind. Zusätzlich können Zellen in den Hoden und den Ovarien den Fas-Liganden exprimieren, der bei aktivierten T-Zellen Apoptose induziert. Die körperliche Trennung und die Expression des Fas-Liganden verhindern beide eine Immunantwort gegen die Zellen in den Hoden und Ovarien. Das zusammen mit einem immunpotenzierenden Cytokin verwendete CpG-Oligonukleotid kann verwendet werden, um die Zellen in den Hoden oder Ovarien zu eliminieren oder wesentlich zu verringern, indem das Immunprivileg der Zellen durchbrochen wird, wodurch ein empfängnisverhütendes Mittel bereitgestellt wird. Ein CpG-Oligonukleotid kann zusammen mit einem immunpotenzierenden Cytokin verwendet werden, um das Immunprivileg der Zellen der Hoden und der Ovarien zu durchbrechen.

Das Verfahren wird durch das Verabreichen eines Antigens, eines immunpotenzierenden Cytokins und eines immunstimulatorischen CpG-Oligonukleotides an den Patienten bewerkstelligt, wobei das Antigen ein Antigen ist, das aus der Gruppe gewählt ist, die aus einem Gonadenzellenantigen und einem Antigen aus einem Cytokin oder Hormon besteht, das für die Erhaltung einer Gonadenzelle benötigt wird. Ein „Gonadenzellantigen" ist, wie hierin verwendet, ein Antigen auf der Oberfläche einer Gonadenzelle, z. B. einer Hoden- oder Ovarienzelle. Solche Antigene sind Fachleuten auf dem Gebiet wohlbekannt. Antigene von einem Cytokin oder Hormon, das für die Erhaltung einer Gonadenzelle benötigt wird, sind auf dem Gebiet ebenfalls wohlbekannt. Diese Antigene werden eine Immunantwort gegen das Cytokin oder das Hormon bewirken, und somit einen Verlust der Gonadenzellen bewirken.

Die CpG-Oligonukleotide werden in einem Aspekt der Erfindung verwendet, um die Aktivierung der Immunzellen und bevorzugterweise der APCs zu induzieren. Eine APC hat auf dem Gebiet eine übliche Bedeutung und umfasst z. B. dendritische Zellen wie beispielsweise unreife dendritische Zellen und Vorläufer- und Progenitor-dendritische Zellen, genauso wie reife dendritische Zellen, die in der Lage sind, Antigen aufzunehmen und zu exprimieren. Eine solche Population von APCs oder dendritischen Zellen wird als immunologisch aktivierte Population von APCs oder von dendritischen Zellen bezeichnet.

Dendritische Zellen bilden die Verbindung zwischen dem angeborenen und dem erworbenen Immunsystem, indem sie Antigene präsentieren, und genauso, indem sie Mustererkennungsrezeptoren exprimieren, die mikrobielle Moleküle wie LPS in ihrer lokalen Umgebung nachweisen. Die Kombination aus einem immunpotenzierenden Cytokin und einem CpG-Oligonukleotid zeigte eine Induktion eines Th1-spezifischen Antikörpers, während das immunpotenzierende Cytokin alleine nur die Herstellung eines Th2-spezifischen Antikörpers bewirkte. Da dendritische Zellen die Verbindung zwischen dem angeborenen und dem erworbenen Immunsystem bilden, unterstützt die Fähigkeit, dendritische Zellen mit einem CpG und einem immunpotenzierenden Cytokin zu unterstützen, die Verwendung von Strategien auf der Grundlage der Kombination von CpG und einem immunpotenzierenden Cytokin zur Immuntherapie von Störungen wie Krebs oder allergischen oder infektiösen Erkrankungen. Die Kombination von einem CpG und einem immunpotenzierenden Cytokin zeigt eine synergistische Aktivierung dendritischer Zellen.

Die Erfindung betrifft in einem Aspekt Verfahren und Produkte zum Aktivieren dendritischer Zellen für in vitro- und ex vivo-Zwecke. Es wurde gemäß der Erfindung gezeigt, dass die Kombination eines immunpotenzierenden Cytokins und eines CpG-Oligonukleotides einen wirksamen Aktivator dendritischer Zellen darstellt. Von dendritischen Zellen nimmt man an, dass sie für die Initiierung der primären Immunantworten bei Immunzellen in vivo wesentlich sind. Es wurde gemäß der Erfindung entdeckt, dass CpG-Oligonukleotide und immunpotenzierende Cytokine in der Lage waren, dendritische Zellen dahingehend zu aktivieren, dass sie, ähnlich wie ein Adjuvans, die primären Immunantworten in Zellen initiieren. Es wurde auch entdeckt, dass vorwiegend die Produktion von IgG2a und weniger die von IgG1 induziert ist, wenn die Kombination des CpG-Oligonukleotides und des immunpotenzierenden Cytokins verwendet wird, um dendritische Zellen zu aktivieren, was ihre Neigung anzeigt, die Entwicklung von Th1-Immunantworten in vivo zu verstärken. Diese Erkenntnisse zeigen die wirksame adjuvante Aktivität von CpG und stellen die Grundlage für die Verwendung von CpG-Nukleotiden als Immuntherapeutika bei der Behandlung von Störungen wie Krebs, infektiösen Erkrankungen und Allergien bereit. In einem Aspekt liefert die Erfindung ein Verfahren zum Aktivieren einer dendritischen Zelle durch das Kontaktieren der dendritischen Zelle, die gegenüber einem Antigen exponiert ist, mit einer wirksamen Menge eines immunpotenzierenden Cytokins und eines immunstimulatorischen CpG-Oligonukleotides zur synergistischen Aktivierung einer dendritischen Zelle.

Dendritische Zellen internalisieren, verarbeiten und präsentieren lösliche spezifische Antigene, gegenüber denen sie exponiert sind, effizient. Der Vorgang des Internalisierens und des Präsentierens von Antigen bewirkt eine schnelle Hochregulierung der Expression des Haupthistokompatibilitätskomplexes (MHC) und von co-stimulatorischen Molekülen, der Produktion von Cytokinen und der Migration in Richtung von lymphatischen Organen, wo sie, wie man annimmt, an der Aktivierung von T-Zellen beteiligt sind.

Eine spezifische Verwendung für die Kombination von einem CpG-Oligonukleotid und einem immunpotenzierenden Cytokin der Erfindung besteht darin, dendritische Zellen zu dem Zweck zu aktivieren, dass eine spezifische Immunantwort gegen Krebsantigene erhöht wird. Die Immunantwort kann unter Verwendung von ex vivo- oder in vivo-Techniken verstärkt werden. Ein „ex vivo"-Verfahren ist, wie hierin verwendet, ein Verfahren, zu dem das Isolieren einer dendritischen Zelle aus einem Patienten, die Manipulation der Zelle außerhalb des Körpers und das Reimplantieren der manipulierten Zelle in den Patienten gehören. Die ex vivo-Vorgehensweise kann bei autologen oder heterologen Zellen verwendet werden, wird aber bevorzugterweise bei autologen Zellen verwendet. In bevorzugten Ausführungsformen werden die dendritischen Zellen aus dem peripheren Blut oder aus dem Knochenmark isoliert, können aber aus jeder Quelle von dendritischen Zellen isoliert werden. Wenn die ex vivo-Vorgehensweise durchgeführt wird, um dendritische Zellen spezifisch zu produzieren, die aktiv gegen ein bestimmtes Krebs- oder eine andere Art von Antigen sind, können die dendritischen Zellen zusätzlich zu dem CpG und dem immunpotenzierenden Cytokin gegenüber dem Antigen exponiert werden. In anderen Fällen war die dendritische Zelle gegenüber dem Antigen möglicherweise schon exponiert, aber exprimiert das Antigen auf der Oberfläche möglicherweise nicht auf eine effiziente Weise. Alternativ kann die dendritische Zelle, gegenüber dem immunpotenzierenden Cytokin oder dem Antigen exponiert sein, entweder durch direkten Kontakt oder Exponierung im Körper, und anschließend wird die dendritische Zelle an den Körper zurückgegeben, und danach erfolgt die Verabreichung von CpG direkt an den Patienten, entweder systemisch oder lokal. Die Aktivierung wird das Verarbeiten des Antigens dramatisch erhöhen. Die aktivierte dendritische Zelle präsentiert das Krebsantigen dann auf ihrer Oberfläche. Wenn sie an den Patienten zurückgegeben wird, aktiviert die aktivierte dendritische Zelle, die das Krebsantigen exprimiert, in vivo T-Zellen, die hinsichtlich des Krebsantigens spezifisch sind. Die ex vivo-Manipulation von dendritischen Zellen zu den Zwecken der Krebsimmuntherapie wurde in verschiedenen Literaturstellen auf dem Gebiet beschrieben, die Engleman, E.G., 1997, Cytotechnology 25:1; Van Schonten W., et al., 1997, Molecular Medicine Today, Juni, 255; Steinman, R.M., 1996, Experimental Hematology, 24, 849; und Gluckman, J.C., 1997, Cytokines, Cellular and Molecular Therapy, 3:187 umfassen. Die ex vivo-Aktivierung dendritischer Zellen der Erfindung kann mit routinemäßigen Manipulierungsschritten ex vivo, die auf dem Gebiet bekannt sind, durchgeführt werden, aber unter Verwendung von einem CpG und einem immunpotenzierenden Cytokin als Aktivator.

Die dendritischen Zellen können auch unter Verwendung von in vivo-Verfahren mit CpG und immunpotenzierendem Cytokin kontaktiert werden. Um dieses zu erreichen, werden das CpG und das immunpotenzierende Cytokin direkt an einen Patient verabreicht, der eine Immuntherapie benötigt. Das CpG und das immunpotenzierende Cytokin können in Kombination mit einem Antigen oder alleine verabreicht werden. In einigen Ausführungsformen wird bevorzugt, dass das CpG und das immunpotenzierende Cytokin in den lokalen Bereich des Tumors verabreicht werden, was auf jede auf dem Gebiet bekannte Weise erreicht werden kann, z. B. durch direkte Injektion in den Tumor, durch Implantate, die die Wirkstoffkombination freisetzen etc.

Dendritische Zellen, die gemäß der Erfindung nützlich sind, können aus jeder Quelle isoliert sein, solange die Zelle in der Lage ist, durch CpG und Cytokin in der Weise aktiviert zu werden, dass sie eine aktive antigenexprimierende dendritische Zelle hervorbringt. Mehrere in vivo-Quellen unreifer dendritischer Zellen können gemäß den Verfahren der Erfindung verwendet werden. Zum Beispiel sind sowohl dendritische Zellen aus dem Knochenmark als auch dendritische Zellen aus dem peripheren Blut hervorragende Quellen unreifer dendritischer Zellen, die durch CpG und Cytokin aktiviert werden. Andere Quellen können durch Fachleute auf dem Gebiet leicht bestimmt werden, ohne dass unangemessene Experimente nötig sind, z. B. durch das Isolieren einer primären Quelle dendritischer Zellen und durch das Testen der Aktivierung durch CpG in vitro. Die Erfindung umfasst auch die Verwendung von allen unreifen dendritischen Zellen, die in einer Kultur in der Form von einer Zellinie erhalten werden, solange die Zellen in der Lage sind, durch CpG und Cytokin aktiviert zu werden. Solche Zellarten können routinemäßig unter Verwendung von auf dem Gebiet bekannten Standardtests identifiziert werden.

Durch immunomagnetisches Zellsortieren isolierte dendritische Zellen des peripheren Blutes, die durch CpG und Cytokin aktiviert werden, stellen eine physiologischere Zellpopulation dendritischer Zellen dar als von Monozyten stammende dendritische Zellen. Unreife dendritische Zellen umfassen ungefähr 1-3% der Zellen im Knochenmark und im peripheren Blut ungefähr 10-100 mal weniger. Periphere Blutzellen können unter Verwendung von auf dem Gebiet wohlbekannten Vorrichtungen gewonnen werden, z. B. der Haemonetics Modell v. 50-Apheresevorrichtung (Haemonetics, Braintree, MA). Rote Blutzellen und Neutrophile werden aus dem Blut durch Zentrifugation entfernt. Die mononukleären Zellen, die an der Grenzfläche vorhanden sind, werden isoliert. Verfahren zum Isolieren von CD4+-dendritischen Zellen aus dem peripheren Blut wurden in O'Doherty U, et al. J Exp Med 1993; 178:1067-1076 beschrieben. Bei Anwesenheit von GM-CSF alleine differenzieren diese Zellen innerhalb von zwei Tagen unter Ablauf aller kennzeichnenden zellulären Vorgänge zu dendritischen Zellen. Die Differenzierung wird von einer Zunahme der Zellgröße, der Körnigkeit und der MHC-II-Expression begleitet, die unter Verwendung von Durchflusszytometrie leicht verfolgt werden kann. Frisch isolierte dendritische Zellen, die bei Abwesenheit von GM-CSF kultiviert werden, durchlaufen schnell die Apoptose. Auffallenderweise sind sowohl das Überleben und die Differenzierung der Zellen bei Anwesenheit von CpG-Oligonukleotiden ohne den Zusatz von GM-CSF im Vergleich zur Anwesenheit von GM-CSF deutlich verbessert. Bei Anwesenheit von CpG bilden dendritische Zellen Zellcluster, die kennzeichnende dichte multilamellare introcytoplasmatische Körper und multivesikuläre Strukturen zeigen, wenn sie mittels Ultrastrukturtechniken wie beispielsweise Elektronenmikroskopie untersucht werden, die nicht bei dendritischen Zellen vorhanden waren, die mit GM-CSF inkubiert worden waren. Die Untersuchung mit Rasterelektronenmikroskopie zeigte lange schleier- und blattartige Auswüchse, von denen man annimmt, dass sie für interzelluläre Wechselwirkungen verwendet werden, und eine unregelmäßige Zellform. Im Gegensatz dazu hatten Zellen, die mit GM-CSF inkubiert worden waren, eine runde Form und wiesen kaum zelluläre Auswüchse auf. Zusätzlich zum Fördern des Überlebens und der Differenzierung dendritischer Zellen führte eine einzelne Zugabe von CpG-Oligonukleotid zur Aktivierung, die durch die Hochregulierung der co-stimulatorischen Moleküle ICAM-1(CD54), B7-2(CD86) und CD40 gezeigt wurde. Die Kombination von CpG-Oligonukleotid und GM-CSF verstärkte die Expression von CD86 und CD40 synergistisch, was beweist, dass die Aktivierung nicht durch CpG-induziertes GM-CSF verursacht wird.

Verfahren zum Herstellen von immunstimulatorischen Nukleinsäuren

Zur Verwendung für die vorliegende Erfindung können Nukleinsäuren de novo unter Verwendung einer jeden aus einer Anzahl von Verfahrensweisen synthetisiert werden, die auf dem Gebiet wohlbekannt sind. Zum Beispiel das b-Cyanoethyl-Phosphoramidit-Verfahren (S.L. Beaucage and M.H. Caruthers, 1981, Tet. Let. 22:1859); das Nukleosid-H-Phosphonat-Verfahren (Garegg, et al., 1986, Tet. Let. 27:4051-4051; Froehler, et al., 1986, Nucl. Acid. Res. 14:5399-5407; Garegg, et al., 1986, Tet. Let. 27:4055-4058, Gaffney, et al., 1988, Tet. Let. 29:2619-2622). Diese Reaktionen können von einer Vielzahl von auf dem Markt erhältlichen automatischen Oligonukleotid-Syntheseapparaten ausgeführt werden. Alternativ können Oligonukleotide ausgehend von vorhandenen Nukleinsäuresequenzen (z. B. genomische oder cDNA) mit Hilfe von bekannten Techniken wie diejenigen, die von Restriktionsenzymen, Exonukleasen oder Endonukleasen Gebrauch machen, hergestellt werden.

Zur Verwendung in vivo sind Nukleinsäuren bevorzugterweise relativ resistent gegen Abbau (z. B. durch Endo- und Exonukleasen). Sekundärstrukturen wie Stem-loops können Nukleinsäuren gegen Abbau stabilisieren. Alternativ kann eine Nukleinsäurestabilisierung wie oben diskutiert durch Phosphat-Rückgrat-Modifikationen erreicht werden. Eine bevorzugte stabilisierte Nukleinsäure kann durch Phosphat-Rückgrat-Modifikation erhalten werden. Eine bevorzugte stabilisierte Nukleinsäure hat mindestens ein teilweise Phosphothioat-modifiziertes Rückgrat. Phosphothioate können unter Verwendung von automatisierten Techniken synthetisiert werden, die entweder von der Phosphoramidat- oder H-Phosphonat-Chemie Gebrauch machen. Aryl- und Alkyl-Phosphonate können z. B. wie in U.S. Patent Nr. 4,469,863 beschrieben hergestellt werden; und Alkylphosphotriester (bei denen der geladene Sauerstoffteil alkyliert ist, wie in U.S. Patent Nr. 5,023,243 und dem Europäischen Patent Nr. 092,574 beschrieben) können durch automatische Festphasensynthese unter Verwendung kommerziell erhältlicher Reagenzien hergestellt werden. Verfahren zum Ausbilden anderer DNA-Rückgrat-Modifikationen und -substitutionen sind beschrieben worden (Uhlmann, E. und Peyman, A. (1990) Chem. Rev. 90:544; Goodchild, J. (1990) Bioconjugate Chem. 1:165). 2'-O-Methyl-Nukleinsäuren mit CpG-Motiven verursachen ebenfalls eine Immunaktivierung, genauso wie Ethoxy-modifizierte CpG-Nukleinsäuren. Tatsächlich wurde keine Rückgrat-Modifikation gefunden, die die CpG-Wirkung vollständig aufhebt, auch wenn sie erheblich reduziert wird, wenn das C durch ein 5-Methyl-C ersetzt ist.

Zur Verabreichung in vivo können Nukleinsäuren mit einem Molekül verbunden sein, das zu einer höheren Bindungsaffinität an Zielzellen- (z. B. dendritischen Zellen)-Oberflächen und/oder einer erhöhten zellulären Aufnahme durch Zielzellen führt, um wie oben diskutiert einen „Nukleinsäure-Abgabekomplex" auszubilden. Nukleinsäuren können mit geeigneten Molekülen ionisch oder kovalent unter Verwendung von Techniken verbunden werden, die auf dem Gebiet wohlbekannt sind. Eine Vielzahl von Kopplungs- oder Vernetzungs-Reagenzien, wie z. B. Protein A, Carbodiimid und N-Succinimidyl-3-(2-pyridyldithio)propionat (SPDP) können verwendet werden. Alternativ können Nukleinsäuren in Liposomen oder Virosomen unter Verwendung von wohlbekannten Techniken eingekapselt werden.

Die Zusammensetzungen der Erfindung, die aktivierte dendritische Zellen, isolierte CpG-Nukleinsäuremoleküle, Cytokine und Mischungen davon umfassen, werden in pharmazeutisch akzeptablen Zusammensetzungen verabreicht. Wenn die Zusammensetzungen der Erfindung verabreicht werden, geschieht dies in pharmazeutisch akzeptablen Mengen. Solche Zubereitungen können routinemäßig Salz, puffernde Agenzien, Konservierungsmittel, kompatible Träger und optional andere therapeutische Agenzien enthalten. Wenn sie klinisch verwendet werden, sollten die Salze pharmazeutisch akzeptabel sein, aber nicht-pharmazeutisch akzeptable Salze können bequem verwendet werden, um pharmazeutisch akzeptable Salze davon herzustellen und sind aus dem Umfang der Erfindung nicht ausgeschlossen. Solche pharmakologisch und pharmazeutisch akzeptablen Salze umfassen, sind aber nicht beschränkt auf diejenigen, die aus den folgenden Säuren hergestellt werden können: Salzsäure, Bromwasserstoffsäure, Schwefelsäure, Salpetersäure, Phosphorsäure, Maleinsäure, Essigsäure, Salicylsäure, Zitronensäure, Ameisensäure, Malonsäure, Bernsteinsäure und dergleichen. Pharmazeutisch akzeptable Salze können auch als Alkalimetall- oder Erdalkalimetallsalze wie beispielsweise Natrium, Kalium oder Calciumsalze hergestellt werden. Wie hierin verwendet, bezeichnet eine Zusammensetzung eines CpG-Oligonukleotides und/oder eines immunpotenzierenden Cytokins die oben beschriebenen Verbindungen genauso wie die Salze davon.

Die Zusammensetzungen der Erfindung können optional mit einem pharmazeutisch akzeptablen Träger verbunden sein. Der Begriff "pharmazeutisch akzeptabler Träger" bedeutet, wie hierin verwendet, ein oder mehr als ein kompatibler fester oder flüssiger Füllstoff, Verdünnungsmittel oder einkapselnde Substanzen, die für die Verabreichung an einen Menschen oder ein anderes Tier geeignet sind. Der Begriff "Träger" bezeichnet einen organischen oder anorganischen Bestandteil, der natürlich oder synthetisch ist und mit dem der aktive Bestandteil verbunden ist, um die Anwendung zu erleichtern. Die Bestandteile der pharmazeutischen Zusammensetzungen sind auch in der Lage, mit den Molekülen der vorliegenden Erfindung und auch miteinander auf eine Weise zusammengemischt zu sein, dass es keine Wechselwirkung gibt, die die erwünschte pharmazeutische Wirkung wesentlich beeinträchtigen würde.

Die pharmazeutischen Zusammensetzungen können geeignete puffernde Agenzien enthalten, die folgende umfassen: Essigsäure in der Form von einem Salz, Zitronensäure in der Form von einem Salz, Borsäure in der Form von einem Salz und Phosphorsäure in der Form in einem Salz.

Die pharmazeutischen Zusammensetzungen können optional auch geeignete Konservierungsmittel enthalten wie beispielsweise: Benzalkoniumchlorid, Chlorbutanol, Parabene und Thimerosal.

Zur parenteralen Verabreichung geeignete Zusammensetzungen umfassen bequemerweise eine sterile wässrige Zubereitung der Zusammensetzungen der Erfindung, die bevorzugterweise hinsichtlich des Blutes des Empfängers isotonisch ist. Diese wässrige Zubereitung kann gemäß bekannter Verfahren unter Verwendung von geeigneten dispergierenden, befeuchtenden und suspendierenden Agenzien formuliert sein. Die sterile, injizierbare Zubereitung kann auch eine sterile, injizierbare Lösung oder Suspension in einem nicht-toxischen parenteral akzeptablen Verdünnungsmittel oder Lösungsmittel sein, z. B. in der Form von einer Lösung in 1,3-Butandiol. Zu den akzeptablen Vehikeln und Lösungsmitteln, die verwendet werden können, zählen Wasser, Ringerlösung und isotonische Natriumchlorid-Lösung. Zusätzlich werden sterile fette Öle herkömmlicherweise als Lösungsmittel oder suspendierendes Medium verwendet. Zu diesem Zweck kann jedes milde fette Öl verwendet werden, einschließlich synthetischer Mono- oder Diglyceride. Zusätzlich können Fettsäuren, wie beispielsweise Ölsäure bei der Herstellung von Mitteln zur Injektion verwendet werden. Trägerformulierungen, die für orale, subkutane, intravenöse, intramuskuläre, etc. Verabreichungen geeignet sind, können in Remington's Pharmaceutical Sciences, Mack Publishing Comonomer., Easton, PA, gefunden werden.

Eine Vielzahl von Verabreichungswegen sind verfügbar. Der spezielle ausgewählte Modus wird natürlich von der speziellen Zusammensetzung, die gewählt ist, der Schwere des Zustandes, der behandelt wird, und der für die therapeutische Wirksamkeit erforderlichen Dosierung abhängen. Allgemein ausgedrückt können die Verfahren der Erfindung unter Verwendung jedes Verabreichungsmodus, der medizinisch akzeptabel ist, praktiziert werden; dies bedeutet jeder Modus, der wirksame Konzentrationen der aktiven Verbindungen bewirkt, ohne klinisch inakzeptable schädliche Wirkungen zu verursachen. Solche Verabreichungsmodi umfassen orale, rektale, topicale, nasale, intradermale oder parenterale Wege. Der Begriff "parenteral" umfasst subkutan, intravenös, intramuskulär oder Infusion. Intravenöse oder intramuskuläre Verabreichungswege sind für eine langandauernde Behandlung und Prophylaxe nicht besonders geeignet. Sie könnten jedoch in Notfallsituationen bevorzugt sein. Für eine prophylaktische Behandlung wird die orale Verabreichung wegen der Bequemlichkeit für den Patienten sowie wegen des Dosierungsschemas bevorzugt sein.

Die Zusammensetzungen können bequem in der Form von Einheitsdosierungen dargeboten werden und können durch jedes der Verfahren, die auf dem Gebiet der Pharmazie wohlbekannt sind, zubereitet werden. Alle Verfahren umfassen den Schritt, bei dem die Zusammensetzungen der Erfindung in Verbindung mit einem Träger gebracht werden, der einen oder mehr als einen zusätzlichen Bestandteil darstellt. Allgemein werden die Zusammensetzungen dadurch hergestellt, dass die Zusammensetzungen der Erfindung gleichmäßig und eng mit einem flüssigen Träger, einem feinen zerteilten festen Träger oder beidem in Verbindung gebracht werden und dem Produkt anschließend, wenn nötig, eine Form verliehen wird.

Zusammensetzungen, die zur oralen Verabreichung geeignet sind, können als getrennte Einheiten, wie beispielsweise als Kapseln, Tabletten oder Pastillen, dargeboten werden, von denen jede eine vorbestimmte Menge der Zusammensetzungen der Erfindung enthalten. Andere Zusammensetzungen umfassen Suspensionen in wässrigen Lösungen oder nicht-wässrigen Lösungen wie beispielsweise einen Sirup, ein Elixier oder eine Emulsion.

Andere Abgabesysteme können solche mit zeitabhängiger Freisetzung, verzögerter Freisetzung oder fortwährender Freisetzung umfassen. Solche Systeme können wiederholte Verabreichungen der Zusammensetzungen der Erfindung, die oben beschrieben sind, vermeiden, was die Bequemlichkeit für den Patient und den Arzt erhöht. Viele Arten von Freisetzungs-Abgabesystemen sind verfügbar und den Fachleuten auf dem Gebiet bekannt. Sie umfassen auf Polymeren basierende Systeme wie Poly(Lactid-Glycolid), Copolyoxalate, Polycaprolactone, Polyesteramide, Polyorthoester, Polyhydroxybutansäure und Polyanhydride. Mikrokapseln der vorstehenden Polymere, die Wirkstoffe enthalten, sind z. B. im US-Patent 5,075,109 beschrieben. Abgabesysteme umfassen auch Nicht-Polymersysteme, die die folgenden sind: Lipide, die Sterole wie beispielsweise Cholesterin, Cholesterinester und Fettsäuren oder Neutralfette wie beispielsweise Mono-, Di- und Triglyceride umfassen; Hydrogel-Freisetzungssysteme; Polydimethylsiloxan-Systeme; peptidbasierte Systeme; Wachsbeschichtungen; komprimierte Tabletten unter Verwendung von konventionellen Bindern und Bindemitteln; teilweise fusionierte Implantate und dergleichen. Spezifische Beispiele umfassen, sind aber nicht beschränkt auf (a) Erosionssysteme, bei denen die Zusammensetzungen der Erfindung in einer Form innerhalb einer Matrix enthalten ist, wie beispielsweise dem in den US-Patenten Nr. 4,452775, 4,667,014, 4,748,034 und 5,239,660 beschriebenen und (b) Diffusionssysteme, bei denen ein aktiver Bestandteil mit einer gesteuerten Geschwindigkeit aus einem Polymer austritt, wie es in den US-Patenten Nr. 3,832,253 und 3,854,480 beschrieben ist. Zusätzlich können Abgabesysteme, die auf Pumpen basieren, verwendet werden, von denen einige für die Implantation angepasst sind.

Die Verwendung eines Implantates mit langanhaltender Freisetzung kann für die Behandlung von chronischen Zuständen besonders geeignet sein. Langanhaltende Freisetzung, wie hierin verwendet, bedeutet, dass das Implantat für die Abgabe therapeutischer Konzentrationen des aktiven Bestandteils über wenigstens 30 Tage und bevorzugterweise 60 Tage konstruiert und angepasst ist. Implantate zur langanhaltenden Freisetzung sind den Fachleuten auf dem Gebiet wohlbekannt und umfassen einige der oben beschriebenen Freisetzungssysteme.

Beispiele Beispeil 1: Materialien und Methoden

Tumormodell und Tumorantigene: Das 38C13 murine B-Zell-Lymphom-Modell wurde in Studien zur antikörperbasierten Therapie und aktiven Immunisierung von Lymphomen umfangreich verwendet (Kwak, L.W., et al., Proc Natl Acad Sci U.S.A. 93:10972-7, 1996). Der Idiotyp (Id) des 38C13-Oberflächen-IgM dient als hochspezifisches tumorverbundenes Antigen (Berman, Y., and Haimovich, J., Eur J Immunol 7:413-7, 1977). Id wurde wie beschrieben (Eshhar, Z., et al., Immunol 122:2430, 1979) aus dem Überstand einer Zellinie gewonnen, die 38C13-IgM sekretiert (Eshhar, Z., et al., J Immunol 122:2430, 1979) und durch Protein-A-Affinitäts-Chromatographie aufgereinigt. Gereinigtes Id wurde unter Verwendung von Glutaraldehyd an Schlüsselloch-Nacktschnecken-Hämocyanin (KLH) gekoppelt und als das Immunogen verwendet. Die Zellinie, die 38C13 Id/murines GM-CSF-Fusionsprotein herstellt, wurde feundlicherweise von Dr. Ronald Levy bereitgestellt. Diese Zellinie wurde in einem Hohlfaser-Reaktor (Unisyn Technologies, Hopkinton, MA) kultiviert, und das erhaltene Fusionsprotein wurde durch Protein-A-Affinitäts-Chromatogaphie erhalten. Das Fusionsprotein besteht aus den variablen Regionen der schweren und leichten Kette von 38C13-Id, den konstanten Regionen der schweren und leichten Kette des menschlichen IgG1 und aus murinen GM-CSF-Sequenzen (Tao, M.H., und Levy, R., Nature 362:755-758, 1993). Die bifunktionale Reaktivität wurde vor der Verwendung durch ELISA bestätigt. Die Platten wurden mit anti-Id beschichtet, es wurden serienweise hergestellte Verdünnungen des Fusionsproteins hinzugefügt, und die Anwesenheit von gebundenen GM-CSF-Teilen wurde durch das Sondieren mir anti-GM-CSF-Antikörpern abgeschätzt. Das 38C13-Id/menschliches GM-CSF-Fusionsprotein wurde auf eine ähnliche Weise erhalten und als eine Kontrolle verwendet.

Immunisierung: Zwei Phosphothioat-CpG-Oligonukleotide wurden im Handel erworben und unter GMP-Bedingungen hergestellt (Oligos Etc., Wilsonville, OR). Beide Oligonukleotidsequenzen zeigten bei allen Tests ähnliche Wirkungen. Wenn nichts anderes angegeben wurde, wurde das CpG-Oligonukleotid 1758 verwendet. Das Oligonukleotid 1758 wies die Sequenz TCTCCCAGCGTGCGCCAT (SEQ ID NO: 104) auf, und das Oligonukleotid 1826 wies die Sequenz TCCATGACGTTCCTGACGTT (SEQ ID NO: 3) auf.

Beide CpG-Oligonukleotide waren unmethyliert. Bei keinem der beiden CpG-Oligonukleotide war Endotoxin nachweisbar vorhanden, wie mit dem LAL-Test bestimmt. Frühere Studien zeigten, dass nicht-immunstimulatorisches Oligonukleotides eine geringe adjuvante Wirkung aufwies (Weiner, G.H., et al., Proc Natl Acad Sci U.S.A. 94:10833-10837, 1997), daher wurden nicht-immunstimulatorische Oligonukleotide nicht von den derzeitigen Studien umfasst. Murines GM-CSF zur in vitro-Herstellung von dendritischen Zellen wurde im Handel gekauft (PeproTech, Rocky Hill, NJ). GM-CSF für in vivo-Studien wurde freundlicherweise von Immunex (Seattle, WA) geliefert.

Weibliche C3H/HeN-Mäuse, die von Harlan-Sprague-Dawley erhalten wurden, wurden in den Tierställen der Universität Iowa gehalten und in einem Alter von 6-9 Wochen verwendet. Jede Maus wurde subkutan mit dem angegebenen Antigen und Adjuvans in einem Gesamtvolumen von 200 &mgr;l unter Verwendung von PBS als einem Vehikel immunisiert.

ELISA-Bestimmung der Anti-Id-Konzentrationen: Nach Betäubung durch Inhalieren mit Metophan wurde durch retroorbitale Punktierung aus den Mäusen Serum erhalten. Mikrotiter-Platten wurden über Nacht mit 5 &mgr;g/ml 38C13-IgM oder irrelevantem IgM beschichtet. IgM-beschichtete Platten wurden mit 5%iger Milch blockiert, und serienweise hergestellte Verdünnungen des Serums hinzugegeben. Als Standard diente Serum aus naiven Mäusen, zu dem eine bekannte Konzentration von monoklonalem anti-Id hinzugegeben wurde. Die Platten wurden gewaschen und hinsichtlich der schweren Kette spezifischer Ziegen-anti-Maus-IgG, -IgG1 oder -IgG2a (Southern Biotechnology Associates, Birmingham, AL), gefolgt von dem kolorimetrischen Substrat p-Nitrophenylphosphat, hinzugegeben. Die Platten wurden unter Verwendung eines Mikroplattenlesegerätes untersucht. Um die Konzentration des anti-Id zu bestimmen, wurden die Testkurven mit Standardkurven verglichen. Die Werte wurden nur als valide betrachtet, wenn die Standardkurven und die Kurven der Proben die gleiche Form aufwiesen. Die Reaktivität des Serums mit einer Kontrolle und irrelevanter muriner IgM wurden parallel untersucht und waren bei allen Tests negativ, was bestätigt, dass die Immunantwort nicht durch die Entwicklung einer isotypischen Antwort bewirkt wurde.

In vivo-Überlebensstudien: Drei Tage nach einer einzelnen subkutanen Immunisierung unter Verwendung des angegebenen Antigens und des angegebenen Adjuvans wurden die Mäuse i.p. mit 1.000 lebenden 38C13-Zellen inokuliert. Die Zellen wuchsen vor der Impfung mindestens 4 Tage lang in der Log-Phase. Mäuse, die einen Tumor entwickelten, zeigten inguinale und abdominale Gewebemengen, Ascites und Kachexie. Alle Mäuse, die einen Tumor entwickelten, starben. Das Überleben wurde bestimmt, und die Signifikanz hinsichtlich der Zeit bis zum Tod wurde unter Verwendung der Cox-Regressions-Analyse eingeschätzt. Zu statistischen Zwecken wurde Mäusen, die tumorfrei blieben, ein Überleben von 60 Tagen zugeordnet. Alle diese Mäuse blieben unbegrenzt tumorfrei und wurden mindestens 100 Tage lang überwacht.

Produktion und Stimulation dendritischer Zellen: Dendritische Zellen wurden unter Verwendung einer modifizierten Version des früher beschriebenen Ansatzes (Zitvogel, L., et al., J Exp Med 182:87-97, 1996; Mayordomo, J.I., et al., Nature Medicine 1:1297-302, 1995) erhalten. Kurz gesagt wurden Knochenmarkzellen durch das Spülen der Oberschenkelknochen und Schienbeine naiver, 6-8 Wochen alter C3H/HeN-Mäuse erhalten. Die roten Blutzellen wurden lysiert, und die T-Zellen wurden durch komplementvermittelte Lyse unter Verwendung einer Mischung von anti-CD3 (145.2C11), anti-CD4 (GD1.5) und anti-CD8 (53.6.7)-Antikörpern entfernt. Die B-Zellen wurden anschließend durch Schwenken unter Verwendung einer mit anti-B220-beschichteten Flasche entfernt. Den verbliebenen Zellen wurde über Nacht gestattet, zu adhärieren. Nicht-adhärierte Zellen wurden in mit 1000 U/ml GM-CSF und 1000 U/ml mulL-4 (PreproTech, Rocky Hill, NJ) bei einer Konzentration von 1,25 × 105 Zellen/ml kultiviert. Nach 4 Tagen wurden die Medien gewechselt, und die dendritischen Zellen wurden 7 Tage nach der Ernte des Knochenmarkes geerntet. Der Phänotyp und die Morphologie der dendritischen Zellen wurden unter Verwendung von einer Analyse mittels Durchflusszytometrie und Rasterelektronenmikroskopie bestätigt. Die dendritischen Zellen wurden gewaschen, gezählt und 1 × 105 wurden 18 Stunden lang in einem Gesamtvolumen von 200 &mgr;l mit Antigen bei einer Endkonzentration von 100 &mgr;g/ml und CpG-Oligonukleotid bei einer Endkonzentration von 50 &mgr;g/ml kultiviert. Bei der Messung der Cytokin-Konzentration wurden alle Proben vierfach gemessen. Der Überstand wurde gewonnen und durch ELISA hinsichtlich des Vorhandenseins von IL-6 und IL-12 wie beschrieben (Klinman, D.M., et al., Proc Natl Acad Sci U.S.A. 93:2879-83, 1996; Yi, A.K., et al., J Immunol 156:558-64, 1996) getestet.

BEISPIEL 2: CpG-OLIGONUKLEOTID VERSTÄRKT DIE ENTWICKLUNG EINER ANTIKÖRPER-ANTWORT AUF Id-KLH-IMMUNISIERUNG. WENN GM-CSF ALS ADJUVANS VERWENDET WIRD

Von CpG-Oligonukleotid ist bekannt, dass es die Produktion einer Reihe von Cytokinen, einschließlich GM-CSF (Krieg, A.M., Trends in Microbiology 4:73-6, 1996), durch APCs induziert. Um zu bestimmen, ob die Zugabe von CpG-Oligonukleotid zu GM-CSF die Immunantwort weiter verstärken würde, wurden die Mäuse mit einer subkutanen einzelnen Injektion von 50 &mgr;g Id-KLH in PBS, die in wässriger Lösung mit 50 &mgr;g CpG-Oligonukleotid, 10 &mgr;g GM-CSF oder einer Kombination von CpG-Oligonukleotid und GM-CSF gemischt war, immunisiert. Serum wurde wöchentlich erhalten und durch ELISA mit Hinblick auf das Vorhandensein von antigenspezifischem IgG (anti-Id-IgG) untersucht. Wie in 1 gezeigt, entwickelten Mäuse, die unter Verwendung sowohl des CpG-Oligonukleotides als auch von GM-CSF immunisiert wurden, die höchsten Konzentrationen anti-Id-IgG. Die Wirkung der beiden Adjuvanzien schien additiv zu sein.

Die Kombination von GM-CSF und CpG-Oligonukleotid könnte demnach eine Reihe verschiedener Schritte bei der Induktion der Immunantwort mit GM-CSF-erhöhender Antigenaufnahme verstärken, während CpG-Oligonukleotid die stromabwärtige Antwort verstärkt, die die Produktion von Cytokinen umfasst, die an der Effektorzellenaktivierung beteiligt sind. Zusätzlich trägt das CpG-Oligonukleotid dazu durch das synergistische Fördern der B-Zellen-Aktivierung durch den Antigenrezeptor und das dadurch bevorzugt ablaufende Aktivieren antigenspezifischer B-Zellen bei (Krieg, A.M., et al., Nature 374:546-9, 1995). Die oben gezeigten Daten zeigen, dass Immunisierungsstrategien, an denen die Kombination von GM-CSF und CpG-Oligonukleotid beteiligt ist, besonders wirksam sind. CpG-Oligonukleotid und lösliches GM-CSF waren hinsichtlich ihrer Fähigkeit, anti-Id-IgG nach der Immunisierung mit Id-KLH zu induzieren, lediglich additiv, was auf der geringen Halbwertzeit von murinem GM-CSF (Keda, E., et al., J Immunotherapy 20:180-93, 1997) beruht haben könnte.

BEISPIEL 3: NACH DER IMMUNISIERUNG MIT Id/GM-CSF-FUSIONSPROTEIN ERHÖHT CpG-OLIGONUKLEOTID DIE PRODUKTION VON ANTI-ID-ANTIKÖRPERN

Von dem aus den variablen Regionen von 38C13, den konstanten Regionen von menschlichem IgG und aus murinem GM-CSF (Id/GM-CSF) bestehenden Id/GM-CSF-Fusionsprotein wurde gezeigt, dass es ein hervorragendes Immunogen ist (Tao, M.H. und Levy, R., Nature 362: 755-758, 1993). Um zu untersuchen, ob CpG-Oligonukleotid die durch Id/GM-CSF induzierte spezifische Antikörperantwort weiter erhöhen kann, wurden Mäuse mit Id-KLH oder Id/GM-CSF mit und ohne CpG-Oligonukleotid als ein Adjuvans immunisiert. Es wurde wöchentlich Serum erhalten, und die anti-Id IgG-Konzentrationen wurden ebenfalls wöchentlich bestimmt. Bei keiner der Mäuse wurde eine Toxizität festgestellt. Wie in 2 gezeigt ist, erhöhte CpG-Oligonukleotid die Produktion von anti-Id-Antikörpern als Antwort auf Id/GM-CSF.

In einem getrennten Experiment wurden Mäuse am Tag 0 immunisiert und erhielten am Tag 14 eine Auffrischung mit dem gleichen Antigen und Adjuvans. Die Kombination von Id/GM-CSF und CpG-Oligonukleotid induzierte nach zwei Immunisierungen bemerkenswert hohe Konzentrationen des anti-Id IgG (3). Eine Woche nach der letzten Immunisierung erhaltenes Serum enthielt mehr als 2,5 mg/ml anti-Id IgG. Als eine Kontrolle umfassten die Experimente ein aus 38C13-Id und menschlichem GM-CSF (Id/GM-CSF) bestehendes Fusionsprotein, weil menschliches GM-CSF im murinen System nicht aktiv ist. Id/menschliches GM-CSF war bezüglich Id/GM-CSF identisch, abgesehen davon, dass die murinen GM-CSF-Sequenzen durch menschliche GM-CSF-Sequenzen ersetzt waren. Die Konzentrationen des nach der Immunisierung unter Verwendung von Id/menschlichem GM-CSF mit oder ohne CpG-Oligonukleotid produziertem anti-Id waren deutlich geringer als diejenigen, die nach Id/GM-CSF festgestellt wurden und ähnlich denjenigen, die mit Id-KLH festgestellt wurden, was zeigt, dass biologisch aktives GM-CSG für die beobachteten Wirkungen wichtig war.

BEISPIEL 4: CpG-OLIGONUKLEOTID ERHÖHT DIE PRODUKTION VON ANTIGENSPEZIFISCHEM ANTIKÖRPER VOM IgG2a-ISOTYP

Eine erhöhte IgG1-Produktion spiegelt eine Th2-Reaktion, wohingegen eine überwiegende IgG2a-Produktion eine Th1-Antwort anzeigt (Stevens, T.L., et al., Nature 334: 255-8, 1988). Darüber hinaus ist muriner IgG2a beim Vermitteln einer antikörperabhängigen zellulären Cytotoxizität wirksamer als muriner IgG, und monoklonaler IgG2a funktioniert als eine Reihe therapeutischer Antikörper zum Behandeln von Tumoren bei Mäusen besser als monoklonaler IgG mit der identischen variablen Region (Kaminski, M. S., J. Immunol. 136: 1123-1130, 1986). Hinsichtlich des anti-Id-IgG wurde eine Isotypenanalyse durchgeführt, und das Vorhandensein von anti-Id IgG1 und IgG2a wurde nach einer Immunisierung eingeschätzt (4). Die Immunisierung umfasste verschiedene Kombinationen von Id-KLH oder Id-GM-CSF mit GM-CSF oder CpG-Oligonukleotid. 4 Wochen nach einer einzelnen Immunisierung wurde eine Serumprobe gewonnen. CpG-Oligonukleotid induzierte im Vergleich zu den entsprechenden Bedingungen ohne CpG-Oligonukleotid eine erhöhte Produktion von anti-Id-IgG2a. Bei anderen Zeitpunkten wurden ähnliche IgG1/IgG2a-Verhältnisse festgestellt.

BEISPIEL 5: IMMUNISIERUNG UNTER VERWENDUNG VON CpG-OLIGONUKLEOTID UND ID/GM-CSF-FUSIONSPROTEIN FÖRDERT DEN SCHUTZ VON MÄUSEN VOR TUMORWACHSTUM

Um zu untersuchen, ob CpG-Oligonukleotid auch bei der Id-GM-CSF-Immunisierung als ein wirksames Adjuvans dienen kann, wurden Mäuse drei Tage nach einer einzelnen Immunisierung mit Id/GM-CSF und mit oder ohne CpG-Oligonukleotid einem Tumor ausgesetzt. Unter Verwendung dieses Zeitplanes war eine Immunisierung mit Id-KLH nur minimal wirksam. Die CpG-Oligonukleotide 1758 und 1826 waren bezüglich des Verlängerns des Überlebens gleichermassen wirksam, wenn sie alleine oder in Kombination mit Id/GM-CSF verwendet wurden. Die in 5 dargestellten Daten zeigen zusammen die Ergebnisse der mit den Oligonukleotiden 1758 und 1826 behandelten Mäuse. Alle Mäuse, die keine Immunisierung erhielten, sowie Mäuse, die ohne das Antigen mit CpG-Oligonukleotid behandelt wurden, entwickelten Tumore und starben innerhalb von 50 Tagen. Dreissig Prozent der mit I/GM-CSF alleine immunisierten Mäuse blieben von der Krankheit verschont, während 70% der mit Id/GM-CSF und CpG-Oligonukleotid immunisierten Gruppe von der Krankheit verschont blieben. Mit Id/GM-CSF und CpG-Oligonukleotid immunisierte Mäuse zeigten ein Überleben, das dem ohne Immunisierung oder bei Behandlung mit CpG-Oligonukleotid alleine festgestelltem Überleben statistisch überlegen war (P < 0,001). Der Unterschied zwischen denjenigen, die mit Id/GM-CSF alleine immunisiert waren, und denjenigen, die mit CpG-Oligonukleotid und Id/GM-CSF immunisiert waren, näherte sich der statistischen Signifikanz (P – 0,072).

In diesen Studien und den Studien aus Beispiel 5, wurden nach wiederholter Immunisierung mit Id/GM-CSF und CpG-Oligonukleotid bemerkenswerte anti-Id IgG-Konzentrationen erreicht. Das CpG-Oligonukleotid lenkte die Antwort unter allen untersuchten Bedigungen, die das Immunisieren mit löslichem GM-CSF und dem Id/GM-CSF-Fusionsprotein umfassen, zu einer IgGsa-Antwort um, was eine verstärkte Th1-Antwort nahelegt. Die unter Verwendung von diesem Ansatz vorgenommene Immunisierung wandelte sich nur 3 Tage nach der Immunisierung mit Id/GM-CSF und dem CpG-Oligonukleotid zu einem Schutz vor dem Tumorwachstum um. Diese ist unter den bis heute erschienenen Berichten der wirksamste Schutz bei diesem ausgiebig untersuchten Model.

BEISPIEL 6: WIRKUNGEN VON CpG-OLIGONUKLEOTID AUF DEN PHÄNOTYP DENDRITISCHER ZELLEN

Die synergistischen Wirkungen von CpG-Oligonukleotid und GM-CSF legten die Möglichkeit nahe, dass diese Agenzien zusammen die Expression von co-stimulatorischen Molekülen oder von MHC durch APCs erhöhen können. Die Expression dieser Moleküle durch aus dem Knochenmark stammende dendritische Zellen wurde untersucht. Die Durchflusszytometrieanalyse von mit Id/GM-CSF und/oder CpG-Oligonukleotid gepulsten dendritischen Zellen zeigt einen bescheidenen Anstieg der Expression von MHCs der Klassen I und II als Antwort auf die Kombination von Id/GM-CSF und CpG-Oligonukleotid. Der Grundspiegel der Expression von CD80 und CD86 war hoch und wurde durch Id/GM-CSF oder CpG-Oligonukleotid nicht erheblich verändert.

BEISPIEL 7: CpG-OLIGONUKLEOTID ERHÖHT DIE PRODUKTION VON IL-12 DURCH MIT Id/GM-CSF GEPULSTE DENDRITISCHE ZELLEN

Die verstärkte Th1-Antwort auf Antigen könnte durch die Fähigkeit von CpG-Oligonukleotid erklärt werden, die Produktion von IL-12 durch APCs wie beispielsweise dendritische Zellen zu erhöhen. Die Produktion von IL-12 durch aus dem Knochenmark stammende dendritische Zellen, die mit Antigen, einschließlich ID/GM-CSF, gepulst waren, wurde bei Anwesenheit von CpG-Oligonukleotid abgeschätzt. Wie in 7 dargestellt ist, erhöhte das Pulsen von dendritischen Zellen mit dem CpG-Oligonukleotid die Produktion von IL-12, vor allem, wenn die Zellen auch mit ID/GM-CSF gepulst wurden. Die IL-6-Produktion wurde durch das Hinzugeben von CpG-Oligonukleotid zu Id/GM-CSF ebenfalls erhöht, auch wenn die Wirkung weniger ausgeprägt war als bei IL-12. Der Einfluss von GM-CSF alleine auf die Produktion von Cytokinen durch dendritische Zellen wurde nicht untersucht, weil diese Zellen unter Verwendung von GM-CSF erzeugt worden waren. Die durch CpG-Oligonukleotid induzierte deutlich erhöhte Produktion von IL-12 durch dendritische Zellen könnte die erhöhte Th1-Antwort zumindest teilweise erklären.

BEISPIEL 8: IDENTIFIZIERUNG VON PHOSPHOTHIOAT-OLIGONUKLEOTID, DAS DIE SEKRETION VON MENSCHLICHEM IL-12 INDUZIERT

Die Fähigkeit eines CpG-Oligonukleotides, die Sekretion von IL-12 zu induzieren, ist ein gutes Maß für sein Potential als Adjuvans, insbesondere, was seine Fähigkeit angeht, eine Th1-Immunantwort zu induzieren, die stark von IL-12 abhängig ist. Daher wurde die Fähigkeit einer Reihe von Phosphothioat-Oligonukleotiden, die IL-12-Sekretion durch menschliche PBMC in vitro zu induzieren, untersucht (Tabelle 1). Diese Experimente zeigten, dass die meisten CpG-Oligonukleotide die IL-12-Sekretion in einigen menschlichen PBMC induzieren konnten (z.B. Expt. 1). Andere Spender reagierten jedoch nur auf einige CpG-Oligonukleotide (z.B. Expt. 2). Das Oligonukleotid 2006 war bei den meisten Patienten ein konsistenter Induktor der IL-12-Sekretion (Tabelle 2).

Tabelle 2 Induktion der Sekretion von menschlichem IL-12 durch Phosphothioat-CpG-Oligonukleotid
  • 1 PBMC wurden aus normalen Spendern gewonnen und über Ficoll abzentrifugiert, dann bei einer Konzentration von 106 Zellen/Reaktionsnapf in Mikrotiterplatten mit 96 Reaktionsnäpfen mit oder ohne die angegebenen Oligonukleotide kultiviert, die zu den Kulturen zu einer Konzentration von 6 &mgr;g/ml hinzugegeben wurden. Die Überstände wurden nach 24 h gewonnen und wie in den Verfahren beschrieben durch ELISA auf IL-12 untersucht. Für jedes Experiment, das für einen anderen Spender steht, wurde eine Standardkurve angefertigt.

BEISPIEL 9: CpG und GM-CSF erhöhen co-stimulatorische Moleküle auf DC in synergistischer Weise Verfahren

Nachweis von Endotozin Die Aktivität von LPS wurde durch die FDA unter Verwendung des Amöbozytenlysat (LAL)-Tests (EU/ml) standardisiert. Die untere Nachweisgrenze des LAL-Tests betrug 0,03 EU/ml (LAL-Test BioWhittaker, Walkersville, MD), wenn wir den Test durchführten. Die in unseren Studien verwendete LPS-Probe (aus Salmonella typhimurium, Sigma, Chemical Co., St. Louis, MO) wies eine Aktivität von 4,35 ng/EU auf. Bei den Oligonukleotiden konnte kein Endotoxin nachgewiesen werden (< 0,0075 EU/mg).

Ergebnisse

Eine Differenzierung der DC über die Kriterien der Morphologie und MHC II-Expression ist zur Induktion einer spezifischen Immunantwort durch DC nicht ausreichend. Eine funktionale Aktivierung der DC erfordert die Expression co-stimulatorischer Moleküle. Wir haben die Wirkung von CpG auf die Expression des interzellulären Anhaftungsmoleküls-1 (ICAM-1, CD54) und die der co-stimulatorischen Oberflächenmoleküle B7-2 (CD86) und CD40 untersucht. Zunächst interessierte uns, ob eine erhöhte Expression von MHC II auf DC (Differenzierung) mit der durch die CD54-Expression wiedergespiegelten Aktivierung korrelierte. Es konnte keine positive Korrelation festgestellt werden, was bestätigt, dass die Differenzierung nicht notwendigerweise mit der Aktivierung von DC verbunden ist (8). Die Expression der co-stimulatorischen Moleküle CD54 (9, Feld A), CD86 (9, Feld B) und CD40 (9, Feld C) wurde bei der Durchflusszytometrie durch die mittlere Fluoreszenzintensität (MFI) lebender DC quantifiziert. Bei allen Experimenten war CpC dem GMCSF beim Erhöhen der Expression co-stimulatorischer Moleküle überlegen. Im Vergleich zu der Probe, die nur Zellen enthielt, erhöhte das CpG-Oligonukleotid 2006 die Expression von CD54 (25,0 ± 5,7 gegen 7,0 ± 1,8; p = 0,02, n = 5), CD 86 (3,9 ± 0,8 gegen 1,6 ± 0,3; p = 0,01) und CD40 (3,5 ± 1,0 gegen 0,9 ± 0,1; p = 0,04, n = 4).

Die Kombination von GMCSF und 2006 zeigte bezüglich CD54 eine additive Wirkung (38,5 ± 7,9, p = 0,03: n = 5) und erhöhte die Expression von CD86 und CD40 synergistisch (CD86: 7,0 ± 1,6; p = 0,01; n = 5; CD40: 8,5 ± 1,0; p < 0,01; n = 4).

Die Spezifität wurde unter Verwendung von 2117 (methylierte Version von 2006) und 2078 (GpC-Version von 2080) untersucht. Das nicht-GpC-Oligonukleotid 2117 zeigte, wenn es mit GMCSF kombiniert wurde, keine synergistische Erhöhung der CD40-Expression.

Tabelle 1 – Sequenzen

Die vorstehende schriftliche Beschreibung wird als ausreichend erachtet, um einem Fachmann auf dem Gebiet zu erlauben, die Erfindung zu praktizieren.

SEQUENZPROTOKOLL


Anspruch[de]
Produkt zur Verwendung in der Therapie oder Prophylaxe, umfassend ein immunstimulatorisches CpG-Oligonukleotid, das eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen, und ein immunpotenzierendes Cytokin. Produkt nach Anspruch 1, worin das Cytokin aus der Gruppe ausgewählt ist, bestehend aus GM-CSF, IL-2, IL-3, IL-5, IL-12 und Interferon-&ggr;. Produkt nach Anspruch 1 oder 2, worin das Cytokin GM-CSF darstellt. Produkt nach einem der Ansprüche 1 bis 3, worin das immunpotenzierende Cytokin und das immunstimulatorische CpG-Oligonukleotid in einer einzelnen Zusammensetzung bereitgestellt werden, oder in getrennten Zusammensetzungen bereitgestellt werden. Produkt nach einem der Ansprüche 1 bis 4, worin G in der Formel: 5'X1CGX23 unmethyliert ist. Produkt nach einem der Ansprüche 1 bis 5, worin das immunstimulatorische CpG-Oligonukleotid eine Größe von 8 bis 100 Nukleotide aufweist. Produkt nach einem der Ansprüche 1 bis 6, worin das Cytokin in der Form von einem Antigen-Cytokin-Fusionsprotein vorliegt. Produkt nach Anspruch 7, worin das Antigen-Cytokin-Fusionsprotein ein Antigen-GM-CSF-Fusionsprotein darstellt. Produkt nach einem der Ansprüche 1-6, weiter umfassend ein Antigen. Produkt nach einem der Ansprüche 1-6, worin das Produkt kein Antigen umfasst und die genannte Anwendung in der Therapie oder Prophylaxe nicht die Anwendung eines verabreichten Antigens umfasst. Produkt nach Anspruch 9, worin das Antigen ein natürliches Pflanzen- oder ein natürliches Tierallergen darstellt. Produkt nach Anspruch 9, worin das genannte Antigen aus der Gruppe ausgewählt ist, bestehend aus einem Krebsantigen, einem mikrobiellen Antigen und einem Allergen. In-vitro-Verfahren zur Aktivierung einer dendritischen Zelle, umfassend:

Kontaktieren einer dendritischen Zelle, die gegenüber einem Antigen exponiert ist, mit einem immunpotenzierenden Cytokin, in einer wirksamen Menge zur synergistischen Aktivierung einer dendritischen Zelle, und einem immunstimulatorischen CpG-Oligonukleotid, das eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23 worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen.
Verfahren nach Anspruch 13, worin das Cytokin aus der Gruppe ausgewählt ist, bestehend aus GM-CSF, IL-2, IL-3, IL-5, IL-12 und Interferon-&ggr;. Verfahren nach Anspruch 13 oder 14, worin das Antigen ein Tumorantigen darstellt. Verfahren nach einem der Ansprüche 13-15, worin G in der Formel: 5'X1CGX23' unmethyliert ist. Verwendung eines Produkts nach einem der Ansprüche 1-10 oder 12 bei der Herstellung eines Arzneimittels zur Behandlung oder Prophylaxe einer neoplastischen Erkrankung. Verwendung eines Produkts nach einem der Ansprüche 1-10 oder 12 bei der Herstellung eines Arzneimittels zur Behandlung oder Prophylaxe einer infektiösen Erkrankung, bevorzugt einer Virusinfektion. Verwendung eines Produkts nach einem der Ansprüche 1-12 bei der Herstellung eines Arzneimittels zur Behandlung oder Prophylaxe einer allergischen Erkrankung. Verwendung eines Produkts nach einem der Ansprüche 1-12 bei der Herstellung eines Arzneimittels zur Behandlung von oder Prophylaxe gegen Asthma. Verwendung eines Produkts nach einem der Ansprüche 1-12 bei der Herstellung eines Arzneimittels zur Induktion einer synergistischen spezifischen Immunantwort auf ein Antigen. Verwendung eines Produkts nach einem der Ansprüche 1-12 bei der Herstellung eines Arzneimittels zur synergistischen Aktivierung einer dendritischen Zelle. Verwendung nach Anspruch 22, worin das Cytokin aus der Liste ausgewählt ist, bestehend aus GM-CSF, IL-4, TNF&agr;, Flt-3-Ligand, IL-3. Verwendung nach Anspruch 22 oder 23, worin die dendritische Zelle gegenüber einem Antigen exponiert wurde. Verwendung eines Produkts nach einem der Ansprüche 1 bis 10 zur Herstellung eines Arzneimittels zur Verabreichung an einen Tumor in einem Patienten mit einer neoplastischen Erkrankung. Verwendung eines Produkts nach einem der Ansprüche 1-8 bei der Herstellung eines Arzneimittels zur Behandlung von oder Prophylaxe bei Individuen, die gegenüber einem Antigen passiv exponiert sind. Verwendung eines Produkts nach einem der Ansprüche 1-8 bei der Herstellung eines Arzneimittels zur Verabreichung zusammen mit einem Antigen. Verwendung eines immunstimulatorischen CpG-Oligonukleotids, das eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen, zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunpotenzierenden Cytokin zur Stimulation einer Immunantwort bei einem Patienten. Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid zur Stimulation einer Immunantwort bei einem Patienten, wobei das genannte Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen. Verwendung nach Anspruch 28 oder 29, worin genanntes Arzneimittel zur Anwendung zusammen mit einem Antigen zur Stimulation einer Antigen-spezifischen Immunantwort bei genanntem Patienten bestimmt ist. Verwendung eines immunstimulatorischen CpG-Oligonukleotids, das eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen, zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunpotenzierenden Cytokin zur Behandlung oder Prävention einer neoplastischen Erkrankung bei einem Patienten. Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid zur Behandlung oder Prävention einer neoplastischen Erkrankung bei einem Patienten, wobei das genannte Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen. Verwendung eines immunstimulatorischen CpG-Oligonukleotids, das eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23 worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen, zur Herstellung eines Arzneimittels. zur Anwendung zusammen mit einem immunpotenzierenden Cytokin zur Behandlung oder Prävention einer infektiösen Erkrankung bei einem Patienten. Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid zur Behandlung oder Prävention einer infektiösen Erkrankung bei einem Patienten, wobei das genannte Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen. Verwendung eines immunstimulatorischen CpG-Oligonukleotids, das eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen, zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunpotenzierenden Cytokin zur Behandlung oder Prävention einer allergischen Erkrankung bei einem Patienten. Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid zur Behandlung oder Prävention einer allergischen Erkrankung bei einem Patienten, wobei das genannte Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen. Verwendung eines immunstimulatorischen CpG-Oligonukleotids, das eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen, zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunpotenzierenden Cytokin zur Behandlung oder Prävention von Asthma bei einem Patienten. Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid zur Behandlung oder Prävention von Asthma bei einem Patienten, wobei das genannte Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen. Verwendung eines immunstimulatorischen CpG-Oligonukleotids, das eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen, zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunpotenzierenden Cytokin zur Behandlung eines Patienten, der eine Virusinfektion hat. Verwendung eines immunpotenzierenden Cytokins zur Herstellung eines Arzneimittels zur Anwendung zusammen mit einem immunstimulatorischen CpG-Oligonukleotid zur Behandlung eines Patienten, der eine Virusinfektion hat, wobei das genannte Oligonukleotid eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23 worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen. Verwendung nach einem der Ansprüche 31 bis 40, worin das genannte Arzneimittel zur Anwendung zusammen mit einem Antigen bestimmt ist. Verwendung nach Anspruch 17 bis 21, 27, 30 oder 41, worin das Antigen ein natürliches Pflanzen- oder ein natürliches Tierallergen darstellt. Verwendung nach Anspruch 27, 30 oder 41, worin das genannte Antigen ein Krebsantigen, ein mikrobielles Antigen oder ein Allergen darstellt. Verwendung nach einem der Ansprüche 28 bis 43, worin das Cytokin aus der Gruppe ausgewählt ist, bestehend aus GM-CSF, IL-2, IL-3, IL-5, IL-12 und Interferon-&ggr;. Verwendung nach einem der Ansprüche 28 bis 43, worin das Cytokin GM-CSF darstellt. Verwendung nach einem der Ansprüche 28 bis 43, worin das immunpotenzierende Cytokin und das immunstimulatorische CpG-Oligonukleotid in einer einzelnen Zusammensetzung bereitgestellt oder in getrennten Zusammensetzungen bereitgestellt sind. Verwendung nach einem der Ansprüche 28 bis 46, worin G in der Formel: 5'X1CGX23' unmethyliert ist. Verwendung nach einem der Ansprüche 28 bis 47, worin das immunstimulatorische CpG-Oligonukleotid eine Größe von 8 bis 100 Nukleotiden aufweist. Verwendung nach einem der Ansprüche 28 bis 48, worin das Cytokin in der Form eines Antigen-Cytokin-Fusionsproteins vorliegt. Verwendung nach einem der Ansprüche 28 bis 49, worin das Antigen-Cytokin-Fusionsprotein ein Antigen-GM-CSF-Fusionsprotein darstellt. Verwendung nach Anspruch 31, worin das genannte Arzneimittel zur Verabreichung an einen Tumor in genanntem Patienten mit der genannten neoplastischen Erkrankung bestimmt ist. Verwendung nach Anspruch 51, worin das genannte Arzneimittel zusammen mit einem Antigen verabreicht wird. Verwendung nach Anspruch 52, worin genanntes Antigen ein Krebsantigen darstellt. Verwendung nach einem der Ansprüche 25, 29 oder 51 bis 53, worin der Tumor aus der Gruppe ausgewählt ist, bestehend aus einem Hirn-, Lungen-, Ovarial-, Brust-, Prostata-, Kolon-, Haut- und Bluttumor. Verwendung nach einem der Ansprüche 27 bis 54, worin der genannte Patient gegenüber einem Antigen exponiert ist, das aus der Gruppe ausgewählt ist, bestehend aus einem Tumorantigen, einem mikrobiellen Antigen und einem Allergen. Verwendung nach Anspruch 55, worin das Antigen ein Tumorantigen darstellt. Produkt, umfassend ein immunstimulatorisches CpG-Oligonukleotid, das eine Sequenz aufweist, die mindestens die folgende Formel einschließt: 5'X1CGX23' worin das Oligonukleotid mindestens 8 Nukleotide einschließt, C unmethyliert ist und X1 und X2 Nukleotide darstellen, ein immunpotenzierendes Cytokin und ein Antigen zur simultanen, getrennten oder sequenziellen Anwendung in einem kombinierten therapeutischen oder prophylaktischen Verfahren. Verwendung nach einem der Ansprüche 17, 25, 31 oder 32, worin die neoplastische Erkrankung aus der Gruppe ausgewählt ist, bestehend aus einem Sarkom, Karzinom, Fibrom, Lymphom, Melanom, Neuroblastom, Retinoblastom, Gliom, Gallengangkarzinom, Hirnkarzinom, Brustkarzinom, Zervikalkarzinom, Choriokarzinom, Kolonkarzinom, Endometriumkarzinom, Ösophaguskarzinom, Magenkarzinom, intraepithelialen Neoplasmen, Leberkarzinom, Lungenkarzinom (kleinzelligem und nicht-kleinzelligem), Oralkarzinom, Ovarialkarzinom, Pankreaskarzinom, Prostatakarzinom, Rektalkarzinom, Hautkarzinom, Hodenkarzinom, Schilddrüsenkarzinom oder Nierenkarzinom. Verwendung nach einem der Ansprüche 18, 39 oder 40, worin die Virusinfektion aus der Gruppe ausgewählt ist, bestehend aus dem HIV, Hepatitis-B-Virus oder Hepatitis-C-Virus.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com